Nucleolar p14ARF Overexpression in Reed-Sternberg Cells in Hodgkin's Lymphoma
2002; Elsevier BV; Volume: 160; Issue: 2 Linguagem: Inglês
10.1016/s0002-9440(10)64876-6
ISSN1525-2191
AutoresJuan F. Garcı́a, Raquel Villuendas, Margarita Sánchez‐Beato, Abel Sánchez‐Aguilera, Lydia Sánchez, Ignacio Priéto, Miguel Á. Piris,
Tópico(s)Epigenetics and DNA Methylation
ResumoThe development of human cancers is frequently associated with the silencing of the two major tumor suppressor pathways represented by retinoblastoma protein and p53. As the incidence of p53 mutations is significantly lower in Hodgkin's lymphoma than in other neoplasias, we investigated whether the malfunction of other proteins in this pathway could be responsible for its inactivation. Because the existence of nucleolar complexes between p14ARF and Hdm2 has been described as having a critical effect on p53 function by inhibiting its degradation, we analyzed the expression and subcellular localization of these proteins in 52 cases and in Hodgkin's cell lines. Two of four cell lines revealed loss of p14ARF expression secondary to gene promoter methylation, this being mutually exclusive with p53 mutations (1 of 4), illustrating the existence of selective pressure to inactivate the p53 pathway. The majority of Hodgkin's samples showed a strong nucleolar expression of p14ARF that was not associated with Hdm2. They also showed the existence of Hdm2/p53 complexes, and the absence of complexes containing either p14ARF/Hdm2 or p14ARF/p53. The different localization of Hdm2 (nucleoplasm) and p14ARF (nucleoli) observed in Hodgkin's tumors and cell lines is associated with the presence of short alternatively spliced transcripts of Hdm2 lacking the ARF-binding region and the nuclear export signal. The absence of these p14ARF/Hdm2 nucleolar complexes could be sufficient to inactivate the pathway and may explain the low frequency of p53 mutations in this tumor. The development of human cancers is frequently associated with the silencing of the two major tumor suppressor pathways represented by retinoblastoma protein and p53. As the incidence of p53 mutations is significantly lower in Hodgkin's lymphoma than in other neoplasias, we investigated whether the malfunction of other proteins in this pathway could be responsible for its inactivation. Because the existence of nucleolar complexes between p14ARF and Hdm2 has been described as having a critical effect on p53 function by inhibiting its degradation, we analyzed the expression and subcellular localization of these proteins in 52 cases and in Hodgkin's cell lines. Two of four cell lines revealed loss of p14ARF expression secondary to gene promoter methylation, this being mutually exclusive with p53 mutations (1 of 4), illustrating the existence of selective pressure to inactivate the p53 pathway. The majority of Hodgkin's samples showed a strong nucleolar expression of p14ARF that was not associated with Hdm2. They also showed the existence of Hdm2/p53 complexes, and the absence of complexes containing either p14ARF/Hdm2 or p14ARF/p53. The different localization of Hdm2 (nucleoplasm) and p14ARF (nucleoli) observed in Hodgkin's tumors and cell lines is associated with the presence of short alternatively spliced transcripts of Hdm2 lacking the ARF-binding region and the nuclear export signal. The absence of these p14ARF/Hdm2 nucleolar complexes could be sufficient to inactivate the pathway and may explain the low frequency of p53 mutations in this tumor. Most common neoplasias accumulate inactivation of both the p53 and Rb pathways, these tumor suppressor genes being silenced by a diverse repertoire of genetic and epigenetic mechanisms.1Nurse