A Transforming Growth Factor-β Control Element Required for SM α-Actin Expression in Vivo Also Partially Mediates GKLF-dependent Transcriptional Repression
2003; Elsevier BV; Volume: 278; Issue: 48 Linguagem: Inglês
10.1074/jbc.m301902200
ISSN1083-351X
AutoresYan Liu, Sanjay Sinha, Gary K. Owens,
Tópico(s)TGF-β signaling in diseases
ResumoWe previously demonstrated that a conserved transforming growth factor-β control element (TCE) within the 5′-region of the smooth muscle cell (SMC) differentiation marker gene SM α-actin could mediate both transcriptional activation and repression in cultured SMCs through interaction with members of the zinc finger Kruppel-like transcription factor (KLF) family. The aims of the present studies were to: 1) determine the role of the SM α-actin TCE in vivo through mutagenesis studies in transgenic mice and 2) further characterize the possible role and mechanisms by which the TCE-binding factor GKLF/KLF4 induces repression of SMC marker genes in various SMC model systems in vitro. Our results showed that the TCE was required for SM α-actin promoter activity in transgenic mice in vivo. Results of transient transfection studies showed that GKLF-induced repression of a SM α-actin promoter/luciferase reporter gene partially depended on the TCE. Furthermore, a GKLF overexpressing adenovirus inhibited whereas GKLF morpholino antisense oligos increased expression of endogenous SMC marker genes. Results of chromatin immunoprecipitation assays showed GKLF binding to TCE containing regions of various SMC marker gene promoters within intact chromatin. Finally, results of co-transfection studies showed that overexpression of IKLF/KLF5 reversed GKLF-dependent repression thus supporting a model of reciprocal activation-repression of SMC gene expression by different members of the KLF gene family. We previously demonstrated that a conserved transforming growth factor-β control element (TCE) within the 5′-region of the smooth muscle cell (SMC) differentiation marker gene SM α-actin could mediate both transcriptional activation and repression in cultured SMCs through interaction with members of the zinc finger Kruppel-like transcription factor (KLF) family. The aims of the present studies were to: 1) determine the role of the SM α-actin TCE in vivo through mutagenesis studies in transgenic mice and 2) further characterize the possible role and mechanisms by which the TCE-binding factor GKLF/KLF4 induces repression of SMC marker genes in various SMC model systems in vitro. Our results showed that the TCE was required for SM α-actin promoter activity in transgenic mice in vivo. Results of transient transfection studies showed that GKLF-induced repression of a SM α-actin promoter/luciferase reporter gene partially depended on the TCE. Furthermore, a GKLF overexpressing adenovirus inhibited whereas GKLF morpholino antisense oligos increased expression of endogenous SMC marker genes. Results of chromatin immunoprecipitation assays showed GKLF binding to TCE containing regions of various SMC marker gene promoters within intact chromatin. Finally, results of co-transfection studies showed that overexpression of IKLF/KLF5 reversed GKLF-dependent repression thus supporting a model of reciprocal activation-repression of SMC gene expression by different members of the KLF gene family. Regulation of SMC 1The abbreviations used are: SMCsmooth muscle cellTGFtransforming growth factorTCETGF-β control elementANOVAanalysis of variancepfuplaque-forming unitChIPchromatin immunoprecipitation assayKLFKruppel-like transcription factorEGFPenhanced green fluorescent proteinEMSAelectrophoretic mobility shift assayCMVcytomegalovirus. differentiation is known to play a critical role in blood vessel formation during