Enzymatic Processing of Uracil Glycol, a Major Oxidative Product of DNA Cytosine
1998; Elsevier BV; Volume: 273; Issue: 16 Linguagem: Inglês
10.1074/jbc.273.16.10026
ISSN1083-351X
AutoresAndrei A. Purmal, Gary W. Lampman, Jeffrey P. Bond, Zafer Hatahet, Susan S. Wallace,
Tópico(s)DNA and Nucleic Acid Chemistry
ResumoA major stable oxidation product of DNA cytosine is uracil glycol (Ug). Because of the potential of Ug to be a strong premutagenic lesion, it is important to assess whether it is a blocking lesion to DNA polymerase as is its structural counterpart, thymine glycol (Tg), and to evaluate its pairing properties. Here, a series of oligonucleotides containing Ug or Tg were prepared and used as templates for a model enzyme, Escherichia coli DNA polymerase I Klenow fragment (exo−). During translesion DNA synthesis, Ug was bypassed more efficiently than Tg in all sequence contexts examined. Furthermore, only dAMP was incorporated opposite template Ug and Tg and the kinetic parameters of incorporation showed that dAMP was inserted opposite Ug more efficiently than opposite Tg. Ug opposite G and A was also recognized and removed in vitro by the E. coli DNA repair glycosylases, endonuclease III (endo III), endonuclease VIII (endo VIII), and formamidopyrimidine DNA glycosylase. The steady state kinetic parameters indicated that Ug was a better substrate for endo III and formamidopyrimidine DNA glycosylase than Tg; for endonuclease VIII, however, Tg was a better substrate. A major stable oxidation product of DNA cytosine is uracil glycol (Ug). Because of the potential of Ug to be a strong premutagenic lesion, it is important to assess whether it is a blocking lesion to DNA polymerase as is its structural counterpart, thymine glycol (Tg), and to evaluate its pairing properties. Here, a series of oligonucleotides containing Ug or Tg were prepared and used as templates for a model enzyme, Escherichia coli DNA polymerase I Klenow fragment (exo−). During translesion DNA synthesis, Ug was bypassed more efficiently than Tg in all sequence contexts examined. Furthermore, only dAMP was incorporated opposite template Ug and Tg and the kinetic parameters of incorporation showed that dAMP was inserted opposite Ug more efficiently than opposite Tg. Ug opposite G and A was also recognized and removed in vitro by the E. coli DNA repair glycosylases, endonuclease III (endo III), endonuclease VIII (endo VIII), and formamidopyrimidine DNA glycosylase. The steady state kinetic parameters indicated that Ug was a better substrate for endo III and formamidopyrimidine DNA glycosylase than Tg; for endonuclease VIII, however, Tg was a better substrate. Free radical-induced DNA damage is a substantial contributor to the spontaneous mutational burden and has been implicated in a variety of disease processes including cancer. Accumulation of free radical-induced DNA damage has also been associated with aging (1Ames B.N. Free Radical Res. Commun. 1989; 7: 121-128Crossref PubMed Scopus (627) Google Scholar, 2Sun Y. Free Radical Biol. Med. 1990; 8: 583-599Crossref PubMed Scopus (1050) Google Scholar, 3Ames B.N. Shigenaga M.K. Hagen T.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7915-7922Crossref PubMed Scopus (5381) Google Scholar). A significant number of free radical-induced mutations produced by oxidizing agents and ionizing radiation are C → T transitions (4Tkeshelashvili L.K. McBride T. Spence K. Loeb L.A. J. Biol. Chem. 1991; 266: 6401-6406Abstract Full Text PDF PubMed Google Scholar, 5McBride T.J. Preston B.D. Loeb L.A. Biochemistry. 