P A long twentieth century of the cell cycle and beyond.Cell. 2000; 100: 71-78Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar The INK4a/ARF locus encodes two tumor suppressor proteins specified by the use of alternative reading frames within a common second exon of both genes. p16 INK4a is an inhibitor of cyclin D-dependent kinases that prevents the phosphorylation of Rb.2Quelle DE Zindy F Ashmun RA Sherr CJ Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest.Cell. 1995; 83: 993-1000Abstract Full Text PDF PubMed Scopus (1307) Google Scholar In contrast, murine p19ARF (and p14ARF in humans) increases the stability and expression of p53.3Kamijo T Weber JD Zambetti G Zindy F Roussel MF Sherr CJ Functional and physical interactions of the ARF tumor suppressor with p53 and Mdm2.Proc Natl Acad Sci USA. 1998; 95: 8292-8297Crossref PubMed Scopus (783) Google Scholar, 4Zhang Y Xiong Y Yarbrough WG ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways.Cell. 1998; 92: 725-734Abstract Full Text Full Text PDF PubMed Scopus (1392) Google Scholar, 5Pomerantz J Schreiber-Agus N Liegeois NJ Silverman A Alland L Chin L Potes J Chen K Orlow I Lee HW Cordon-Cardo C DePinho RA The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2's inhibition of p53.Cell. 1998; 92: 713-723Abstract Full Text Full Text PDF PubMed Scopus (1324) Google Scholar, 6Kamijo T Zindy F Roussel MF Quelle DE Downing JR Ashmun RA Grosveld G Sherr CJ Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF.Cell. 1997; 91: 649-659Abstract Full Text Full Text PDF PubMed Scopus (1373) Google Scholar Although in Hodgkin's lymphoma (HL) inactivation of the p16-Rb pathway has been shown to take place in the majority of cases as a consequence of p16INK4a gene methylation,7Garcia JF Villuendas R Algara P Saez AI Sanchez-Verde L Martinez-Montero JC Martinez P Piris MA Loss of p16 protein expression associated with methylation of the p16INK4A gene is a frequent finding in Hodgkin's disease.Lab Invest. 1999; 79: 1453-1459PubMed Google Scholar there has been no unequivocal demonstration of the silencing of the p53 pathway. Thus, the frequency of p53 mutation is distinctly lower in HL than it is in other tumoral conditions, as has been shown by different research groups.8Elenitoba-Johnson KS Medeiros LJ Khorsand J King TC P53 expression in Reed-Sternberg cells does not correlate with gene mutations in Hodgkin's disease.Am J Clin Pathol. 1996; 106: 728-738PubMed Google Scholar, 9Sanchez-Beato M Piris MA Martinez-Montero JC Garcia JF Villuendas R Garcia FJ Orradre JL Martinez P MDM2 and p21WAF1/CIP1, wild-type p53-induced proteins, are regularly expressed by Sternberg-Reed cells in Hodgkin's disease.J Pathol. 1996; 180: 58-64Crossref PubMed Scopus (31) Google Scholar, 10Montesinos-Rongen M Roers A Kuppers R Rajewsky K Hansmann ML Mutation of the p53 gene is not a typical feature of Hodgkin and Reed-Sternberg cells in Hodgkin's disease.Blood. 1999; 94: 1755-1760PubMed Google ScholarThe p53 pathway is critically dependent on the status of p53 and its interactions with Hdm2 (the human counterpart of murine Mdm2) and p14ARF.11Sherr CJ Weber JD The ARF/p53 pathway.Curr Opin Genet Dev. 2000; 10: 94-99Crossref PubMed Scopus (571) Google Scholar p53 accumulates in response to DNA damage or oncogenic signaling, primarily through protein stabilization after disruption of its interaction with its negative regulator, Hdm2.5Pomerantz J Schreiber-Agus N Liegeois NJ Silverman A Alland L Chin L Potes J Chen K Orlow I Lee HW Cordon-Cardo C DePinho RA The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2's inhibition of p53.Cell. 1998; 92: 713-723Abstract Full Text Full Text PDF PubMed