embryogenesis (1Hungerford J.E. Little C.D. J. Vasc. Res. 1999; 36: 2-27Crossref PubMed Scopus (236) Google Scholar). Moreover, in pathological states such as atherogenesis, restenosis, and hypertension, SMCs "dedifferentiate" by reducing expression of SMC marker genes and increasing their proliferation rate and synthesis of extracellular matrix proteins (2Owens G.K. Atherosclerosis and Coronary Artery Disease. Lippincott-Raven Publishers, Philadelphia1996: 401-420Google Scholar). As such, there is considerable interest in identifying extracellular signals, signal transducing molecules and transcription factors involved in regulating SMC differentiation. Many different environmental cues are known to affect SMC differentiation including endothelial cell-SMC interactions, SMC-matrix contacts, mechanical forces, and various cytokines such as platelet-derived growth factor BB (PDGF-BB), activin, and transforming growth factor β1 (TGF-β1). Of particular interest, TGF-β1 has been implicated in control of SMC differentiation/proliferation and synthesis of extracellular matrix, processes that are important for blood vessel development/maturation and/or progression of vascular disorders such as atherosclerosis and restenosis after balloon angioplasty (3Owens G.K. Geisterfer A.A. Yang Y.W. Komoriya A. J. Cell Biol. 1988; 107: 771-780Crossref PubMed Scopus (236) Google Scholar, 4Ross R. Nature. 1993; 362: 801-809Crossref PubMed Scopus (10004) Google Scholar). TGF-β1 has also been shown to induce expression of SMC differentiation marker genes in a variety of cell types in vitro, including multipotent embryonic 10T1/2 cells (5Hirschi K.K. Rohovsky S.A. D'Amore P.A. J. Cell Biol. 1998; 141: 805-814Crossref PubMed Scopus (704) Google Scholar), neural crest cells (6Shah N.M. Groves A.K. Anderson D.J. Cell. 1996; 85: 331-343Abstract Full Text Full Text PDF PubMed Scopus (700) Google Scholar), myofibroblasts (7Desmouliere A. Geinoz A. Gabbiani F. Gabbiani G. J. Cell Biol. 1993; 122: 103-111Crossref PubMed Scopus (1895) Google Scholar), and pericytes (8Verbeek M.M. Otte-Holler I. Wesseling P. Ruiter D.J. de Waal R.M. Am. J. Pathol. 1994; 144: 372-382PubMed Google Scholar). The spatial and temporal expression pattern of TGF-β1 and TGF-β type II receptor expression in mesenchymal cells is consistent with the possibility that TGF-β1 plays an important role in stimulating vascular development (9Lawler S. Candia A.F. Ebner R. Shum L. Lopez A.R. Moses H.L. Wright C.V. Derynck R. Development. 1994; 120: 165-175PubMed Google Scholar). In addition, targeted disruption of the TGF-β1 gene, or TGF-β receptor genes resulted in early embryonic lethality due to defects in development and/or vascular maturation as manifested by reduced investment of endothelial tubes by presumptive SMCs. For example, 50% of mice deficient in both alleles of TGF-β1 died in utero between 9.5 and 10.5 dpc from abnormalities in yolk sac blood vessel development (10Dickson M.C. Martin J.S. Cousins F.M. Kulkarni A.B. Karlsson S. Akhurst R.J. Development. 1995; 121: 1845-1854Crossref PubMed Google Scholar). The vessel defects observed included impaired contacts between layers of endothelial and mesenchymal cells. Similarly, disruption of the TGF-β type II receptor caused embryonic lethality around E10.5 due to defects in yolk sac vasculogenesis, including enlargement and reduced SMC investment of yolk sac blood vessels (11Oshima M. Oshima H. Taketo M.M. Dev. Biol. 1996; 179: 297-302Crossref PubMed Scopus (563) Google Scholar). Knockout of endoglin, a TGF-β type III receptor, also led to embryonic lethality by 11.5 dpc from defects in angiogenesis including failed VSMC development (12Li D.Y. Sorensen L.K. Brooke B.S. Urness L.D. Davis E.C. Taylor D.G. Boak B.B. Wendel D.P. Science. 