1991; 30: 207-213Crossref PubMed Scopus (226) Google Scholar, 6Ayaki H. Higo K. Yamamoto O. Nucleic Acids Res. 1986; 14: 5013-5018Crossref PubMed Scopus (41) Google Scholar, 7Jaberaboansari A. Dunn W.C. Preston R.J. Mitra S. Waters L.C. Radiat. Res. 1991; 127: 202-210Crossref PubMed Scopus (26) Google Scholar, 8Waters L.C. Sikpi M.O. Preston R.J. Mitra S. Jaberaboansari A. Radiat. Res. 1991; 127: 190-201Crossref PubMed Scopus (36) Google Scholar), thus oxidized cytosine residues appear to play an important role in oxidative mutagenesis. Hydroxyl radicals, the principal damaging species produced by oxidizing agents, interact with cytosine residues principally by addition to the 5,6-double bond (9Kuwabara M. Radiat. Phys. Chem. 1991; 37: 691-704Google Scholar, 10Breen A.P. Murphy J.A. Free Radical Biol. Med. 1995; 18: 1033-1077Crossref PubMed Scopus (916) Google Scholar). A major oxidation product of DNA cytosine is cytosine glycol which is unstable and deaminates to uracil glycol (Ug) 1The abbreviations used are: Ug, 5,6-dihydroxy-5,6-dihydrouracil; dUG, 5,6-dihydroxy-5,6-dihydrodeoxyuridine; Tg, 5,6-dihydroxy-5,6-dihydrothymine; dTg, 5,6-dihydroxy-5,6-dihydrodeoxythymidine; dUgTP, 5,6-dihydroxy-5,6-dihydrodeoxyuridine 5′-triphosphate; dTgTP, 5,6-dihydroxy-5,6-dihydrodeoxythymidine 5′-triphosphate; Kf(exo−), DNA polymerase I Klenow fragment lacking proofreading activity; endo, endonuclease; eq, pseudoequatorial; ax, pseudoaxial. 1The abbreviations used are: Ug, 5,6-dihydroxy-5,6-dihydrouracil; dUG, 5,6-dihydroxy-5,6-dihydrodeoxyuridine; Tg, 5,6-dihydroxy-5,6-dihydrothymine; dTg, 5,6-dihydroxy-5,6-dihydrodeoxythymidine; dUgTP, 5,6-dihydroxy-5,6-dihydrodeoxyuridine 5′-triphosphate; dTgTP, 5,6-dihydroxy-5,6-dihydrodeoxythymidine 5′-triphosphate; Kf(exo−), DNA polymerase I Klenow fragment lacking proofreading activity; endo, endonuclease; eq, pseudoequatorial; ax, pseudoaxial. (11Wagner J.R. Hu C.-C. Ames B.N. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 3380-3384Crossref PubMed Scopus (238) Google Scholar). Cytosine glycol can also dehydrate to form 5-hydroxycytosine (5-OHC) (11Wagner J.R. Hu C.-C. Ames B.N. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 3380-3384Crossref PubMed Scopus (238) Google Scholar, 12Dizdaroglu M. Simic M.G. Radiat. Res. 1984; 100: 41-46Crossref PubMed Scopus (37) Google Scholar, 13Teoule R. Int. J. Radiat. Biol. 1987; 51: 573-589Crossref Scopus (364) Google Scholar), while 5-hydroxyuracil (5-OHU) arises from sequential deamination and dehydration (11Wagner J.R. Hu C.-C. Ames B.N. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 3380-3384Crossref PubMed Scopus (238) Google Scholar). Depending on the oxidizing agent used, uracil glycol and 5-hydroxycytosine are formed at comparable levels in DNA and furthermore, the background level of these lesions is high in DNA extracted from untreated cells (11Wagner J.R. Hu C.-C. Ames B.N. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 3380-3384Crossref PubMed Scopus (238) Google Scholar). Oxidized pyrimidine lesions are repaired by a highly conserved process called base excision repair (for reviews, see Refs. 14Demple B. Harrison L. Annu. Rev. Biochem. 1994; 63: 915-948Crossref PubMed Scopus (1289) Google Scholar and 15Wallace S. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Press, Cold Spring Harbor, NY1997Google Scholar). The damaged pyrimidines are recognized by a class of enzymes called DNA glycosylases. The principal activities in Escherichia colithat recognize oxidized pyrimidines are endonuclease III (endo III) and endonuclease VIII (endo VIII) (see Refs. 14Demple B. Harrison L. Annu. Rev. Biochem. 1994; 63: 915-948Crossref PubMed Scopus (1289) Google Scholar and 15Wallace S. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Press, Cold Spring Harbor, NY1997Google Scholar, and references therein); formamidopyrimidine DNA glycosylase (Fpg) has also been shown to recognize oxidized pyrimidines in vitro (16Hatahet Z. Kow Y.W. Purmal A.A. Cunningham R.P. Wallace S.S. J. Biol. Chem. 1994; 269: 18814-18820Abstract Full Text PDF PubMed Google Scholar). Upon recognition of an oxidized pyrimidine by a DNA glycosylase, the N-glycosylic bond is cleaved releasing the free base. This is followed by cleavage of the phosphodiester backbone by an associated DNA lyase activity which leaves a blocked 3′ terminus in the resulting nick (Refs. 14Demple B. Harrison L. Annu. Rev. Biochem. 1994; 63: 915-948Crossref PubMed Scopus (1289) Google Scholar and 15Wallace S. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Press, Cold Spring Harbor, NY1997Google Scholar and references therein). The block, either an α,β-unsaturated aldehyde or a phosphate must be removed by the phosphodiesterase or phosphatase activity of another class of enzymes, the 5′ AP endonucleases (Refs. 14Demple B. Harrison L. Annu. Rev. Biochem. 1994; 63: 915-948Crossref PubMed Scopus (1289) Google Scholar and 15Wallace S. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Press, Cold Spring Harbor, NY1997Google Scholar and references therein). This results in a single base gap which is filled in by DNA polymerase and sealed by DNA ligase (Refs. 14Demple B. Harrison L. Annu. Rev. Biochem. 1994; 63: 915-948Crossref PubMed Scopus (1289) Google Scholar and 15Wallace S. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Press, Cold Spring Harbor, NY1997Google Scholar and references therein). If the lesion is not repaired prior to its encounter with the replication fork, it can either block DNA polymerase and thus be potentially lethal or it can be bypassed by DNA polymerase and be potentially mutagenic depending on its ability to mispair. Of the modified pyrimidine lesions retaining the intact pyrimidine ring that have been studied to date, only thymine glycol (Tg) is a strong blocking lesion to DNA polymerases in vitro (17Ide H. Kow Y.W. Wallace S.S. Nucleic Acids Res. 1985; 13: 8035-8052Crossref PubMed Scopus (237) Google Scholar, 18Rouet P. Essigmann J.M. Cancer Res. 1985; 45: 6113-6118PubMed Google Scholar, 19Hayes R.C. LeClerc J.E. Nucleic Acids Res. 1986; 14: 1045-1061Crossref PubMed Scopus (90) Google Scholar, 20Clark J.M. Beardsley G.P. Biochemistry. 1987; 26: 5398-5403Crossref PubMed Scopus (93) Google Scholar) and is lethal in vivo (21Achey P.M. Wright C.F. Radiat. Res. 1983; 93: 609-612Crossref PubMed Scopus (19) Google Scholar, 22Moran E. Wallace S.S. Mutat. Res. 1985; 146: 229-241PubMed Google Scholar, 23Laspia M.F. Wallace S.S. J. Bacteriol. 1988; 170: 3359-3366Crossref PubMed Google Scholar). Other free radical-induced pyrimidine lesions, such as dihydrothymine (24Ide H. Melamede R.J. Wallace S.S. Biochemistry. 1987; 26: 964-969Crossref PubMed Scopus (41) Google Scholar), 5-OHU (25Purmal A.A. Kow Y.W. Wallace S.S. Nucleic Acids Res. 1994; 22: 72-78Crossref PubMed Scopus (155) Google Scholar), and 5-OHC (25Purmal A.A. Kow Y.W. Wallace S.S. Nucleic Acids Res. 1994; 22: 72-78Crossref PubMed Scopus (155) Google Scholar), do not block DNA polymerases and are readily bypassed. Dihydrothymine always pairs with A and is not a mutagenic lesion (26Evans J. Maccabee P. Hatahet Z. Courcelle J. Bockrath R. Ide H. Wallace S.S. Mutat. Res. 1993; 299: 147-156Crossref PubMed Scopus (104) Google Scholar). 5-OHC can pair with A in vitro (25Purmal A.A. Kow Y.W. Wallace S.S. Nucleic Acids Res. 1994; 22: 72-78Crossref PubMed Scopus (155) Google Scholar) and has been shown to be mutagenic in E. coli (27Feig D.I. Sowers L.C. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6609-6613Crossref PubMed Scopus (192) Google Scholar). 