Scopus (1324) Google Scholar, 12Prives C Signaling to p53: breaking the MDM2–p53 circuit.Cell. 1998; 95: 5-8Abstract Full Text Full Text PDF PubMed Scopus (627) Google Scholar Hdm2 opposes p53 function at several levels. It can bind to the N-terminal transcriptional activation domain of p53 to block the expression of p53-responsive genes.13Momand J Zambetti GP Olson DC George D Levine AJ The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation.Cell. 1992; 69: 1237-1245Abstract Full Text PDF PubMed Scopus (2776) Google Scholar, 14Momand J Wu HH Dasgupta G MDM2—master regulator of the p53 tumor suppressor protein.Gene. 2000; 242: 15-29Crossref PubMed Scopus (520) Google Scholar, 15Oliner JD Pietenpol JA Thiagalingam S Gyuris J Kinzler KW Vogelstein B Oncoprotein MDM2 conceals the activation domain of tumour suppressor p53.Nature. 1993; 362: 857-860Crossref PubMed Scopus (1297) Google Scholar Additionally, Hdm2 has an intrinsic E3 ligase activity that conjugates ubiquitin to p53,16Honda R Tanaka H Yasuda H Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53.FEBS Lett. 1997; 420: 25-27Abstract Full Text Full Text PDF PubMed Scopus (1587) Google Scholar, 17Honda R Yasuda H Association of p19(ARF) with Mdm2 inhibits ubiquitin ligase activity of Mdm2 for tumor suppressor p53.EMBO J. 1999; 18: 22-27Crossref PubMed Scopus (612) Google Scholar playing a role in shuttling p53 from the nucleus to the cytoplasm, where p53 is degraded in the proteasomes.18Tao W Levine AJ Nucleocytoplasmic shuttling of oncoprotein Hdm2 is required for Hdm2-mediated degradation of p53.Proc Natl Acad Sci USA. 1999; 96: 3077-3080Crossref PubMed Scopus (297) Google Scholar, 19Tao W Levine AJ P19(ARF) stabilizes p53 by blocking nucleo-cytoplasmic shuttling of Mdm2.Proc Natl Acad Sci USA. 1999; 96: 6937-6941Crossref PubMed Scopus (495) Google Scholar, 20Freedman DA Levine AJ Nuclear export is required for degradation of endogenous p53 by MDM2 and human papillomavirus E6.Mol Cell Biol. 1998; 18: 7288-7293Crossref PubMed Scopus (457) Google ScholarIn murine models, the interaction of p53 with Mdm2 is dependent on the interaction of both proteins with p19ARF. It has been shown under different experimental conditions that the nucleolar sequestration of Mdm2 by p19ARF antagonizes the ubiquitination of p53 and its transport to the cytoplasm, inducing p53 stabilization and activation in the nucleoplasm, and leads to the induction of a battery of p53-responsive genes.18Tao W Levine AJ Nucleocytoplasmic shuttling of oncoprotein Hdm2 is required for Hdm2-mediated degradation of p53.Proc Natl Acad Sci USA. 1999; 96: 3077-3080Crossref PubMed Scopus (297) Google Scholar, 19Tao W Levine AJ P19(ARF) stabilizes p53 by blocking nucleo-cytoplasmic shuttling of Mdm2.Proc Natl Acad Sci USA. 1999; 96: 6937-6941Crossref PubMed Scopus (495) Google Scholar, 21Weber JD Taylor LJ Roussel MF Sherr CJ Bar-Sagi D Nucleolar Arf sequesters Mdm2 and activates p53.Nat Cell Biol. 1999; 1: 20-26Crossref PubMed Scopus (795) Google Scholar According to this model, p14ARF inactivation or Hdm2 overexpression occurs more commonly in human tumor cells that retain wild-type p53, consistent with the hypothesis that disruption of the ARF-Hdm2-p53 pathway is important in the commonest types of cancer.22Pinyol M Hernandez L Martinez A Cobo F Hernandez S Bea S Lopez-Guillermo A Nayach I Palacin A Nadal A Fernandez PL Montserrat E Cardesa A Campo E INK4a/ARF locus alterations in human non-Hodgkin's lymphomas mainly occur in tumors with wild-type p53 gene.Am J Pathol. 