Role of HIF-1 and NF-κB Transcription Factors in the Modulation of Transferrin Receptor by Inflammatory and Anti-inflammatory Signals
2008; Elsevier BV; Volume: 283; Issue: 30 Linguagem: Inglês
10.1074/jbc.m800365200
ISSN1083-351X
AutoresLorenza Tacchini, Elena Gammella, Cristina Ponti, Stefania Recalcati, Gaetano Cairo,
Tópico(s)Heme Oxygenase-1 and Carbon Monoxide
ResumoInflammation generates various changes in body iron homeostasis, including iron sequestration in the reticuloendothelial system with ensuing hypoferremia and anemia of chronic disease. Increased iron accumulation is caused by hepcidin-mediated down-regulation of the iron export protein ferroportin and higher iron uptake. However, enhanced iron acquisition by macrophages cannot be accounted for by the previously reported transferrin receptor (TfR1) down-regulation in macrophages exposed to lipopolysaccharide (LPS)/interferon γ (IFNγ) because it impairs a major iron uptake mechanism. Because TfR1 is up-regulated by the hypoxia-inducible factor (HIF-1), we investigated the effect of inflammatory and anti-inflammatory signals on HIF-1-mediated TfR1 gene expression. Exposure of mouse macrophages (RAW 264.7 and J774A.1 cells or peritoneal macrophages) to LPS/IFNγ up-regulated NF-κB, which in turn rapidly and transiently activated HIF-1-dependent TfR1 expression and iron uptake. Activation of an anti-inflammatory pathway by pre-exposure to the adenosine A2A receptor agonist CGS21680 prevented the inducing effect of LPS/IFNγ on HIF-1 and TfR1 expression by inhibiting NF-κB activity, whereas treatment with CGS21680 alone increased HIF-1-mediated TfR1 expression by means of an NF-κB-independent signaling pathway. In conclusion, an interplay of the HIF-1 and NF-κB pathways controls TfR1 transcription in inflammation. The consequent changes in TfR1 expression may be involved in modulating iron retention in inflammatory macrophages, thus possibly contributing to the development of hypoferremia in the early phases preceding the down-regulation of macrophage ferroportin by hepcidin. Inflammation generates various changes in body iron homeostasis, including iron sequestration in the reticuloendothelial system with ensuing hypoferremia and anemia of chronic disease. Increased iron accumulation is caused by hepcidin-mediated down-regulation of the iron export protein ferroportin and higher iron uptake. However, enhanced iron acquisition by macrophages cannot be accounted for by the previously reported transferrin receptor (TfR1) down-regulation in macrophages exposed to lipopolysaccharide (LPS)/interferon γ (IFNγ) because it impairs a major iron uptake mechanism. Because TfR1 is up-regulated by the hypoxia-inducible factor (HIF-1), we investigated the effect of inflammatory and anti-inflammatory signals on HIF-1-mediated TfR1 gene expression. Exposure of mouse macrophages (RAW 264.7 and J774A.1 cells or peritoneal macrophages) to LPS/IFNγ up-regulated NF-κB, which in turn rapidly and transiently activated HIF-1-dependent TfR1 expression and iron uptake. Activation of an anti-inflammatory pathway by pre-exposure to the adenosine A2A receptor agonist CGS21680 prevented the inducing effect of LPS/IFNγ on HIF-1 and TfR1 expression by inhibiting NF-κB activity, whereas treatment with CGS21680 alone increased HIF-1-mediated TfR1 expression by means of an NF-κB-independent signaling pathway. In conclusion, an interplay of the HIF-1 and NF-κB pathways controls TfR1 transcription in inflammation. The consequent changes in TfR1 expression may be involved in modulating iron retention in inflammatory macrophages, thus possibly contributing to the development of hypoferremia in the early phases preceding the down-regulation of macrophage ferroportin by hepcidin. Inflammatory states are associated with changes in body iron homeostasis (1Weiss G. Best. Pract. Res. Clin. Haematol. 