Expression of Microtubule-Associated Protein 2 in Benign and Malignant Melanocytes
2001; Elsevier BV; Volume: 158; Issue: 6 Linguagem: Inglês
10.1016/s0002-9440(10)64682-2
ISSN1525-2191
AutoresDong Fang, James R. Hallman, Namrata Sangha, Timothy E. Kute, James A. Hammarback, Wain L. White, Vijayasaradhi Setaluri,
Tópico(s)Melanoma and MAPK Pathways
ResumoCutaneous melanocytic neoplasms are known to acquire variable characteristics of neural crest differentiation. Melanocytic nevus cells in the dermis and desmoplastic melanomas often display characteristics of nerve sheath differentiation. The extent and nature of neuronal differentiation characteristics displayed by primary and metastatic melanoma cells are not well understood. Here, we describe induction of a juvenile isoform of microtubule-associated protein 2 (MAP-2c) in cultured metastatic melanoma cells by the differentiation inducer hexamethylene bisacetamide. Up-regulation of this MAP-2 isoform, a marker for immature neurons, is accompanied by extended dendritic morphology and down-regulation of tyrosinase-related protein 1 (TYRP1/gp75), a melanocyte differentiation marker. In a panel of cell lines that represent melanoma tumor progression, MAP-2c mRNA and the corresponding ∼70-kd protein could be detected predominantly in primary melanomas. Immunohistochemical analysis of 61 benign and malignant melanocytic lesions showed abundant expression of MAP-2 protein in melanocytic nevi and in the in situ and invasive components of primary melanoma, but only focal heterogeneous expression in a few metastatic melanomas. In contrast, MAP-2-positive dermal nevus cells and the invasive cells of primary melanomas were TYRP1-negative. This reciprocal staining pattern in vivo is similar to the in vitro observation that induction of the neuronal marker MAP-2 in metastatic melanoma cells is accompanied by selective extinction of the melanocytic marker TYRP1. Our data show that neoplastic melanocytes, particularly at early stages, retain the plasticity to express the neuron-specific marker MAP-2. These observations are consistent with the premise that both benign and malignant melanocytes in the dermis can express markers of neuronal differentiation. Cutaneous melanocytic neoplasms are known to acquire variable characteristics of neural crest differentiation. Melanocytic nevus cells in the dermis and desmoplastic melanomas often display characteristics of nerve sheath differentiation. The extent and nature of neuronal differentiation characteristics displayed by primary and metastatic melanoma cells are not well understood. Here, we describe induction of a juvenile isoform of microtubule-associated protein 2 (MAP-2c) in cultured metastatic melanoma cells by the differentiation inducer hexamethylene bisacetamide. Up-regulation of this MAP-2 isoform, a marker for immature neurons, is accompanied by extended dendritic morphology and down-regulation of tyrosinase-related protein 1 (TYRP1/gp75), a melanocyte differentiation marker. In a panel of cell lines that represent melanoma tumor progression, MAP-2c mRNA and the corresponding ∼70-kd protein could be detected predominantly in primary melanomas. Immunohistochemical analysis of 61 benign and malignant melanocytic lesions showed abundant expression of MAP-2 protein in melanocytic nevi and in the in situ and invasive components of primary melanoma, but only focal heterogeneous expression in a few metastatic melanomas. In contrast, MAP-2-positive dermal nevus cells and the invasive cells of primary melanomas were TYRP1-negative. This reciprocal staining pattern in vivo is similar to the in vitro observation that induction of the neuronal marker MAP-2 in metastatic melanoma cells is accompanied by selective extinction of the melanocytic