2000; 156: 1987-1996Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 23Sarkar S Julicher KP Burger MS Della Valle V Larsen CJ Yeager TR Grossman TB Nickells RW Protzel C Jarrard DF Reznikoff CA Different combinations of genetic/epigenetic alterations inactivate the p53 and pRb pathways in invasive human bladder cancers.Cancer Res. 2000; 60: 3862-3871PubMed Google Scholar, 24Sherr CJ The Pezcoller lecture: cancer cell cycles revisited.Cancer Res. 2000; 60: 3689-3695PubMed Google Scholar, 25Ichimura K Bolin MB Goike HM Schmidt EE Moshref A Collins VP Deregulation of the p14ARF/MDM2/p53 pathway is a prerequisite for human astrocytic gliomas with G1-S transition control gene abnormalities.Cancer Res. 2000; 60: 417-424PubMed Google Scholar, 26Esteller M Tortola S Toyota M Capella G Peinado MA Baylin SB Herman JG Hypermethylation-associated inactivation of p14(ARF) is independent of p16(INK4a) methylation and p53 mutational status.Cancer Res. 2000; 60: 129-133PubMed Google Scholar, 27Gazzeri S Della Valle V Chaussade L Brambilla C Larsen CJ Brambilla E The human p19ARF protein encoded by the beta transcript of the p16INK4a gene is frequently lost in small cell lung cancer.Cancer Res. 1998; 58: 3926-3931PubMed Google ScholarPrevious studies have shown that the Hdm2 protein has a nucleolar localization signal (NrLS) contained within the C-terminus RING-finger domain,28Lohrum MA Ashcroft M Kubbutat MH Vousden KH Identification of a cryptic nucleolar-localization signal in MDM2.Nat Cell Biol. 2000; 2: 179-181Crossref PubMed Scopus (170) Google Scholar, 29Weber JD Kuo ML Bothner B DiGiammarino EL Kriwacki RW Roussel MF Sherr CJ Cooperative signals governing ARF-mdm2 interaction and nucleolar localization of the complex.Mol Cell Biol. 2000; 20: 2517-2528Crossref PubMed Scopus (244) Google Scholar and also contains a central ARF-binding domain.4Zhang Y Xiong Y Yarbrough WG ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways.Cell. 1998; 92: 725-734Abstract Full Text Full Text PDF PubMed Scopus (1392) Google Scholar, 5Pomerantz J Schreiber-Agus N Liegeois NJ Silverman A Alland L Chin L Potes J Chen K Orlow I Lee HW Cordon-Cardo C DePinho RA The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2's inhibition of p53.Cell. 1998; 92: 713-723Abstract Full Text Full Text PDF PubMed Scopus (1324) Google Scholar, 6Kamijo T Zindy F Roussel MF Quelle DE Downing JR Ashmun RA Grosveld G Sherr CJ Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF.Cell. 1997; 91: 649-659Abstract Full Text Full Text PDF PubMed Scopus (1373) Google Scholar, 30Stott FJ Bates S James MC McConnell BB Starborg M Brookes S Palmero I Ryan K Hara E Vousden KH Peters G The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2.EMBO J. 1998; 17: 5001-5014Crossref PubMed Scopus (1007) Google Scholar The NrLS in Hdm2 seems normally to be concealed and is unmasked by conformational changes after p14ARF binding.28Lohrum MA Ashcroft M Kubbutat MH Vousden KH Identification of a cryptic nucleolar-localization signal in MDM2.Nat Cell Biol. 2000; 2: 179-181Crossref PubMed Scopus (170) Google Scholar Therefore, cell-cycle arrest by human p14ARF requires both binding and nucleolar importation of Hdm2. This nucleolar compartmentalization of the p14ARF/Hdm2 complexes is critical for the capacity of p14ARF to inhibit cell-cycle progression.The interaction between p14ARF and Hdm2 is bi-directional, each protein being capable of regulating the subnuclear localization of the other.29Weber JD Kuo ML Bothner B DiGiammarino EL Kriwacki RW Roussel MF Sherr CJ Cooperative signals governing ARF-mdm2 interaction and nucleolar localization of the complex.Mol Cell Biol. 2000; 20: 2517-2528Crossref PubMed Scopus (244) Google Scholar Murine p19ARF mutants that bind Mdm2 but fail to move it into the nucleolus do not trigger p53-dependent