2005; 18: 183-201Crossref PubMed Scopus (133) Google Scholar). The main systemic response is a rapid fall in plasma iron concentration accompanied by iron sequestration in the reticuloendothelial system. By restricting iron availability for erythroid progenitor cells, prolonged hypoferremia may limit hemoglobin synthesis and cause inflammation-related anemia (2Ganz T. Blood. 2003; 102: 783-788Crossref PubMed Scopus (1193) Google Scholar, 3Andrews N.C. Schmidt P.J. Annu. Rev. Physiol. 2007; 69: 69-85Crossref PubMed Scopus (476) Google Scholar). Increased iron retention within inflammatory macrophages, which is favored by the induction of the iron storage protein ferritin (4Konijn A.M. Carmel N. Levy R. Hershko C. Br. J. Haematol. 1981; 49: 361-370Crossref PubMed Scopus (89) Google Scholar, 5Recalcati S. Taramelli D. Conte D. Cairo G. Blood. 1998; 91: 1059-1066Crossref PubMed Google Scholar, 6Kim S. Ponka P. J. Biol. Chem. 2000; 275: 6220-6226Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 7Kim S. Ponka P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 12214-12219Crossref PubMed Scopus (71) Google Scholar, 8Torti F.M. Torti S.V. Blood. 2002; 99: 3505-3516Crossref PubMed Scopus (878) Google Scholar) and regarded as a host attempt to withhold iron from the invading pathogens (1Weiss G. Best. Pract. Res. Clin. Haematol. 2005; 18: 183-201Crossref PubMed Scopus (133) Google Scholar, 9Knutson M. Wessling-Resnick M. Crit. Rev. Biochem. Mol. Biol. 2003; 38: 61-88Crossref PubMed Scopus (257) Google Scholar, 10Cairo G. Bernuzzi F. Recalcati S. Genes Nutrition. 2006; 1: 25-40Crossref PubMed Google Scholar), may be due to increased iron uptake and decreased iron export (9Knutson M. Wessling-Resnick M. Crit. Rev. Biochem. Mol. Biol. 2003; 38: 61-88Crossref PubMed Scopus (257) Google Scholar). Characterization of the interaction between the acute phase protein hepcidin and the iron exporter ferroportin has shed light on the molecular mechanisms underlying the blockade of macrophage iron release (2Ganz T. Blood. 2003; 102: 783-788Crossref PubMed Scopus (1193) Google Scholar, 3Andrews N.C. Schmidt P.J. Annu. Rev. Physiol. 2007; 69: 69-85Crossref PubMed Scopus (476) Google Scholar, 11De Domenico I. McVey Ward D. Kaplan J. Nat. Rev. Mol. Cell Biol. 2008; 9: 72-81Crossref PubMed Scopus (351) Google Scholar). The cytokine-triggered increase in circulating hepcidin causes the internalization and degradation of ferroportin (12Nemeth E. Tuttle M.S. Powelson J. Vaughn M.B. Donovan A. Ward D.M. Ganz T. Kaplan J. Science. 2004; 306: 2090-2093Crossref PubMed Scopus (3691) Google Scholar), the major iron exporter, thus blocking iron release from macrophages (13Delaby C. Pilard N. Goncalves A.S. Beaumont C. Canonne-Hergaux F. Blood. 2005; 106: 3979-3984Crossref PubMed Scopus (244) Google Scholar). However, although it has been shown that direct exposure to a bolus of hepcidin rapidly lowers serum iron (14Rivera S. Nemeth E. Gabayan V. Lopez M.A. Farshidi D. Ganz T. Blood. 2005; 106: 2196-2199Crossref PubMed Scopus (275) Google Scholar) and that peak urinary hepcidin levels in LPS-treated subjects precede the development of hypoferremia (15Kemna E. Pickkers P. Nemeth E. Van der Hoeven H. Swinkels D. Blood. 