marker TYRP1. Our data show that neoplastic melanocytes, particularly at early stages, retain the plasticity to express the neuron-specific marker MAP-2. These observations are consistent with the premise that both benign and malignant melanocytes in the dermis can express markers of neuronal differentiation. Melanocytes arise from the neural crest, which also gives rise to peripheral neurons, glial cells, and neuroendocrine cell types.1Le Douarin NM The Neural Crest. Cambridge University Press, Cambridge1982Google Scholar Neoplastic melanocytes are known to exhibit certain differentiation characteristics of other neural crest derivatives. For example, some benign nevus cells that migrate into the dermis morphologically resemble Schwann cells of the peripheral nervous system.2Reed JA Finnerty B Albino AP Divergent cellular differentiation pathways during the invasive stage of cutaneous malignant melanoma progression.Am J Pathol. 1999; 155: 549-555Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar Similarly, desmoplastic (neurotropic) melanomas, which arise most often in sun-damaged skin, share many characteristics of peripheral nerve sheath tumors, including nerve involvement and expression of neural protein markers.3Sangueza OP Requena L Neoplasms with neural differentiation: a review.: Part II: malignant neoplasms.Am J Dermatopathol. 1998; 20: 89-102Crossref PubMed Scopus (63) Google Scholar Other studies have shown expression of neuron-associated markers such as intermediate filament protein peripherin, neuropeptide substance P, muscarinic acetylcholine receptors, and neuron-specific enolase in primary and metastatic melanomas.4Prieto VG McNutt NS Lugo J Reed JA The intermediate filament peripherin is expressed in cutaneous melanocytic lesions.J Cutan Pathol. 1997; 24: 145-150Crossref PubMed Scopus (31) Google Scholar, 5Khare VK Albino AP Reed JA The neuropeptide/mast cell secretagogue substance P is expressed in cutaneous melanocytic lesions.J Cutan Pathol. 1998; 25: 2-10Crossref PubMed Scopus (58) Google Scholar, 6Lammerding-Koppel M Noda S Blum A Schaumburg-Lever G Rassner G Drews U Immunohistochemical localization of muscarinic acetylcholine receptors in primary and metastatic malignant melanomas.J Cutan Pathol. 1997; 24: 137-144Crossref PubMed Scopus (38) Google Scholar, 7Dhillon AP Rode J Leathem A Neurone specific enolase: an aid to the diagnosis of melanoma and neuroblastoma.Histopathology. 1982; 6: 81-92Crossref PubMed Scopus (95) Google Scholar These observations suggest that human cutaneous melanocytes maintain plasticity of differentiation. Neoplastic transformation presumably allows them to exhibit characteristics of other neural crest derivatives. Although the dermal environment is thought to facilitate alternative pathways of differentiation in neoplastic melanocytes, signaling mechanisms involved in such trans-differentiation are not well understood.2Reed JA Finnerty B Albino AP Divergent cellular differentiation pathways during the invasive stage of cutaneous malignant melanoma progression.Am J Pathol. 1999; 155: 549-555Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar In this study, we describe expression of a neuron-selective marker microtubule-associated protein 2 (MAP-2) in melanoma in vivo and its induction in melanoma cells in vitro. MAPs are a family of proteins expressed predominantly in neuronal cells and are associated with the dendritic morphology of neurons.8Matus A Microtubule-associated proteins: their potential role in determining neuronal morphology.Ann Rev Neurosci. 