responses.21Weber JD Taylor LJ Roussel MF Sherr CJ Bar-Sagi D Nucleolar Arf sequesters Mdm2 and activates p53.Nat Cell Biol. 1999; 1: 20-26Crossref PubMed Scopus (795) Google Scholar The existence of complexes containing both Hdm2 and p14ARF that lead to inactivation of Hdm2 has also been demonstrated in human tumoral cells.31Lindstrom MS Klangby U Inoue R Pisa P Wiman KG Asker CE Immunolocalization of human p14(ARF) to the granular component of the interphase nucleolus.Exp Cell Res. 2000; 256: 400-410Crossref PubMed Scopus (74) Google Scholar, 32Zhang Y Xiong Y Mutations in human ARF exon 2 disrupt its nucleolar localization and impair its ability to block nuclear export of MDM2 and p53.Mol Cell. 1999; 3: 579-591Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar However, there is controversy about the exact localization of these complexes, which under some experimental conditions has been found to be mainly nucleoplasmic.32Zhang Y Xiong Y Mutations in human ARF exon 2 disrupt its nucleolar localization and impair its ability to block nuclear export of MDM2 and p53.Mol Cell. 1999; 3: 579-591Abstract Full Text Full Text PDF PubMed Scopus (341) Google ScholarThe interaction of Hdm2 with p14ARF and p53 is critically dependent on the integrity of the Hdm2 molecule, and specifically on the NrLS, p14ARF-binding domain, p53-binding domain, and nuclear-export signal (NES). The analysis of Hdm2 transcripts and protein, both in human tumors and cell lines have revealed the presence of various alternatively spliced Hdm2 transcripts,33Gudas JM Nguyen H Klein RC Katayose D Seth P Cowan KH Differential expression of multiple MDM2 messenger RNAs and proteins in normal and tumorigenic breast epithelial cells.Clin Cancer Res. 1995; 1: 71-80PubMed Google Scholar, 34Sigalas I Calvert AH Anderson JJ Neal DE Lunec J Alternatively spliced mdm2 transcripts with loss of p53 binding domain sequences: transforming ability and frequent detection in human cancer.Nat Med. 1996; 2: 912-917Crossref PubMed Scopus (251) Google Scholar, 35Matsumoto R Tada M Nozaki M Zhang CL Sawamura Y Abe H Short alternative splice transcripts of the mdm2 oncogene correlate to malignancy in human astrocytic neoplasms.Cancer Res. 1998; 58: 609-613PubMed Google Scholar whose functional significance remains to be examined. It is of particular note that many of these Hdm2-spliced forms have lost the central region of the protein, including the p14ARF-binding region, and the NES.In HL, the presumed inactivation of the p53 pathway seems to be achieved mainly through an alternative mechanism to p53 mutations. This prompted us to study the expression and subcellular localization of p14ARF and its relationship with other proteins in the p53 pathway, in particular Hdm2, in this disease. The results revealed an increased nucleolar expression of p14ARF and an absence of nucleolar or nucleoplasmic p14ARF/Hdm2 complexes. Moreover, overexpression of Hdm2 protein in Reed-Sternberg (RS) cells is associated with the expression of several alternatively spliced transcripts that lack the p14ARF-binding domain, which could be the basis of the malfunction of the p53 pathway in this tumor.Materials and MethodsTissue SamplesTwenty samples of reactive lymphoid tissue (tonsils and reactive lymphadenitis) and 52 tumor specimens from HL cases were obtained from the tissue archives of the CNIO tumor bank. All specimens were obtained from previously untreated cases of HL, and were diagnosed according to the criteria used in the Revised European–American Lymphoma classification,36Harris NL Jaffe ES Stein H Banks PM Chan JK Cleary ML Delsol G De Wolf-Peeters C Falini B Gatter KC A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group.Blood. 