5-OHU always pairs with Ain vitro (25Purmal A.A. Kow Y.W. Wallace S.S. Nucleic Acids Res. 1994; 22: 72-78Crossref PubMed Scopus (155) Google Scholar) and because it is derived from C, it is a potentially important premutagenic lesion. Oxidized deoxynucleoside triphosphates from the nucleotide pools can also be incorporated into DNA; these may pair correctly or mispair. 5-OHdCTP and 5-OHdUTP are efficient substrates for E. coliDNA polymerase I Klenow fragment (Kf) (28Purmal A.A. Kow Y.W. Wallace S.S. Nucleic Acids Res. 1994; 22: 3930-3935Crossref PubMed Scopus (74) Google Scholar); 5-OHdUTP is incorporated in place of A and thus, if incorporated from the nucleotide pool, would not be mutagenic. 5-OHdCTP can be misincorporated as T and thus could be mutagenic. 8-Oxo-dGTP and 8-oxo-dATP can also be incorporated into DNA; 8-oxo-dGTP is often misincorporated as T leading to T → G transversions (29Cheng K.C. Cahill D.S. Kasai H. Nishimura S. Loeb L.A. J. Biol. Chem. 1992; 267: 166-172Abstract Full Text PDF PubMed Google Scholar, 30Maki H. Sekiguchi M. Nature. 1992; 355: 273-275Crossref PubMed Scopus (783) Google Scholar). We have previously reported the synthesis of dUgTP and shown it to be a reasonably efficient substrate for DNA polymerase I Kf (31Purmal A.A. Bond J.P. Lyons B.A. Kow Y.W. Wallace S.S. Biochemistry. 1998; 37: 330-338Crossref PubMed Scopus (16) Google Scholar). This is in contrast to its structural relative, dTgTP, which is a poor substrate (24Ide H. Melamede R.J. Wallace S.S. Biochemistry. 1987; 26: 964-969Crossref PubMed Scopus (41) Google Scholar, 31Purmal A.A. Bond J.P. Lyons B.A. Kow Y.W. Wallace S.S. Biochemistry. 1998; 37: 330-338Crossref PubMed Scopus (16) Google Scholar). Both dUgTP and dTgTP are incorporated in place of T (31Purmal A.A. Bond J.P. Lyons B.A. Kow Y.W. Wallace S.S. Biochemistry. 1998; 37: 330-338Crossref PubMed Scopus (16) Google Scholar) and thus would not be potentially mutagenic if incorporated from oxidized nucleotide pools. Here we report the enzymatic processing of Ug contained in template DNA and show that Ug is readily bypassed by the model enzyme, E. coli DNA polymerase I Kf(exo−), in contrast to Tg which is poorly bypassed except in certain sequence contexts. Only dAMP can be incorporated into DNA opposite Ug. Finally, Ug in DNA is a good substrate for endonucleases III and VIII and to a lesser extent for Fpg, but it cannot be removed by uracil DNA glycosylase. dTgTP and dUgTP were prepared as described previously (24Ide H. Melamede R.J. Wallace S.S. Biochemistry. 1987; 26: 964-969Crossref PubMed Scopus (41) Google Scholar, 31Purmal A.A. Bond J.P. Lyons B.A. Kow Y.W. Wallace S.S. Biochemistry. 1998; 37: 330-338Crossref PubMed Scopus (16) Google Scholar); the 2′-deoxynucleoside triphosphates used in the DNA polymerase reactions and the Mono-Q 5/5 column were purchased from Pharmacia; Partisphere SAX, 0.4 × 12.5 cm, column was obtained from Whatman; 2′,3′-dideoxynucleoside triphosphates, Klenow fragment (10 μm/μl), Sequenase version 2.0 (13 μm/μl), T4 DNA ligase (5 μm/μl), and shrimp alkaline phosphatase were obtained from U. S. Biochemical Corp.; terminal transferase (10 μm/ml) and T4 polynucleotide kinase were purchased from Boehringer Mannheim; uracil DNA glycosylase (100 μm/μl) was obtained from Epicentre Technologies; E. coli endo III (10 μm), endo VIII (200 μm), and Fpg DNA glycosylase (6.6 μm) were purified as described previously (16Hatahet Z. Kow Y.W. Purmal A.A. Cunningham R.P. Wallace S.S. J. Biol. Chem. 1994; 269: 18814-18820Abstract Full Text PDF PubMed Google Scholar). [γ-32P]ATP (>5000 Ci/mmol, 10 mCi/ml) was purchased from DuPont; ultrapure Sequagel sequencing system was obtained from National Diagnostics. All oligonucleotides were obtained from Operon Technologies or synthesized by the standard phosphoramidite method on a ABI 380A DNA synthesizer (Vermont Cancer Center, University of Vermont). 