1988; 11: 29-44Crossref PubMed Scopus (511) Google Scholar MAP-2, a neuron-specific MAP primarily localized to dendrites, stabilizes microtubule bundles and allows outgrowth of cellular processes.9Kosik KS Caceres A Tau protein and the establishment of an axonal morphology.J Cell Sci. 1991; 15: 69-74Crossref Google Scholar Multiple isoforms of MAP-2, which are regulated during development, have been described. Thus, whereas the high molecular weight (∼280 kd) mature forms, MAP-2a and MAP-2b, persist throughout the life of the neuron, the juvenile isoform (∼70 kd) MAP-2c, derived by alternative splicing of MAP-2 mRNA, appears during development and diminishes in adult neurons.10Graner CC Matus A Different forms of microtubule-associated protein 2 are encoded by separate mRNA transcripts.J Cell Biol. 1988; 106: 779-783Crossref PubMed Scopus (134) Google Scholar Expression of this neuron-selective MAP-2 in melanocytes and melanocytic lesions has not been investigated. Our data show that MAP-2 is expressed abundantly in a majority of melanocytic nevi and primary melanomas, but weakly and heterogeneously in a few metastatic melanomas in vivo. In metastatic melanoma cell lines in vitro, MAP-2 can be induced by treatment with hexamethylene bisacetamide (HMBA), a pharmacological compound known to induce terminal differentiation of mouse erythroleukemia cells and a variety of human tumor cells.11Rifkind RA Richon VM Marks PA Induced differentiation, the cell cycle, and the treatment of cancer.Pharmacol Ther. 1996; 69: 97-102Crossref PubMed Scopus (41) Google Scholar Induction of MAP-2 by HMBA is accompanied by polydendritic morphology and down-regulation of the melanocytic differentiation marker TYRP1/gp75. Treatment with HMBA does not repress other melanocytic markers tested including tyrosinase, DCT/TYRP2, SILV/Pmel17, and microphthalmia-associated transcription factor (MITF).12Fang D Setaluri V Role of microphthalmia transcription factor in regulation of melanocyte differentiation marker TRP-1.Biochem Biophys Res Commun. 1999; 256: 657-663Crossref PubMed Scopus (46) Google Scholar, 13Fang D Kute T Setaluri V Regulation of tyrosinase-related protein 2 (TYRP2) in human melanocytes: relationship to growth and dendritic morphology.Pigment Cell Res. 2001; 14: 132-139Crossref PubMed Scopus (58) Google Scholar This reciprocal relationship between the induction of MAP-2 and extinction of TYRP1 is also observed in the expression pattern of these two proteins in melanocytic neoplasms in vivo. The significance of this reciprocal expression of the melanocytic marker TYRP1 and the neuronal marker MAP-2 in differentiation of melanocytic lesions and the possible consequences of MAP-2 expression on melanoma tumor progression will be discussed. Primary culture of human melanocytes was initiated from neonatal foreskins. Fresh skin specimens were washed three times with Hanks’ balanced salt solution and excess fat was removed. The samples were cut into small pieces and incubated in 0.25% trypsin solution at 4°C overnight. Epidermis was separated from the dermis and epidermal cells were suspended and cultured in Ham’s F10 nutrient medium with 10% fetal bovine serum, 85 nmol/L 12-O-tetradecanoylphorbol-13-acetate (TPA), 0.1 mmol/L 3-isobutyl-1-methylxanthine (IBMX), 2.5 nmol/L cholera toxin (CT), and 100 μg/ml geneticin. Primary (WM35, WM75, WM98-1, WM115, and WM793) and metastatic (WM451Lu) human melanoma cell lines were kindly provided by Dr. Meenhard Herlyn (The Wistar Institute, Philadelphia, PA). WM35 is derived from an early-stage radial growth phase primary lesion (Breslow thickness 0.69 mm, Clark level II) and the patient was cured after surgical removal of the lesion. WM35 cells do not metastasize in nude mice.14Elder DE Rodeck U Thurin J Cardillo F Clark WH Stewart R Herlyn M Antigenic profile of tumor progression stages in human melanocytic nevi and melanomas.Cancer Res. 1989; 49: 5091-5096PubMed Google Scholar WM75 is derived from vertical growth phase (VGP) primary melanoma (Breslow thickness 6.25 mm, Clark level IV) from a patient who also had a subsequent metastatic lesion. WM98-1 is derived from a VGP primary (Breslow thickness 5.4 mm, Clark level IV) and the patient had a recurrence of melanoma during 5-year clinical follow-up. WM98-1 is tumorigenic in nude mice.15Rodeck U Herlyn M Menssen HD Furlanetto RW Koprowsk H Metastatic but not primary melanoma cell lines grow in vitro independently of exogenous growth factors.Int J Cancer. 