1994; 84: 1361-1392PubMed Google Scholar and the World Health Organization classification.37Harris NL Jaffe ES Diebold J Flandrin G Muller-Hermelink HK Vardiman J Lister TA Bloomfield CD World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting–Airlie House, Virginia, November 1997.J Clin Oncol. 1999; 17: 3835-3849Crossref PubMed Scopus (2499) Google Scholar They included 23 cases of nodular sclerosis HL, 17 cases of mixed cellularity HL, 1 case of lymphocyte-rich classical HL, 3 cases of lymphocyte depletion HL, and 7 cases of nodular lymphocyte-predominant HL.Cell LinesFour HL-derived cell lines (HDLM2, L428, L540, and KMH2) were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). Normal peripheral blood lymphocytes (PBLs) were obtained from voluntary healthy donors. All cells were cultured in RPMI 1640 medium (Life Technologies, Inc., Grand Island, NY) supplemented with 10 or 20% heat-inactivated fetal calf serum (Life Technologies, Inc.), glutamine, penicillin, and streptomycin. Cells were grown at 37°C in 5% CO2. Peripheral blood lymphocytes were additionally supplemented with 2% phytohemagglutinin (Life Technologies, Inc.). For immunostaining, cells were harvested by centrifugation, washed with cold phosphate-buffered saline (PBS), cytospun onto poly-l-lysine-coated slides, and fixed in 50% ethanol/50% acetone.Antibodies (Abs)p14ARF protein was detected with a goat polyclonal Ab (C-18; Santa Cruz Biotechnology, Santa Cruz, CA).31Lindstrom MS Klangby U Inoue R Pisa P Wiman KG Asker CE Immunolocalization of human p14(ARF) to the granular component of the interphase nucleolus.Exp Cell Res. 2000; 256: 400-410Crossref PubMed Scopus (74) Google Scholar, 38Takemoto S Trovato R Cereseto A Nicot C Kislyakova T Casareto L Waldmann T Torelli G Franchini G p53 stabilization and functional impairment in the absence of genetic mutation or the alteration of the p14(ARF)-MDM2 loop in ex vivo and cultured adult T-cell leukemia/lymphoma cells.Blood. 2000; 95: 3939-3944Crossref PubMed Google Scholar The staining of nucleoli in some endothelial cells, macrophages, and small lymphocytes provided an internal control. Nucleolin-C23 was detected with a monoclonal Ab (MS-3, Santa Cruz). Nucleolin expression was used as a nucleolar marker.39Smetana K Ochs R Lischwe MA Gyorkey F Freireich E Chudomel V Busch H Immunofluorescence studies on proteins B23 and C23 in nucleoli of human lymphocytes.Exp Cell Res. 1984; 152: 195-203Crossref PubMed Scopus (27) Google Scholar, 40Lischwe MA Richards RL Busch RK Busch H Localization of phosphoprotein C23 to nucleolar structures and to the nucleolus organizer regions.Exp Cell Res. 1981; 136: 101-109Crossref PubMed Scopus (130) Google Scholar Human Hdm2 protein was detected with the monoclonal Ab MDM2 Ab-1 (IF-2; Oncogene Research, Cambridge, MA). IF-2 recognizes an epitope within amino acid residues 26 to 169 of human Hdm2 protein. We used the monoclonal Ab DO7 (Novocastra, Newcastle on Tyne, UK) for p53 protein analyses, and rabbit polyclonal Ab CM1 (Novocastra) for double immunolabeling Hdm2-p53.Immunostaining TechniquesAll immunostaining techniques were performed in paraffin-embedded tissue sections and cytospin preparations of the different HL-derived cell lines, using an initial heat-induced antigen retrieval step (slides were heated in a pressure cooker for 3 minutes in a 0.01 mol/L solution of sodium citrate before incubation with the Abs).After incubation with the primary Ab, immunodetection was performed with biotinylated anti-mouse or anti-goat immunoglobulins as appropriate, followed by peroxidase-labeled streptavidin (LSAB-DAKO; Glostrup, Denmark) and