2005; 106: 1864-1866Crossref PubMed Scopus (415) Google Scholar), the rapid onset of hypoferremia in LPS-treated mice (16Gutteberg T.J. Rokke O. Andersen O. Jorgensen T. Scand. J. Infect. Dis. 1989; 21: 709-715Crossref PubMed Scopus (38) Google Scholar, 17Bertini R. Bianchi M. Erroi A. Villa P. Ghezzi P. J. Leukocyte Biol. 1989; 46: 254-262Crossref PubMed Scopus (55) Google Scholar, 18Yang F. Liu X.B. Quinones M. Melby P.C. Ghio A. Haile D.J. J. Biol. Chem. 2002; 277: 39786-39791Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 19Laftah A.H. Sharma N. Brookes M.J. McKie A.T. Simpson R.J. Iqbal T.H. Tselepis C. Biochem. J. 2006; 397: 61-67Crossref PubMed Scopus (92) Google Scholar) suggests that factors other than hepcidin-dependent ferroportin down-regulation (e.g. iron uptake) may be important for iron sequestration within reticuloendothelial cells during the very early phase of the inflammatory response. The pathways of iron acquisition by macrophages are less clear, as are the changes induced by inflammatory stimuli. This is particularly true in the case of the role of changes in the internalization of transferrin-bound iron through the transferrin receptor (TfR1) 2The abbreviations used are: TfR, transferrin (Tf) receptor; IRP, iron regulatory protein; LPS, lipopolysaccharide; IFN, interferon; HIF, hypoxia-inducible factor; HRE, hypoxia-responsive element; shRNA, short hairpin RNA; DFO, desferrioxamine; RLA, relative luciferase activity. during the development of reticuloendothelial iron sequestration under inflammatory conditions. A number of studies have shown that exposure to inflammatory stimuli for 10–24 h down-regulates TfR1 expression (5Recalcati S. Taramelli D. Conte D. Cairo G. Blood. 1998; 91: 1059-1066Crossref PubMed Google Scholar, 6Kim S. Ponka P. J. Biol. Chem. 2000; 275: 6220-6226Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 20Byrd T.F. Horwitz M.A. J. Clin. Investig. 1993; 91: 969-976Crossref PubMed Scopus (136) Google Scholar, 21Mulero V. Brock J.H. Blood. 1999; 94: 2383-2389Crossref PubMed Google Scholar, 22Kim S. Ponka P. J. Biol. Chem. 1999; 274: 33035-33042Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 23Ludwiczek S. Aigner E. Theurl I. Weiss G. Blood. 2003; 101: 4148-4154Crossref PubMed Scopus (351) Google Scholar) and, because this impairs a major iron uptake mechanism (21Mulero V. Brock J.H. Blood. 1999; 94: 2383-2389Crossref PubMed Google Scholar, 23Ludwiczek S. Aigner E. Theurl I. Weiss G. Blood. 2003; 101: 4148-4154Crossref PubMed Scopus (351) Google Scholar), it cannot account for the increased accumulation of iron in macrophages. This inhibition of TfR1 expression is post-transcriptionally controlled by means of the well characterized interaction between iron regulatory proteins (IRPs) and the iron-responsive elements in the untranslated regions of iron-related mRNAs (24Hentze M.W. Kuhn L.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8175-8182Crossref PubMed Scopus (1137) Google Scholar, 25Cairo G. Pietrangelo A. Biochem. J. 2000; 352: 241-250Crossref PubMed Scopus (276) Google Scholar, 26Cairo G. Recalcati S. Pietrangelo A. Minotti G. Free Radic. Biol. Med. 2002; 32: 1237-1243Crossref PubMed Scopus (157) Google Scholar, 27Theil E.C. Leipuviene R. Cell. Mol. Life Sci. 2007; 64: 2945-2955Crossref PubMed Scopus (83) Google Scholar), as nitric oxide (NO)-dependent IRP2 down-regulation decreases TfR1 mRNA levels and increases ferritin synthesis (5Recalcati S. Taramelli D. Conte D. Cairo G. Blood. 