1987; 40: 687-690Crossref PubMed Scopus (146) Google Scholar, 16Satyamoorthy K DeJesus E Linnenbach AJ Kraj B Kornreich DL Rendle S Elder DE Herlyn M Melanoma cell lines from different stages of progression and their biological and molecular analyses.Melanoma Res. 1997; 7: S35-S42PubMed Google Scholar WM115 is derived from a VGP primary melanoma (Breslow thickness 2.24 mm, Clark level III) in a patient who had a recurrence 9 months later.16Satyamoorthy K DeJesus E Linnenbach AJ Kraj B Kornreich DL Rendle S Elder DE Herlyn M Melanoma cell lines from different stages of progression and their biological and molecular analyses.Melanoma Res. 1997; 7: S35-S42PubMed Google Scholar WM793 is derived from a VGP primary melanoma (Breslow thickness 0.55 mm, Clark level II) in a patient who did not have a recurrence during 10-year clinical follow-up.16Satyamoorthy K DeJesus E Linnenbach AJ Kraj B Kornreich DL Rendle S Elder DE Herlyn M Melanoma cell lines from different stages of progression and their biological and molecular analyses.Melanoma Res. 1997; 7: S35-S42PubMed Google Scholar These WM lines were grown in Ham’s F10 medium containing 10% fetal bovine serum and 1% antibiotic-antimycotic mixture. Metastatic melanoma cell lines SK-MEL-19 and SK-MEL-23 clone 22 (cl.22) cells described earlier,17Houghton AN Real FX Davis LJ Cordon-Cardo C Old LJ Phenotypic heterogeneity of melanoma.: Relation to the differentiation program of melanoma cells.J Exp Med. 1987; 165: 812-829Crossref PubMed Scopus (140) Google Scholar, 18Carey TE Takahashi T Resnick LA Oettgen HF Old LJ Cell surface antigens of human malignant melanoma: mixed hemadsorption assays for humoral immunity to cultured autologous melanoma cells.Proc Natl Acad Sci USA. 1976; 73: 3278-3282Crossref PubMed Scopus (387) Google Scholar were grown in minimal essential medium supplemented with 10% fetal bovine serum, 1% nonessential amino acids, 1% glutamine, and 1% antibiotic-antimycotic mixture. Cells were seeded at a density of 5 × 105 cells/10 ml of culture medium in 100-mm dishes. Culture medium, fetal bovine serum, Hanks’ balanced salt solution, antibiotic-antimycotic mixture, geneticin, nonessential amino acids, and glutamine were purchased from Life Technologies, Inc., Bethesda, MD. TPA, 3-isobutyl-1-methylxanthine, and CT were from Sigma Chemical Co., St. Louis, MO. HMBA was obtained from Aldrich Chemical Co., Milwaukee, WI. Cells grown as monolayers were washed twice with Hanks’ balanced salt solution, harvested by trypsinization, and washed once with ice-cold PBS. PolyA+ RNA and total RNA were isolated from cell pellets using MicroFastTrack mRNA (Invitrogen Corp., Carlsbad, CA) and Ultraspec-II RNA isolation system (Biotecx Laboratories, Inc., Houston, TX), respectively. Total RNAs were treated with DNase I (Clontech Laboratories Inc., Palo Alto, CA) for differential display reverse transcriptase-polymerase chain reaction (PCR) to remove the remaining genomic DNA. Reverse transcriptase-PCR was performed using a GeneAmp System 2400 (Perkin-Elmer Corp., Foster City, CA). Differential display was performed using a Delta differential display kit (Clontech Laboratories Inc.) following the manufacturer’s instructions. First-strand cDNA was synthesized from 2 μg of total RNA isolated from 