1999; 284: 1534-1537Crossref PubMed Scopus (723) Google Scholar). However, since the mice with disrupted genes died before SMC differentiation began during embryogenesis, the role of TGF-β in regulating SMC differentiation in vivo remains unclear. smooth muscle cell transforming growth factor TGF-β control element analysis of variance plaque-forming unit chromatin immunoprecipitation assay Kruppel-like transcription factor enhanced green fluorescent protein electrophoretic mobility shift assay cytomegalovirus. In contrast to its clearly documented effect in promoting SMC differentiation in vitro, the role of TGF-β1 in atherogenesis and restenosis is controversial and complex. For example, TGF-β1 is not only released by platelets (13Assoian R.K. Sporn M.B. J. Cell Biol. 1986; 102: 1217-1223Crossref PubMed Scopus (425) Google Scholar) and macrophages (14Assoian R.K. Fleurdelys B.E. Stevenson H.C. Miller P.J. Madtes D.K. Raines E.W. Ross R. Sporn M.B. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 6020-6024Crossref PubMed Scopus (805) Google Scholar) at the site of vascular injury, but its mRNA and protein are also elevated in neointimal vascular SMCs following balloon injury to rat carotid arteries (15Majesky M.W. Lindner V. Twardzik D.R. Schwartz S.M. Reidy M.A. J. Clin. Investig. 1991; 88: 904-910Crossref PubMed Scopus (473) Google Scholar, 16Nikol S. Isner J.M. Pickering J.G. Kearney M. Leclerc G. Weir L. J. Clin. Investig. 1992; 90: 1582-1592Crossref PubMed Scopus (356) Google Scholar). Furthermore, TGF-β1 expression was shown to be higher in restenotic tissue than in primary plaque tissue from human atherectomy specimens (16Nikol S. Isner J.M. Pickering J.G. Kearney M. Leclerc G. Weir L. J. Clin. Investig. 1992; 90: 1582-1592Crossref PubMed Scopus (356) Google Scholar). In addition, reduction of TGF-β1 levels in the blood vessel wall by neutralizing antibodies led to a small but significant reduction in neointima formation, whereas overexpression of TGF-β1 by adenoviral gene transfer resulted in transient neointima formation (17Wolf Y.G. Rasmussen L.M. Ruoslahti E. J. Clin. Investig. 1994; 93: 1172-1178Crossref PubMed Scopus (290) Google Scholar). On the other hand, it was recently reported that administration of TGF-βs 1, 2, and 3 neutralizing antibody accelerated the development of atherosclerotic lesions in apoE-deficient mice (18Mallat Z. Gojova A. Marchiol-Fournigault C. Esposito B. Kamate C. Merval R. Fradelizi D. Tedgui A. Circ. Res. 2001; 89: 930-934Crossref PubMed Scopus (416) Google Scholar). Previously our laboratory identified a novel cis-element referred to as TGF-β control element or TCE in the SM α-actin promoter that is highly conserved across species in multiple SMC marker genes including smooth muscle myosin heavy chain (SM MHC), SM22α, and h1-calponin (19Hautmann M.B. Madsen C.S. Owens G.K. J. Biol. Chem. 1997; 272: 10948-10956Abstract Full Text Full Text PDF PubMed Scopus (250) Google Scholar). Mutation of the TCE within the SM22α promoter in transgenic mice showed that the TCE was critical for expression of SM22α in all three muscle types during embryogenesis and in SMC containing tissues in adult mice (20Adam P.J. Regan C.P. Hautmann M.B. Owens G.K. J. Biol. Chem. 2000; 275: 37798-37806Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar). To identify possible TCE binding factors, a 17.5-day mouse embryo cDNA library was screened with a yeast one-hybrid system, using three repeats of TCE as bait sequence. One of the candidate TCE-binding factors identified was GKLF/KLF4, which belongs to a family of Kruppel-like zinc finger transcription factors hallmarked with three CX2CX3FX5LX2HX3H zinc finger motifs separated by a highly conserved 7-amino acid