1998; 91: 1059-1066Crossref PubMed Google Scholar, 6Kim S. Ponka P. J. Biol. Chem. 2000; 275: 6220-6226Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 7Kim S. Ponka P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 12214-12219Crossref PubMed Scopus (71) Google Scholar, 22Kim S. Ponka P. J. Biol. Chem. 1999; 274: 33035-33042Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). However, TfR1 expression is also regulated at the transcriptional level. We and others have previously shown that TfR1 expression is up-regulated by the hypoxia-inducible factor (HIF1) (28Tacchini L. Bianchi L. Bernelli-Zazzera A. Cairo G. J. Biol. Chem. 1999; 274: 24142-24146Abstract Full Text Full Text PDF PubMed Scopus (297) Google Scholar, 29Lok C.N. Ponka P. J. Biol. Chem. 1999; 274: 24147-24152Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 30Bianchi L. Tacchini L. Cairo G. Nucleic Acids Res. 1999; 27: 4223-4227Crossref PubMed Scopus (152) Google Scholar), which is typically activated under hypoxic conditions but can also be turned on by a number of non-hypoxic stimuli, including inflammatory signals such as NO and LPS (for review, see Dery et al. (31Dery M.A. Michaud M.D. Richard D.E. Int. J. Biochem. Cell Biol. 2005; 37: 535-540Crossref PubMed Scopus (442) Google Scholar)). On the basis of these considerations, we investigated the effect of LPS/IFNγ on the HIF-1-mediated activation of TfR1 gene expression in macrophages. In an attempt to clarify the effect of the interplay between inflammatory and anti-inflammatory modulators on HIF-1-mediated TfR1 expression, we also considered the effect of the anti-inflammatory molecule adenosine, as we have recently shown that adenosine A2A receptor-mediated signaling induces HIF-1 and activates HIF-1 target genes in macrophages (32De Ponti C. Carini R. Alchera E. Nitti M.P. Locati M. Albano E. Cairo G. Tacchini L. J. Leukocyte Biol. 2007; 82: 392-402Crossref PubMed Scopus (66) Google Scholar). The results of the present study show that, by inducing NF-κB, inflammatory signals activate HIF-1-dependent and IRP-independent TfR1 expression and the uptake of transferrin-bound iron. They also show that exposure to the adenosine A2A receptor agonist CGS21680 alone increases HIF-1-mediated TfR1 expression, whereas pre-treatment with CGS21680 prevents the inducing effect of LPS/IFNγ on HIF-1 and TfR1 expression by inhibiting NF-κB activity. Cell Cultures and Treatments—The J774A.1 and RAW 264.7 murine macrophage cell lines were obtained from the European Collection of Cell Cultures and cultured in endotoxin-free E-MEM or RPMI 1640 medium, respectively (Sigma), containing 10% fetal bovine serum, 2 mm glutamine, 100 units/ml penicillin, and 0.1 ng/ml streptomycin at 37 °C in 5% CO2. Proteose peptone-elicited peritoneal macrophages were harvested from 8-week-old pathogen-free female CD1 mice (Charles River Italia, Calco, Italy) housed, fed, and handled in compliance with the prescriptions for the care and use of laboratory animals. The macrophages were purified by means of adherence to plastic tissue culture clusters (Corning-Costar Italia, Milan, Italy) for 2 h at 37°C in 5% CO2 as previously described (33Taramelli D. Recalcati S. Basilico N. Olliaro P. Cairo G. Lab. Investig. 2000; 80: 1781-1788Crossref PubMed Scopus (44) Google Scholar). Near-confluent J774A.1 or RAW 264.7 cells and peritoneal macrophages were exposed to 1 μg/ml LPS and 100 units/ml IFNγ or various concentrations (5–50 μm) of the A2A adenosine receptor agonist CGS21680 (Sigma) or 100 μm adenosine (Sigma) for different times. When appropriate, the cells were treated with 10 μm Bay 11-7082 (Sigma) or 100 nm chetomin (Alexis, Italy) or 100 μm desferrioxamine (DFO, Sigma). Immunoblot Analyses—To detect TfR1 and β-actin, cytosolic extracts were prepared as described (34Cairo G. Tacchini L. Pogliaghi G. Anzon E. Tomasi A. Bernelli-Zazzera A. J. Biol. Chem. 1995; 270: 700-703Abstract Full Text Full Text PDF PubMed Scopus (294) Google Scholar). HIF-1α, NF-κB p65, and TFIID were determined in nuclear extracts prepared according to Tacchini et al. (35Tacchini L. De Ponti C. Matteucci E. Follis R. Desiderio M.A. Carcinogenesis. 