70 to 85% confluent control or 5 mmol/L of HMBA-treated (for 48 hours) SK-MEL-19 cells using an oligo (dT) primer. Diluted cDNA (1:12.5 and 1:50) was used to amplify the differential display-PCR product in the presence of [α-33P] dATP (Dupont NEN, Boston, MA) using a random combination of arbitrary primers and oligo (dT) primers. PCR product was resolved by electrophoresis in a 5% polyacrylamide, 8-mol/L urea sequencing gel. The gel was dried and exposed to Biomax MS film (Kodak, Rochester, NY). Bands expressed differentially between untreated and treated samples were cut, eluted, re-amplified, and sequenced by the ABI 377 DNA sequencer (Perkin-Elmer Corp., Foster City, CA). Northern analysis was performed as described previously using a Northern Max kit and a Strip-EZ DNA probe synthesis and removal kit (Ambion, Inc., Austin, TX).12Fang D Setaluri V Role of microphthalmia transcription factor in regulation of melanocyte differentiation marker TRP-1.Biochem Biophys Res Commun. 1999; 256: 657-663Crossref PubMed Scopus (46) Google Scholar The blots were washed at room temperature for 20 minutes with 2× SSC, 0.5% sodium dodecyl sulfate (SDS), followed by washes at 55 to 60°C for 20 minutes with 0.5%× SSC, 0.5% SDS, and then 0.1%× SSC, 0.5% SDS. The 410-bp cDNA template for the MAP-2 probe was amplified by PCR using a set of primers flanking the region of MAP-2 cDNA identical to differential display-PCR fragment (sense: 5′ ATCAAATGGTCCACTAGGCG 3′; antisense: 5′ GCACTTCAAGGGAAGCTGAT 3′). The cDNA templates for tyrosinase, TYRP1, DCT/TYRP2, MITF probes were generated as described before.12Fang D Setaluri V Role of microphthalmia transcription factor in regulation of melanocyte differentiation marker TRP-1.Biochem Biophys Res Commun. 1999; 256: 657-663Crossref PubMed Scopus (46) Google Scholar Human GAPDH probe was from Ambion. Human β-actin probe template (838 bp) was amplified using primers from Clontech Laboratories, Inc. (sense: 5′ ATCTGGCACCACACCTTCTACAATGAGCTGCG 3′; antisense: 5′ CGTCATA CTCCTGCTTGCTGATCCACATCTGC 3′). MAP-2, tyrosinase, TYRP1, DCT/TYRP2, MITF, GAPDH, and β-actin probes detected a single mRNA band at ∼6.0 kb, 1.9 kb, 2.8 kb, 4.5 kb, 5.5 kb, 1.4 kb, and 1.8 kb, respectively.12Fang D Setaluri V Role of microphthalmia transcription factor in regulation of melanocyte differentiation marker TRP-1.Biochem Biophys Res Commun. 1999; 256: 657-663Crossref PubMed Scopus (46) Google Scholar Band intensity was quantitatively analyzed with an ImageQuaNT software (Molecular Dynamics, Sunnyvale, CA). Relative intensities of MAP-2 signals were obtained by normalizing to GAPDH. Western blot analysis was performed as described earlier.12Fang D Setaluri V Role of microphthalmia transcription factor in regulation of melanocyte differentiation marker TRP-1.Biochem Biophys Res Commun. 1999; 256: 657-663Crossref PubMed Scopus (46) Google Scholar Briefly, cells were solubilized in lysis buffer containing 1% SDS, 10 mmol/L Tris, pH 7.4, and proteinase inhibitors (Boehringer Mannheim, Indianapolis, IN). Protein content was estimated using the bicinchoninic acid protein assay (Pierce, Rockford, IL). Total cellular protein was subjected to 9% SDS-polyacrylamide gel electrophoresis, and transferred electrophoretically to a polyvinylidene difluoride membrane (NEN Life Science, Boston, MA). The blots were incubated in blocking buffer [1% bovine serum albumin in Tris-buffered saline (TBS) containing 10 mmol/L Tris, pH 7.5, 100 mmol/L NaCl] at room temperature for 3 hours, and then at 4°C overnight with addition of the primary antibodies diluted in TBS. Anti-MAP-2 mAbs HM-2 (Sigma) and M13 (Zymed Laboratories, San Francisco, CA) were used at 1:1000; anti-γ-tubulin polyclonal antibody (Sigma) was used at 1:5000. Blots were washed with TBST (TBS containing 0.1% Tween 20) with frequent changes of wash buffer. They were then incubated with donkey anti-mouse (for HM-2 and M13) or anti-rabbit (for γ-tubulin) horseradish peroxidase antibody (Amersham Pharmacia Biotech Inc., Piscataway, NJ) or alkaline phosphatase-conjugated goat anti-mouse IgG (BioRad Laboratories, Hercules, CA) diluted in TBST at 1:2000 to 1:2500 for 1 to 3 hours, and washed again with TBST with frequent changes of wash buffer. Protein bands were detected either colorimetrically or by chemiluminescence using an ECL kit (Amersham Pharmacia Biotech Inc.) and exposed to Kodak X-ray film for 5 seconds to 15 minutes. Tissue specimens were fixed in 10% neutral-buffered formalin, processed by routine histological method, and embedded in paraffin. Standard sections were cut and collected on positively charged slides and immunohistochemical studies for TYRP1 (1:80, mel-5; Signet Laboratories; Dedham, MA), gp100 (1:100, HMB45; DAKO Corporation; Carpinteria, CA), Melan A/MART-1 (1:5; Novocastra Laboratories; Burlingame, CA), neuron-specific enolase (1:50; DAKO; Glostrup, Denmark), neurofilament protein p68 (1:5; Accurate Chemical and Scientific Co.; Westbury, NY), low-affinity nerve growth factor receptor (1:40, p75NGFR; Boehringer Mannheim; Indianapolis, IN), and neural adhesion molecule (1:40, CD56/N-CAM; Becton-Dickinson; San Jose, CA) were performed using standard immunoperoxidase techniques on a Ventana autostainer (Ventana Medical Systems, Tucson, AZ). Immunohistochemical studies for MAP-2 (M13, prediluted; Zymed) were performed manually using the manufacturer’s Histostain-Plus kit, which uses a standard streptavidin-biotin amplification method and a 3-amino-9-ethylcarbazole chromogen. We reported earlier that the treatment of human pigmented melanocytic cells in culture with the differentiation-inducing agent HMBA inhibits cell growth and causes selective down-regulation of the melanocyte differentiation marker TYRP1.12Fang D Setaluri V Role of microphthalmia transcription factor in regulation of melanocyte differentiation marker TRP-1.Biochem Biophys Res Commun. 1999; 256: 657-663Crossref PubMed Scopus (46) Google Scholar, 13Fang D Kute T Setaluri V Regulation of tyrosinase-related protein 2 (TYRP2) in human melanocytes: relationship to growth and dendritic morphology.Pigment Cell Res. 2001; 14: 132-139Crossref PubMed Scopus (58) Google Scholar, 19Vijayasaradhi S Doskoch PM Wolchok J Houghton AN Melanocyte differentiation marker gp75, the brown locus protein, can be regulated independently of tyrosinase and pigmentation.J Invest Dermatol. 1995; 105: 113-119Crossref PubMed Scopus (32) Google Scholar Flow cytometric analysis showed that treatment with HMBA results in accumulation of cells in G0/G1 phase and a significant decrease in population of cells in G2/M phase (data not shown). This change in growth kinetics upon treatment with HMBA is accompanied by formation of long dendrites in all melanoma cells tested.12Fang D Setaluri V Role of microphthalmia transcription factor in regulation of melanocyte differentiation marker TRP-1.Biochem Biophys Res Commun. 1999; 256: 657-663Crossref PubMed Scopus (46) Google Scholar, 13Fang D Kute T Setaluri V Regulation of tyrosinase-related protein 2 (TYRP2) in human melanocytes: relationship to growth and dendritic morphology.Pigment Cell Res. 2001; 14: 132-139Crossref PubMed Scopus (58) Google Scholar, 19Vijayasaradhi S Doskoch PM Wolchok J Houghton AN Melanocyte differentiation marker gp75, the brown locus protein, can be regulated independently of tyrosinase and pigmentation.J Invest Dermatol. 