interfinger spacer, TGEKP(Y/F)X (21Shields J.M. Christy R.J. Yang V.W. J. Biol. Chem. 1996; 271: 20009-20017Abstract Full Text Full Text PDF PubMed Scopus (569) Google Scholar). Studies from our laboratory showed that GKLF specifically bound to the TCE of the SM α-actin or SM 22α promoters and overexpression of GKLF repressed expression of SM22α and SM α-actin promoter-reporter constructs in cultured SMCs. Paradoxically, TGF-β has been shown to up-regulate various SMC marker genes (20Adam P.J. Regan C.P. Hautmann M.B. Owens G.K. J. Biol. Chem. 2000; 275: 37798-37806Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar, 22Hautmann M.B. Adam P.J. Owens G.K. Arterioscler. Thromb. Vasc. Biol. 1999; 19: 2049-2058Crossref PubMed Scopus (103) Google Scholar). To reconcile this apparent contradiction, we postulated that the TCE could act as an activator or repressor of expression of SMC marker genes, and that activation or repression would dominate depending on the stoichiometry of specific binding factors. Consistent with this hypothesis, we found that: 1) GKLF was not expressed in TGF-β-treated differentiated SMCs but was present in phenotypically modulated cultured SMCs; 2) TGF-β1 could down-regulate GKLF RNA and protein in cultured SMCs; and 3) BTEB2/IKLF/KLF 5 could stimulate the activity of SM22α and SM α-actin promoters in cultured cells (20Adam P.J. Regan C.P. Hautmann M.B. Owens G.K. J. Biol. Chem. 2000; 275: 37798-37806Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar). Whereas the preceding studies have provided evidence implicating a possible role of the TCE/GKLF in transcriptional regulation of SM22α and SM α-actin in cultured SMCs, the previous studies have not: 1) addressed if GKLF could repress expression of endogenous SMC marker genes as opposed to transiently transfected promoter-reporter constructs; 2) directly tested if GKLF is an endogenous repressor for SMC differentiation using loss-of-function approaches; 3) determined if GKLF is directly associated with promoters of SMC marker genes within intact chromatin, and 4) directly tested whether IKLF can antagonize GKLF induced repression of SM α-actin promoter activity in cultured cells. The present studies address each of these questions, and provide compelling evidence that GKLF is a very potent repressor of multiple SMC differentiation marker genes at least in cultured cell systems. Generation and Analysis of Mutation of the SM α-Actin TCE in Transgenic Mice—Mutation of the SM α-actin TCE was made by PCR mutagenesis in the context of a full-length SM α-actin promoter/enhancer from –2560 to +2784 that we have previously shown is sufficient to recapitulate expression of the endogenous SM α-actin in transgenic mice in vivo (23Mack C.P. Owens G.K. Circ. Res. 1999; 84: 852-861Crossref PubMed Scopus (204) Google Scholar). A 1.1-kb fragment containing the TCE mutation was verified by sequencing and used to replace its wild type counterpart within the SM α-actin promoter (Fig. 1). The mutated promoter was then linked to a LacZ reporter to make the transgenic construct PPITCE-LacZ. The transgenic mice were then generated by the Transgenic Core Facility at the University of Virginia as described previously (23Mack C.P. Owens G.K. Circ. Res. 1999; 84: 852-861Crossref PubMed Scopus (204) Google Scholar). Positive founder lines were identified by PCR genotyping, and bred for assessment of transgene expression in embryonic and adult mice. Animals were euthanized by CO2 asphyxiation, and tissues or embryos stained for β-galactosidase activity as previously described (23Mack C.P. Owens G.K. Circ. Res. 1999; 84: 852-861Crossref PubMed Scopus (204) Google Scholar). Multiple independent founder lines were analyzed to address possible locus and transgene