8-Oxo-2′-deoxyguanosine phosphoramidite, used to prepare 8-oxo-G-containing oligonucleotides, and tetrahydrofuran phosphoramidite, used to prepare the AP-containing oligonucleotides (catalog name "dSpacer"), were obtained from Glen Research (Sterling, VA). Lesion-containing oligonucleotides were deprotected in the presence of 0.25 m β-mercaptoethanol following the procedure recommended by Glen Research. The oligonucleotides were purified by Mono-Q anion-exchange chromatography on a Milton Roy HPLC system and by electrophoresis in a 12% polyacrylamide gel. After purification, oligonucleotides were desalted by gel-filtration on an NAP 5 column (Pharmacia) using water as an eluent. The oligonucleotides were 5′-32P-labeled with [γ-32P]ATP using T4 polynucleotide kinase following standard procedures. Labeled oligonucleotides were further purified using a NENSORB 20 Nucleic Acids Purification Cartridge (DuPont). To obtain the desired final specific radioactivity, labeled oligonucleotides were combined with the appropriate cold oligonucleotides. The oligonucleotides to be used in the ligation reaction were synthesized with 5′-phosphate. To monitor the ligation reaction and detect the ligation product, 5′-phosphate was removed from small amounts of the oligonucleotides (about 5 nmol) with 0.01 unit of shrimp alkaline phosphatase in a buffer containing 20 mm Tris-HCl, pH 8.0, and 10 mm MgCl2. Dephosphorylated oligonucleotides were purified using a NENSORB 20 cartridge and 5′-32P-labeled with [γ-32P]ATP using standard procedures. Labeled oligonucleotides were further purified using a NENSORB 20 cartridge and combined with the same cold 5′-phosphorylated oligonucleotide to obtain the desired final specific radioactivity. 18-, 37-, and 45-mer oligonucleotides containing a single, internal Ug or Tg (templates 1, 2, 3, 4, and 5, Fig. 1) were prepared by a modification of a method previously described (32Hatahet Z. Purmal A.A. Wallace S.S. Nucleic Acids Res. 1993; 21: 1563-1568Crossref PubMed Scopus (38) Google Scholar) using terminal deoxynucleotidyl transferase. 1–2.5 nmol of GCAGCCAAAACGTCC, CCTTCG, or CCTTCGT were incubated for 30 min at 30 °C in 65 μl of buffer containing 100 mm sodium cacodylate, pH 7.0, 1 mm CoCl2, 0.1 mm EDTA, 50 μg/ml bovine serum albumin, 0.1 mm dithiothreitol, 0.1–0.12 mm dUgTP, or 0.18–0.2 mm dTgTP and 100 units of terminal deoxynucleotidyl transferase. The oligonucleotides extended from the 3′-end with a single dUgTP or dTgTP were then high performance liquid chromatography purified on a Partisphere SAX column (0.4 × 12.5 cm, Whatman) using a linear gradient of sodium phosphate buffer, pH 6.3 (from 5 mm to 0.5 mover 60 min), containing 25% acetonitrile. The purified extended oligonucleotides, GCAGCCAAAACGTCCX, CCTTCGX, or CCTTCGTX (X = Ug or Tg), were desalted using NAP-5 columns (Pharmacia) and ligated using T4 DNA ligase with32pGGATGGTCTGTCCCTTGAATCGATAGGGG,32pTACTTTCCTCT, or 32pACTTTCCTCT, respectively, using the appropriate "scaffolding" oligonucleotides GACAGACCATCCAGGACGTTTTGGCTGC or AGAGGAAAGTAACGAAGG. 37-Mers (templates 4 and 5, Fig. 1) were obtained by the ligation of CCTTCGX or CCTTCGTX (X = Ug or Tg) with32pTACTTTCCTCTTCCCTTGAATCGATAGGGG or32pACTTTCCTCTTCCCTTGAATCGATAGGGG, respectively, using AGAGGAAAGTAACGAAGG as a scaffold. All 5′-phosphorylated oligonucleotides used for ligation contained a low specific activity 5′-32P label (about 10 nCi) for detection of the ligation products. In later experiments, the radioactivity of the internal32P label was below the level of detection by autoradiography during the exposure time used for the detection of 5′-terminal 32P label. Ligation reactions were performed for 10–15 h at 15 °C in 50 