1995; 105: 113-119Crossref PubMed Scopus (32) Google Scholar In Figure 1, the effect of HMBA on the morphology of a representative melanoma cell line SK-MEL-19 is shown. To characterize changes in gene expression associated with growth inhibition and dendritic morphology of melanoma cells, we performed differential display analysis using RNA obtained from control and HMBA-treated SK-MEL-19 melanoma cells. Arbitrary primer P4 (ATTAACCCTCACTAAATGCTGGTAG) and oligo dT primer T7 (CATTATGCTGAGTGATATCTTTTTTTTTGA) amplified a cDNA that is overexpressed in treated cells. Nucleotide sequence analysis of the ∼450-bp cDNA band showed 98% identity to 3′-untranslated region within exon 19 of 10.2-kb human MAP-2 cDNA (GenBank Accession No. U32996; between nucleotides 1931 to 2384). cDNA probes derived from this region detect 6-kb and 9-kb alternative splice variants of MAP-2 mRNAs that produce, respectively, a juvenile polypeptide form (MAP-2c) of ∼70 kd and two mature forms (MAP-2a and MAP-2b) of ∼280 kd.10Graner CC Matus A Different forms of microtubule-associated protein 2 are encoded by separate mRNA transcripts.J Cell Biol. 1988; 106: 779-783Crossref PubMed Scopus (134) Google Scholar A 410-bp PCR-amplified cDNA fragment nested within the 450-bp differential display fragment was used to probe polyA+ RNA isolated from control and HMBA-treated melanoma cells. In control metastatic melanoma SK-MEL-19 and SK-MEL-23 cl.22 cells, a weak 6-kb band representing the alternatively spliced MAP-2 mRNA could be seen. Treatment of melanoma cells with HMBA for 2 to 5 days resulted in a significant up-regulation of MAP-2 expression (Figure 2A). In SK-MEL-19 cells treated with HMBA for 48 hours, a fourfold increase in MAP-2 mRNA was noted. Prolonged presence of the inducer resulted in continued accumulation (up to 12-fold) of MAP-2 in SK-MEL-19 cells (Figure 2B). Thus, Northern analysis confirmed the identification of MAP-2 as a differentially expressed gene in melanoma cells treated with the differentiation inducer. In the middle panel of Figure 2A, aconcomitant down-regulation of the melanocyte differentiation marker TYRP1 mRNA by the inducer in SK-MEL-19 and SK-MEL-23 cl.22 is shown. Expression of MAP-2 was studied in a panel of well-characterized cell lines that represent melanoma progression.14Elder DE Rodeck U Thurin J Cardillo F Clark WH Stewart R Herlyn M Antigenic profile of tumor progression stages in human melanocytic nevi and melanomas.Cancer Res. 1989; 49: 5091-5096PubMed Google Scholar, 15Rodeck U Herlyn M Menssen HD Furlanetto RW Koprowsk H Metastatic but not primary melanoma cell lines grow in vitro independently of exogenous growth factors.Int J Cancer. 1987; 40: 687-690Crossref PubMed Scopus (146) Google Scholar, 16Satyamoorthy K DeJesus E Linnenbach AJ Kraj B Kornreich DL Rendle S Elder DE Herlyn M Melanoma cell lines from different stages of progression and their biological and molecular analyses.Melanoma Res. 1997; 7: S35-S42PubMed Google Scholar PolyA+ RNA isolated from neonatal foreskin melanocytes, primary radial growth phase melanoma cell line WM35, primary VGP melanoma cell lines WM75 and WM98–1, and metastatic melanoma WM451 was analyzed by Northern blot hybridization (Figure 3). In primary melanoma cell lines WM35 and WM75, the 6-kb MAP-2 mRNA was readily detected. MAP-2 mRNA was not detectable in normal melanocytes, primary melanoma WM98–1, or metastatic melanoma WM451. The variable expression of melanocyte differentiation markers tyrosinase, TYRP1, DCT, and MITF in these cell lines is shown (Figure 3). These data show that melanocytes at early stages of tumor progression activate transcription of the neuronal differentiation marker MAP-2 and produce an alternatively processed MAP-2c transcript normally found in immature neurons. Western blot analysis was also used to detect the expression of MAP-2 protein and the specificity of available anti-MAP-2 antibodies. As shown in Figure 