diaminobenzidine chromogen as substrate. All immunostaining was performed using the Techmate 500 (DAKO) automatic immunostaining device. Incubations either omitting the specific Ab or containing unrelated Abs were used as a control of the technique.For double-immunolabeling and laser confocal analyses, 3-μm-thick paraffin-embedded tissue sections from reactive lymphoid tissues (tonsils) and eight neoplastic specimens with different levels of p14ARF expression, were cut and mounted on poly-l-lysine-coated slides, and stained with polyclonal anti-p14ARF and either monoclonal anti-Hdm2, or monoclonal anti-nucleolin, or monoclonal anti-p53. After simultaneous overnight incubation at 4°C with the primary Abs, sections were washed in PBS and incubated with secondary Abs: Alexa 488-conjugated donkey anti-goat IgG (Molecular Probes, Eugene, OR), Alexa 488-conjugated donkey anti-rabbit IgG (Molecular Probes), and Cy3-conjugated goat anti-mouse IgG, (Jackson Immuno Research, Baltimore, MD). For immunofluorescence analyses, tissue sections were counterstained using 4,6-diamidino-2-phenylindole (DAPI) (Molecular Probes) and directly visualized under a DMRA microscope (Leica Microsystems, Wetzlar, Germany) fitted with appropriate fluorescence filters. For laser confocal analyses in cell lines, nuclei were stained with TO-PRO3 (Molecular Probes), mounted with glycerol and examined with a laser-scanning confocal microscopy system TCS NT (Leica Microsystems). Series of images were processed and analyzed with the accompanying software package (Leica Microsystems) and Adobe Photoshop 5.5 image-processing software.ImmunoprecipitationFor p53 and Hdm2 immunoprecipitation, the L428 cell line was harvested by centrifugation, washed with cold PBS, and lysed with buffer (50 mmol/L Tris-HCl, pH 8, 1% Triton X-100, 150 mmol/L NaCl, and protease inhibitors). Lysed cells (1 mg of protein) were incubated with primary Abs and protein A/G, and filtered using the IMMUNOcatcher kit (CytoSignal, Irvine, CA) following the manufacturer's instructions. Immunoprecipitates were electrophoresed by 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and blotted onto nitrocellulose membranes (Hybond ECL, Amersham, UK). Membranes were serially incubated with anti-Hdm2 or anti-p53 primary Abs and anti-mouse (Amersham) horseradish peroxidase-labeled secondary Abs, followed by detection with the enhanced chemiluminescence system (Amersham). The anti-p14ARF Ab used for these experiments is not suitable for detecting endogenous protein and complexes in this model.Methylation Study and 5-Aza-2′-Deoxycytidine Treatment in Hodgkin's-Derived Cell LinesMethylation-specific polymerase chain reaction (PCR) assays were performed to analyze the methylation status of CpG islands of the promoter region of p14ARF gene in DNA extracted from the different HL-derived cell lines used in this study, as previously described.26Esteller M Tortola S Toyota M Capella G Peinado MA Baylin SB Herman JG Hypermethylation-associated inactivation of p14(ARF) is independent of p16(INK4a) methylation and p53 mutational status.Cancer Res. 2000; 60: 129-133PubMed Google Scholar Briefly, 1 μg of denatured genomic DNA was modified by reaction with sodium bisulfite under conditions that convert all unmethylated cytosines to uracils. Modification was completed by NaOH, 0.3 mol/L, treatment for 5 minutes at room temperature, followed by ethanol precipitation.Fifty ng of bisulfite-modified DNA was amplified using previously described p14ARF unmethylated-specific primers (U)41Xing EP Nie Y Song Y Yang GY Cai YC Wang LD Yang CS Mechanisms of inactivation of p14ARF, p15INK4b, and p16INK4a genes in human esophageal