mm Tris-HCl, pH 7.6, 10 mm MgCl2, 0.1 mm EDTA, 10 mm dithiothreitol, 0.3 mm ATP, 10 μm nicked duplex oligonucleotide, and 0.5 unit/μl reaction mixture of T4 DNA ligase. After ligation, the strands containing the lesion were separated from the scaffolding oligonucleotide by electrophoresis on 12 or 20% polyacrylamide gels under denaturing conditions, electroeluted from the gel, and desalted using NAP-5 columns. The ligation efficiency of oligonucleotides containing 3′-dUg or -dTg was lower than those containing 3′-dT. The yield of ligation products of oligonucleotides without lesions was 90–95%. Under the same reaction conditions, the conversion of 3′ modified oligonucleotides into ligation products ranged between 45 and 60%. Appropriate amounts of templates 1, 4, and 5 were annealed to a 32P-labeled primer 1 (Fig. 1) in Buffer P (15 mm Tris-HCl, pH 7.5, 7.5 mmMgCl2, 30 mm NaCl, 4 mmdithiothreitol) and treated with an excess of uracil DNA glycosylase following the manufacturer's instructions. A double-stranded 18-mer oligonucleotide duplex containing an abasic site, which was used as a substrate for DNA repair endonucleases, was prepared by annealing 5′-32P-labeled template 2 with U in position 7 to 18-mer 2 (Fig. 1) in 10 mm Tris-HCl, pH 7.5, 10 mm NaCl, 1 mm EDTA buffer followed by treatment of the duplex with excess uracil DNA glycosylase following the manufacturer's instructions. The bypass of Ug and Tg in different sequence contexts was studied using various concentrations of Kf(exo−) (10−5-10−2μm/μl). In the typical bypass assay, a primer oligonucleotide containing the 5′-32P label was annealed to a template with single Ug or Tg. The primer-template complex (50 nm) was incubated at 37 °C for 15 min with Kf(exo−) in 6 μl of the reaction mixture, containing Buffer P and four dNTP's (64 μm each). The same conditions were used for the "running start" primer extension reaction. Here the concentration of Kf(exo−) was 1.6 × 10−3 μm/μl and the concentration of each of four dNTP's was 50 μm. Extension of the primer with only one nucleotide was performed similarly to the bypass assay using 5 μm of only one of the four dNTP's in each experiment and 2.5–6 × 10−4 μm/ml Kf(exo−). The reaction mixtures were incubated for 15 min at 15 °C. Sequencing reactions were performed using T7 DNA polymerase (Sequenase version 2.0) following the supplier's recommendations (U. S. Biochemical Corp.). To determine the kinetic parameters for lesion bypass, a steady state kinetic assay (33Boosalis M. Petruska J. Goodman M.F. J. Biol. Chem. 1987; 262: 14689-14696Abstract Full Text PDF PubMed Google Scholar) was used. The reaction mixture was prepared by adding 3.5 μl of a solution containing primer32pTCAAGGGACAGACCAT, annealed to (template 1, Fig. 1) Kf(exo−) and the buffer to 2.5 μl of water solution containing dCTP and dATP. The final mixture (6 μl) contained 0.02 unit of Kf(exo−), Buffer P, 50 nmprimer-template complex, 50 μm dCTP, and various concentrations of dATP (0.05–10 μm). Reactions were incubated at 4 °C. Reaction times varied between 0.5 and 2 min. For endo III, endo VIII, and Fpg DNA glycosylase assays, the standard reaction mixture (10 μl) contained 100 nm double-stranded oligonucleotide substrate, 10 mm Tris-HCl, pH 7.5, 50 mm NaCl, 1 mm EDTA, and 1–100 nm enzyme. In all experiments, the strand containing the lesion was 5′-32P-labeled. Each enzyme reaction was incubated at 37 °C for 20 min. The reactions were terminated by adding 10 μl of loading buffer and reaction products were analyzed in a 13% polyacrylamide denaturing gel. To determine kinetic parameters, a 5′-32P-labeled template 2 (Fig. 1) containing Ug or Tg at position 7 was annealed to 18-mer 2 (Fig. 1) in 10 mmTris-HCl, pH 7.5, 50 mm NaCl, 1 mm EDTA