copy number effects on expression patterns. Cell Cultures—Rat aortic SMCs were cultured in Dulbecco's modified Eagle's medium + F12 (Invitrogen) supplemented with 10% fetal bovine serum (Hyclones), 200 μg/ml l-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin (Invitrogen) as previously described (19Hautmann M.B. Madsen C.S. Owens G.K. J. Biol. Chem. 1997; 272: 10948-10956Abstract Full Text Full Text PDF PubMed Scopus (250) Google Scholar). NIH 3T3 cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone), 0.075% sodium bicarbonate, 0.1 mm non-essential amino acids, 1 mm sodium pyruvate, 200 μg/ml l-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin (Invitrogen). Generation of Constructs and Virus—The SM α-actin promoter region from –2560 to +2784 (with or without TCE mutation) was subcloned into the pGL3 vector to generate PPITCE-Luc and PPI-Luc reporter constructs, respectively. GKLF cDNA was subcloned into a pcDNA3.0 mammalian expression vector (pcDNA-GKLF). The SRF expression plasmid pcDNA-SRF was generated as previously described (24Spencer J.A. Misra R.P. J. Biol. Chem. 1996; 271: 16535-16543Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar). The mouse IKLF cDNA was a generous gift from Dr. Masahiko Kurabayahi at the Gunma University (25Conkright M.D. Wani M.A. Anderson K.P. Lingrel J.B. Nucleic Acids Res. 1999; 27: 1263-1270Crossref PubMed Scopus (143) Google Scholar) and was subcloned into pcDNA3.0 vector (pcDNA-IKLF). A FLAG epitope tag was included on the N terminus of GKLF to generate pcDNA-Flag-GKLF. The FLAG-tagged GKLF was then subcloned into pShuttle (Clontech), and used to make an Adeno-GKLF construct according to the manufacturer's protocol. Purified GKLF adenoviruses (Ad-CMV-GKLF) were prepared by Gene Transfer Vector Core (Iowa). Control viruses Ad-CMV and ad-CMV-EGFP were also obtained there. A GKLF construct lacking the binding domain (pcDNA-GKLF-NB) was made by deleting 93 bp on the C terminus of the GKLF open reading frame. Transient Transfections/Reporter Assays and Infections by Adenovirus—SMCs were transfected with PPI-Luc or PPITCE-Luc and pcDNA-GKLF or pcDNA-GKLF-NB, and NIH 3T3 cells were transfected with PPI-Luc or PPITCE-Luc, pcDNA-SRF, pcDNA-GKLF and pcDNA-IKLF in triplicate using Superfect reagent (Qiagen) according to the manufacturer's protocol. The cells were incubated 48 h before being harvested with Passive Lysis Buffer (Promega). Luciferase activity was measured with Luciferase Assay Substrate (Promega), and was normalized to total protein (Coomassie Plus Protein Assay Reagent, Pierce). Transfections were repeated at least three times, and the relative luciferase activities were presented as mean ± S.E. SMCs were infected with GKLF Adeno virus (Ad-CMV-GKLF) or control virus (Ad-CMV) in triplicate 3 days after plating at multiplicity of infection (moi) of five plaque forming unit (pfu) per cell. The infection efficiency was demonstrated to be almost 100% based on infection with an EGFP expression adenovirus construct, i.e. Ad-CMV-EGFP (data not shown). RNA samples were prepared with Trizol reagent (Invitrogen) according to the manufacturer's instruction 24 h after infection. RNA samples were then subjected to real time RT-PCR analyses, and the relative changes are presented as mean ± S.E. The experiments were repeated three times. Loss-of-Function Assay Using Morpholino Oligos—A GKLF morpholino antisense oligonucleotide was designed to target at the initiation site for GKLF translation (agactcgccaggtggctgcctcatt) and was synthesized by Gene Tools (Fig. 5A). Morpholinos were transfected into SMC with ethoxylated polyethylenimine (EPEI) according to the manufacturer's instructions 1 day after plating. The transfection efficiency was verified to be higher