squamous cell carcinoma.Clin Cancer Res. 1999; 5: 2704-2713PubMed Google Scholar and methylated-specific primers (M),26Esteller M Tortola S Toyota M Capella G Peinado MA Baylin SB Herman JG Hypermethylation-associated inactivation of p14(ARF) is independent of p16(INK4a) methylation and p53 mutational status.Cancer Res. 2000; 60: 129-133PubMed Google Scholar with 1 U of AmpliTaq Gold (Applied Biosystems, Weiterstadt, Germany) under the following conditions: 30 seconds at 94°C, 30 seconds at 60°C, and 30 seconds at 72°C, for 35 cycles. Controls without DNA and positive controls for U and M reactions were performed for each set of PCRs. The PCR product was visualized under UV illumination in agarose gels stained with ethidium bromide.Additionally, to confirm that loss of p14ARF protein expression is the result of gene promoter hypermethylation, we subjected the methylated cell lines to different doses (1 to 3 μmol) of the demethylating agent 5-aza-2′-deoxycytidine (Sigma, St. Louis, MO) for 3 days.Mutation Study in the Hodgkin's-Derived Cell LinesDNA from the four cell lines was analyzed for mutations in exons 5 to 8 of the p53 gene using previously described primers and conditions.42Villuendas R Piris MA Algara P Sanchez-Beato M Sanchez-Verde L Martinez JC Orradre JL Garcia P Lopez C Martinez P The expression of p53 protein in non-Hodgkin's lymphomas is not always dependent on p53 gene mutations.Blood. 1993; 82: 3151-3156PubMed Google Scholar The HDLM2 cell line was additionally amplified for exons 9 and 10.The mutational study of p14ARF gene comprised exon 1β and exon 2. For amplification of p14ARF exon 1β the primers used were as follows: GCCTGCGGGGCGGAGAT (sense) and AGGGCTGTGTGAAGGGAGGTC (antisense). Briefly, 200 ng of DNA were amplified with 25 pmol of each primer, 200 μmol/L of each dNTP, and 1 U of AmpliTaq Gold (Applied Biosystems, Foster City, CA). The conditions were 30 seconds at 94°C, 30 seconds at 56°C, and 30 seconds at 72°C, for 35 cycles. Primers and conditions for p14ARF exon 2 amplification have been previously described.43Villuendas R Sanchez-Beato M Martinez JC Saez AI Martinez-Delgado B Garcia JF Mateo MS Sanchez-Verde L Benitez J Martinez P Piris MA Loss of p16/INK4A protein expression in non-Hodgkin's lymphomas is a frequent finding associated with tumor progression.Am J Pathol. 1998; 153: 887-897Abstract Full Text Full Text PDF PubMed Scopus (112) Google ScholarPCR products were purified using the QIAquick PCR Purification Kit (Qiagen Inc., Valencia, CA) and directly sequenced with an automated DNA Sequencer ABI PRISM 3700 Genetic Analyzer (Applied Biosystems, CA) in the DNA Sequencing Core Service of the CNIO.Nested Reverse Transcriptase (RT)-PCR for HDM2 TranscriptsTotal RNA was extracted from cultured cells with the RNAeasy MiniKit (Qiagen). cDNA synthesis was performed with random primers and AMV reverse transcriptase at 42°C for 1 hour. A 1526-bp fragment (for the full-length Hdm2 transcript) was amplified using nested PCR primers and conditions as previously described.35Matsumoto R Tada M Nozaki M Zhang CL Sawamura Y Abe H Short alternative splice transcripts of the mdm2 oncogene correlate to malignancy in human astrocytic neoplasms.Cancer Res. 1998; 58: 609-613PubMed Google Scholar To corroborate the identity of the different PCR products, each band was purified from the gel and directly sequenced.Resultsp14ARF Is Expressed in the Nucleoli of Tumoral Cells in Some HL-Derived Cell LinesL428 and HDLM2 HL-derived cell lines displayed strong p14ARF expression (Figure 1A). Localization of the protein was always nucleolar, with variable numbers of positive cells (greater in the HDLM2 than in th
Referência(s)