buffer. As a control for the Fpg DNA glycosylase reaction, a 24-mer32pGAACTAGTGG(8-oxo-G)TCCCCCGGGCTGC was annealed to the appropriate 24-mer complement strand. For all substrates, the concentration range used was 20–300 nm. Endo III, endo VIII, and Fpg DNA glycosylase were used in the 2–5 nmconcentration range. Aliquots of the reaction mixtures were withdrawn at 0.5-min intervals and quenched with gel loading buffer. For each substrate and enzyme, the data obtained were then fitted to calculate the apparent Km and Vmaxvalues using the Macintosh program, k.cat (BioMetallics, Inc.). All DNA polymerase reactions were terminated by the addition of an equal volume of loading buffer (95% formamide, 0.05% bromphenol blue, 0.05% xylene cyanol, and 20 mm EDTA). Reaction products were analyzed by electrophoresis on 0.4 mm, 13% polyacrylamide gels containing 8m urea. The gels were electrophoresed in 50 mmTris borate, 2 mm EDTA buffer, pH 8.3, for 1.5–3 h at 2000 V, dried under vacuum, and exposed to x-ray film. The radioactivity in the bands corresponding to the products of enzymatic reactions were analyzed using a Model GS-250 Molecular Imager System (Bio-Rad). Tg is assumed to be the A conformer (as defined by Miller and Miaskiewicz (34Miller J. Miaskiewicz K. DNA Damage: Effects on DNA Structure and Protein Recognition. The New York Academy of Sciences, New York1994: 71-91Google Scholar)), the 5R,6S-stereoisomer in which the hydroxyl groups at the C5 and C6 positions are in the pseudoequatorial (5-eq) and pseudoaxial (6-ax) positions, respectively (see Kung and Bolton (35Kung H.C. Bolton P.H. J. Biol. Chem. 1997; 272: 9227-9236Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) and references therein for a discussion of the identification of the cis-stereoisomer of Tg formed in DNA, and Miaskiewicz and Miller (36Miaskiewicz K. Miller J. Int. J. Radiat. Biol. 1993; 63: 677-686Crossref PubMed Scopus (30) Google Scholar) for ab initiodetermination of the relative stabilities of the 5-eq/6-ax and 5-ax/6-eq enantiomers of Tg). The 5-eq/6-ax enantiomers of Ug were found to be the most stable cis-isomers of Ug based onab initiocalculations 2A. Derecski-Kovacs, S. S. Wallace, and J. P. Bond, unpublished data. and the 5R,6S species was identified as the dominant conformer obtained from the synthesis procedure using NMR (31Purmal A.A. Bond J.P. Lyons B.A. Kow Y.W. Wallace S.S. Biochemistry. 1998; 37: 330-338Crossref PubMed Scopus (16) Google Scholar). The methods for obtaining geometries and force field parameters for Tg and Ug have been described previously (31Purmal A.A. Bond J.P. Lyons B.A. Kow Y.W. Wallace S.S. Biochemistry. 1998; 37: 330-338Crossref PubMed Scopus (16) Google Scholar). Briefly, geometries were obtained using Gaussian 94 (Gaussian, Inc.), partial charges were obtained, based on the Gaussian 94 calculations, using the RESP procedure of Kollman and co-workers (37Bayley C.I. Cieplak P. Cornell W.D. Kollman P.A. J. Phys. Chem. 1993; 97: 10269-101280Crossref Scopus (5533) Google Scholar), and the remaining force field parameters were chosen from the AMBER set (38Cornell W.D. Cieplak P. Bayley C. Gould I.R. Merz K.M., JR. Ferguson D.M. Spellmeyer D.C. Fox T. Caldwell J.W. Kollman P.A. J. Am. Chem. Soc. 1995; 117: 5179-5197Crossref Scopus (11498) Google Scholar). Damaged bases were modeled into DNA by replacing the pyrimidine of the central base pair in 7-base pair B-DNA fragments as described previously (31Purmal A.A. Bond J.P. Lyons B.A. Kow Y.W. Wallace S.S. Biochemistry. 