than 80% with fluorescent control oligos (data not shown). The specificity of the antisense oligo was validated by employing two rigorous control oligos: GKLF-Inv, ttactccgtcggtggaccgctcaga and GKLF-Mis, agtctagccaggaggctgcgtcttt. RNA samples were prepared from cells 48 h after transfection with Trizol reagent (Invitrogen) according to the manufacturer's instruction. The purified RNA was then subjected to real time RT-PCR, and the relative changes are presented as mean ± S.E. The experiments were repeated seven times. Real Time RT-PCR—RNA samples were run on a 1% agarose gel to check quality. 1 μg of RNA was reverse-transcribed as follows: dH2O was mixed with 1 μg of RNA, made to 10 μl, heated at 68 °C for 10 min, and chilled on ice for 3 min. RNA was mixed with a 10-μl reaction mix: 4 μl of 5× buffer, 2 μl of 10 mm dNTP, 1 μl of random decamer (cat. 5722g, Ambion), 0.5 μl of RNase inhibitor (40 units/μl), 0.5 μl of Superscript II (Invitrogen), and 2 μl of dH2O, incubated at 42 °C for 90 min and heated up at 95 °C for 5 min. 0.5 μl of cDNA was used for each real time PCR reaction. The PCRs were performed in the iCycler (Bio-Rad) and unknown samples were quantified by reference to serial dilutions of a known standard. For each sample, SMC-specific gene expression was normalized to 18 S rRNA or GAPDH level to correct for differences in RNA extraction and reverse transcription efficiencies. The primer and probe sequences are described here: 18 S rRNA-For, cggctaccacatccaaggaa; 18 S rRNA-Rev, agctggaattaccgcggc; 18 S probe, tgctggcaccagacttgccctc; Rat SM α-actin-For, agtcgccatcaggaa cctcgag; Rat SM α-actin-Rev, atcttttccatgtcgtcccagttg; Rat SMMHC-For, cagttggacactatgtcagggaaa; SMMHC-Rev, atggagacaaatgctaatcagcc; SMMHC probe, caaaataccaaatgacagcaaagcccagc; GAPDH-For, ggctcatgaccacagtccat; GAPDH-Rev, gcctgcttcaccaccttct; and GAPDH probe, cctggagaaacctgccaagtatgatgac (IDT). Chromatin Immunoprecipitation (ChIP)—Three days after plating, SMCs were infected with Ad-CMV-GKLF or Ad-CMV at 5 M.O.I. After a 24-h incubation, ChIP assays were performed as described previously (26Manabe I. Owens G.K. J. Clin. Investig. 2001; 107: 823-834Crossref PubMed Scopus (126) Google Scholar). In brief, chromatin samples were immunoprecipitated with no antibody, anti-acetylated histone 4 (Upstate), anti-SRF antibody (Santa Cruz Biotechnology, Inc.), or anti-FLAG antibody (Sigma). Immunoprecipitated chromatin samples were reverse-cross-linked, purified, and subjected to PCR amplification using primers specific to TCE-containing promoter regions of SM α-actin, SM MHC, or transin. The supernatant of the no antibody immunoprecipitation reaction was used as total input DNA. The sequences of the PCR primers were as follows: SM α-actin 5, acgcgaacagaggaatgcagtggaagagac; SM α-actin 3, cctcccactcgcctcccaaacaaggagc; SM MHC 5, ctgcgcgggaccatatttagtcagggggag; SM MHC 3, ctgggcgggag acaacccaaaaaggccagg; Transin 5, gatggccttatctggcatcaatggga; and Transin 3, gatgctctcccactcaccaactcact. The SM α-Actin TCE Was Required for SM α-Actin Promoter Activity in Vivo—Our initial goal was to determine if a 4-bp mutation of the SM α-actin TCE altered expression in transgenic mice (Fig. 1). Our earlier studies showed that the TCE mutation employed prevented TGF-β-dependent TCE binding activity in EMSA and abolished SM α-actin promoter activity in cultured SMCs (20Adam P.J. Regan C.P. Hautmann M.B. Owens G.K. J. Biol. Chem. 2000; 275: 37798-37806Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar). In the current study, four independent transgenic founder lines carrying the PPITCE-LacZ transgene were obtained, and three of them successfully transmitted the transgene over multiple generations. Embryos at 13.5 dpc and 16.5 dpc or adult tissues from 6–10 weeks