4A, mAb HM-2 detected both the immature juvenile ∼70-kd and mature ∼280-kd isoforms found in 1-day-old rat brain extracts and the 280-kd mature form in the adult brain extracts. On the other hand, mAb M13 detected only the mature 280-kd form in newborn and adult rat brain extracts. Western blot analysis of detergent extracts of melanoma cell lines with mAb HM-2 is shown in Figure 4B. A protein band of ∼70 kd corresponding to the MAP-2c isoform, consistent with the presence of 6-kb MAP-2 mRNA, could be detected in WM35, WM75, and all primary melanoma cell lines tested and the metastatic cell line SK-MEL-19, but not in normal melanocytes. For comparison, amounts of MAP-2 isoforms detectable in newborn rat brain extracts are also shown (first lane in Figure 4B). Human melanoma MAP-2c appears to migrate slightly slower than the ∼70-kd doublet of rat brain isoform. In SK-MEL-19 cells treated with HMBA, an increase in the amount of MAP-2c protein was apparent. Although the 9-kb mRNA that produces a mature 280-kd protein was not detectable by Northern blotting, a faint protein band corresponding to the MAP-2a and MAP-2b isoforms could be detected in WM35 and WM75 melanoma cell lines. To understand the possible pathways involved in up-regulation of MAP-2 by HMBA, we tested the effects of phorbol ester TPA (a modifier of protein kinase C activity) and CT (a cAMP inducer) on MAP-2 expression in melanoma cells. SK-MEL-19 cells were treated with TPA or CT for 6, 24, and 48 hours and MAP-2 expression was studied by Northern blot analysis of total RNA. As shown in Figure 5, treatment of cells with TPA or CT alone did not induce MAP-2 expression. Up-regulation of MAP-2 expression in cells treated with HMBA could be detected by 48 hours. When HMBA was added together with TPA or CT, a significant increase in MAP-2c mRNA could be detected as early as 6 hours after treatment. Similarly, whereas treatment with TPA or CT alone did not cause down-regulation of TYRP1 mRNA, treatment with HMBA alone or in combination with TPA or CT resulted in extinction of TYRP1 expression. These data suggest that although agents that affect protein kinase C and cAMP pathways themselves have no effect on MAP-2 expression in melanoma cells, these agents can facilitate HMBA-mediated induction of MAP-2. These data also suggest that there is a reciprocal relationship between pathways that regulate the expression of the melanocytic marker TYRP1 and the neuronal marker MAP-2 in melanoma cells. To test whether MAP-2 is also expressed in human melanocytic lesions in vivo, immunohistochemistry was performed using anti-MAP-2 mAb M13. A total of 61 individual paraffin-embedded specimens were tested. These included 10 congenital and acquired melanocytic nevi, 9 primary malignant melanomas, and 42 metastatic melanomas. Whereas the majority of nevi (60%) and many primary melanomas (44%) were strongly MAP-2-positive (+++ to ++), only a small percentage of metastatic melanomas (24%) had foci of MAP-2-stained cells (Table 1). Fisher’s exact test showed a strong association between the number of lesions showing strong MAP-2 reactivity and the characteristics of the melanocytic lesions (P = 0.0039). As shown in Figure 6A, in a malignant melanoma arising in a nevus, both the dermal nevus cells and the cells within the early primary melanoma showed strong cytoplasmic staining for MAP-2. TYRP1-specific mAb MEL-5 stained melanocytes and melanoma cells within epidermis and at the dermal-epidermal junction, whereas the early invasive disease and the intradermal nevus cells were less intensely stained.Table 1Immunohistochemical Staining of Melanocytic Lesions with Anti-MAP-2 AntibodyMAP-2 staining intensityLesionn++++++−Nevi106 (60%)0 (0%)1 (10%)3 (30%)Primary melanoma93 (33.3
Referência(s)