1998; 37: 330-338Crossref PubMed Scopus (16) Google Scholar), and LeaP (39Pearlman, D. A., Case, D. A., Caldwell, J. W., Ross, W. S., Cheatham, T. E., III, Ferguson, D. M., Seibel, G. L., Singh, C., Weiner, P. L., and Kollman, P. A. (1995) AMBER, 4.1, University of California, San Francisco.Google Scholar) was used to add neutralizing counterions and explicit water molecules. Energy minimization and molecular dynamics of the counterions and solvent were followed by energy minimization and short molecular dynamics simulations of the entire systems. Nucleic acid structure parameters (40Dickerson R. Bansal M Christopher R Diekmann S. Hunter W. Kennard O. von Kitzing E. Lavery R. Nelson H. Olson W. Saenger W. Nucleic Acids Res. 1989; 17: 1797-1803Crossref PubMed Scopus (227) Google Scholar) were measured using the Biopolymer module of Insight® II from Biosym/MSI (which is based on the NEWHEL 91 program suite of Dickerson and co-workers). We note that the numerous limitations of the molecular modeling procedure used here (e.g. the absence of polymerase, the length of the DNA fragments, the duration of the simulations, and the use of B-DNA for the starting conformation) make it impossible to derive quantitative conclusions based on structure. The objective of the molecular mechanics calculations was to relieve the substantial steric repulsions that resulted from introduction of the damaged bases in B-DNA, and in doing so provide a plausible illustration of the impact of the difference between the A conformers of Tg and Ug on DNA structure. During the brief simulation, the Watson-Crick hydrogen bonds of the undamaged pairs remained essentially intact. Thymine glycol has been shown to be a strong block to several DNA polymerases (17Ide H. Kow Y.W. Wallace S.S. Nucleic Acids Res. 1985; 13: 8035-8052Crossref PubMed Scopus (237) Google Scholar, 18Rouet P. Essigmann J.M. Cancer Res. 1985; 45: 6113-6118PubMed Google Scholar, 19Hayes R.C. LeClerc J.E. Nucleic Acids Res. 1986; 14: 1045-1061Crossref PubMed Scopus (90) Google Scholar, 20Clark J.M. Beardsley G.P. Biochemistry. 1987; 26: 5398-5403Crossref PubMed Scopus (93) Google Scholar). When Tg was randomly introduced into DNA, it constituted an absolute block to Kf in all but one sequence context, 5′-C(Tg)Pu-3′ (19Hayes R.C. LeClerc J.E. Nucleic Acids Res. 1986; 14: 1045-1061Crossref PubMed Scopus (90) Google Scholar, 26Evans J. Maccabee P. Hatahet Z. Courcelle J. Bockrath R. Ide H. Wallace S.S. Mutat. Res. 1993; 299: 147-156Crossref PubMed Scopus (104) Google Scholar). To compare the bypass of Ug and Tg by Kf(exo−), three different DNA templates containing Ug or Tg in the sequence contexts 5′-CXG-3′ (known Tg bypass context, see Refs. 19Hayes R.C. LeClerc J.E. Nucleic Acids Res. 1986; 14: 1045-1061Crossref PubMed Scopus (90) Google Scholar, 24Ide H. Melamede R.J. Wallace S.S. Biochemistry. 1987; 26: 964-969Crossref PubMed Scopus (41) Google Scholar, and 26Evans J. Maccabee P. Hatahet Z. Courcelle J. Bockrath R. Ide H. Wallace S.S. Mutat. Res. 1993; 299: 147-156Crossref PubMed Scopus (104) Google Scholar), 5′-GXT-3′, or 5′-TXA-3′, where X was Ug or Tg (templates 1, 4, and 5, respectively, Fig. 1), were prepared. As a "no lesion" control, templates 1, 4, and 5 contained T in place of Tg or Ug and as a "complete blockage" control, templates 1, 4, and 5 contained an abasic site. The same 5′-32P-labeled primer 1 was used with all three templates. Figs. 2 and3 show the results of translesion synthesis using these templates with different concentrations of Kf(exo−). With the "bypass sequence context" (Fig. 2), both Tg and Ug were bypassed at high concentrations (10−2and 10−3 μm/μl) of Kf(exo−) (lanes 9, 10, and 13, 14, Fig. 2). At 10−2 μm/μl of Kf(exo−), even an abasic site was successfully bypassed (lane 1, Fig. 2); however, an almost complete block was observed with an abasic site (lane 2, Fig. 2) at 10−3 μm/μl where Tg was bypasssed (lane 10, Fig. 2). Lowering the polymerase
Referência(s)