old mice were stained with X-gal and compared with embryos or tissues carrying the wild-type SM α-actin promoter from –2560 to +2784/LacZ transgene (PPI-LacZ), which was previously shown to recapitulate the same spatial and temporal expression pattern as the endogenous SM α-actin gene (23Mack C.P. Owens G.K. Circ. Res. 1999; 84: 852-861Crossref PubMed Scopus (204) Google Scholar). Our results showed that the TCE mutation completely abolished SM α-actin promoter activity in all three muscle types in embryos (Fig. 2A). In adult tissues, the TCE mutation abolished LacZ expression in aorta, coronary vessels, and bronchi, while it dramatically decreased LacZ expression in bladder, intestine, and stomach (Fig. 2B). These results thus provide compelling evidence that the TCE is required for expression of the SM α-actin gene in vivo in most SMC tissues, although results showing partial detection of β-gal activity in bladder and intestine suggest that there may be different regulatory paradigms for SM α-actin in various SMC subtypes in a manner similar to the SM MHC (26Manabe I. Owens G.K. J. Clin. Investig. 2001; 107: 823-834Crossref PubMed Scopus (126) Google Scholar) and SM22α genes (27Li L. Miano J.M. Mercer B. Olson E.N. J. Cell Biol. 1996; 132: 849-859Crossref PubMed Scopus (285) Google Scholar). Virtually identical results were found in all three independent TCE mutant transgenic founder lines thus indicating that loss of expression was a function of mutation of the TCE and not due to random locus-dependent gene silencing. A major long term goal of our laboratory has been to understand mechanisms that down-regulate expression of SMC marker genes associated with phenotypic modulation. However, since results of our TCE mutant studies in transgenic mice showed virtually complete absence of SM α-actin promoter activity in various SMC tissues in vivo, it was not possible to further examine role of TCE in phenotypic modulation of SMC using these transgenic founder lines. As an alternative, we employed cultured SMCs, which are well documented to be phenotypically modulated (28Owens G.K. Physiol. Rev. 1995; 75: 487-517Crossref PubMed Scopus (1404) Google Scholar), to study the possible role of the TCE in expression of SM α-actin gene expression. GKLF-induced Repression of the SM α-Actin Promoter in Cultured SMCs Was Partially Dependent on a Conserved TGF-β Control Element (TCE)—Our previous studies showed that the zinc finger Kruppel-like factor GKLF bound to SM22α and SM α-actin TCEs in EMSA and repressed the activity of the SM22α and SM α-actin promoters in co-transfection studies of TGF-β1-treated 10T1/2 cells (20Adam P.J. Regan C.P. Hautmann M.B. Owens G.K. J. Biol. Chem. 2000; 275: 37798-37806Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar). In this study, we tested whether the GKLF-mediated repression of the SM α-actin promoter activity was TCE-dependent. As shown in Fig. 3A, at a low concentration of GKLF plasmid, repression of SM α-actin expression was highly TCE dependent, whereas at higher concentrations of GKLF plasmid, the relative dependence on the TCE was virtually lost. Since transcription factors are usually present at low copy number in cells, it is tempting to speculate that the TCE dependence exhibited at lower concentrations of GKLF plasmid might better reflect what occurs in vivo under physiological circumstances, and that the effects seen at higher concentrations of GKLF plasmid may represent gene squelching. However, due to the absence of antibody that is completely specific for GKLF the actual concentration of GKLF protein that exists in vivo is unknown, and it is equally plausible that GKLF may play a key role in modulating SMC gene expression via both TCE dependent and independent mechanisms. The results shown in Fig. 3A indicate that a significant component of GKLF-induced suppression of SM α-actin was TCE-independent. Indeed, the proximity of the TCE and the CArG box, a conserved SRF binding element that is required for expression of multiple SMC genes (23Mack C.P. Owens G.K. Circ. Res. 1999; 84: 852-861Crossref PubMed Scopus (204) Google Scholar, 26Manabe I. Owens G.K. J. Clin. Investig. 2001; 107: 823-834Crossref PubMed Scopus (126) Google Scholar, 27Li L. Miano J.M. Mercer B. Olson E.N. J. Cell Biol. 1996; 132: 849-859Crossref PubMed Scopus (285) Google Scholar) suggests that TCE-independent GKLF mediated repression might depend on both protein-DNA and/or protein-protein interactions. To test if DNA binding was required for GKLF-induced repression, we made a GKLF construct with two zinc fingers of the DNA binding domain deleted (designated GKLF-NB). This mutation completely abrogated GKLF's ability to repress the SM α-actin promoter (Fig. 3B). However, we could not rule out the possibility that destroying the GKLF DNA binding domain might also inactivate its effecter domain or its activity to interact with other protein involved in regulation of SMC marker genes, although studies by others have shown that GKLF has a modular structure, and that its DNA binding domain and effecter domain can function independently of each other (29Geiman D.E. Ton-That H. Johnson J.M. Yang V.W. Nucleic Acids Res. 2000; 28: 1106-1113Crossref PubMed Google Scholar, 30Yet S.F. McA'Nulty M.M. Folta S.C. Yen H.W. Yoshizumi M. Hsieh C.M. Layne M.D. Chin M.T. Wang H. Perrella M.A. Jain M.K. Lee M.E. J. Biol. Chem. 1998; 273: 1026-1031Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). In summary, the preceding results indicate that GKLF can potentially inhibit transcription of SM α-actin through both TCE-dependent and -independent mechanisms. However, it is unclear whether TCE-independent activity is mediated through binding to another cis-element in the SM α-actin promoter and/or is mediated through protein-protein interactions. A GKLF-expressing Adenovirus Repressed Endogenous SM α-Actin and SM MHC Expression in Cultured SMCs—Because of low transfection efficiency in cultured SMCs, to directly test if GKLF could alter expression of endogenous SMC marker genes, a GKLF-expressing adenovirus (Ad-CMV-GKLF) was generated. Cultured SMCs were infected by Ad-CMV, Ad-CMV-EGFP, or Ad-CMV-GKLF at 5 pfu/cell. The infected cells appeared normal, and no apparent cell death was observed by phase-contrast microscopy. Total RNA was prepared from infected cells, and subjected to reverse transcription and real time RT-PCR analyses of SM α-actin and SM MHC, which represent markers of early and late stages of SMC differentiation respectively. As shown in Fig. 4, expression of SM α-actin and SM MHC mRNAs were substantially reduced in GKLF virus infected cells as compared with cells infected with control viruses. Results thus indicate that GKLF can potential inhibit expression of multiple endogenous SMC differentiation marker genes. Inhibition of Endogenous GKLF with Antisense Morpholinos Increased Expression of Endogenous SM α-Actin and SM MHC in Cultured SMCs—Our earlier studies showed that GKLF was expressed in phenotypically modulated cultured SMCs (20Adam P.J. Regan C.P. Hautmann M.B. Owens G.K. J. Biol. Chem. 2000; 275: 37798-37806Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar). To test whether GKLF is an endogenous repressor of SMC marker gene expression, morpholino antisense oligos were used to knockdown GKLF in cultured SMCs. Morpholino oligos consist of four different morpholino subunits, each of which contains one of the four genetic bases linked to a 6-member morpholino ring, and t
Referência(s)