2004; 25: 2089-2100Crossref PubMed Scopus (105) Google Scholar). Aliquots of cytosolic or nuclear extracts containing equal amounts of proteins (as assessed using the Bio-Rad protein assay kit) were electrophoresed and electroblotted onto Hybond ECL membranes (Amersham Biosciences). After assessing transfer by means of Ponceau S staining, the membranes were incubated with TfR1 antibody (Zymed Laboratories Inc., San Francisco, CA) diluted 1:1000, HIF-1α antibody (H1α67, Novus Biologicals, Littleton, CO) diluted 1:1000, TFIID antibody (Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:500, NF-κB p65 antibody (Santa Cruz Biotechnology) diluted 1:500, and β-actin antibody (Sigma) diluted 1:20,000. After incubation with the appropriate secondary antibody, the antigens were detected using an immunodetection kit (ECL Plus, Amersham Biosciences) and quantitated by means of densitometry with the values being calculated after normalization to the amount of TFIID or β-actin. Uptake of 55Fe-labeled Transferrin—To evaluate the incorporation of 55Fe-labeled transferrin (Tf), the cells were exposed to 1 μm 55Fe-labeled Tf during the last 2 h of the various treatments. Human apoTf (Sigma) was incubated with 55Fe-iron citrate, prepared by mixing 55FeCl3 (PerkinElmer Life Sciences) with citric acid in a 1:2 molar ratio under previously described conditions (36Alberghini A. Recalcati S. Tacchini L. Santambrogio P. Campanella A. Cairo G. J. Biol. Chem. 2005; 280: 30120-30128Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). At the end of the incubation, the medium was removed, and the cells were washed and homogenized in the lysis buffer used for the immunoblot analysis. Aliquots of the lysates were taken to measure the amount of cellular 55Fe by means of liquid scintillation counting using Ultima Gold (Packard Instrument Co.) and determine protein content. Electrophoretic Mobility Shift Assay—Aliquots of the nuclear extracts were incubated with [γ-32P]ATP (Amersham Bioscience)-labeled oligonucleotides (Primm, Milan, Italy) corresponding to the sequence from nucleotide position –93 to nucleotide position –75 relative to the transcription start site in the human TfR1 gene encompassing the binding sites for HIF-1 (5′-AGCGTACGTGCCTCAGGA-3′) and oct-1 (5′-TGCGAATGCAAATCACTAGAA-3′), electrophoresed, and autoradiographed (35Tacchini L. De Ponti C. Matteucci E. Follis R. Desiderio M.A. Carcinogenesis. 2004; 25: 2089-2100Crossref PubMed Scopus (105) Google Scholar). The specificity of the assay was demonstrated by the fact that the signals disappeared after the addition of a 50-fold excess of specific (but not nonspecific) oligonucleotides. The quantitative determinations were made by means of direct nuclear counting using an InstantImager (Packard Instrument Co.), with the values being calculated after normalization to the activity of oct-1. Plasmid Constructs—The pGL3PGK6TKp vector (a kind gift of P. J. Ratcliffe, Oxford, UK) contains a hypoxia-responsive element (HRE) multimer (37Tacchini L. Matteucci E. De Ponti C. Desiderio M.A. Exp. Cell Res. 2003; 290: 391-401Crossref PubMed Scopus (54) Google Scholar). The wild-type (–455 TfR1) construct containing the TfR1 promoter was generated from vectors kindly provided by Dr. L. Kuhn, as previously described (28Tacchini L. Bianchi L. Bernelli-Zazzera A. Cairo G. J. Biol. Chem. 1999; 274: 24142-24146Abstract Full Text Full Text PDF PubMed Scopus (297) Google Scholar). For the mutated (-455 mTfR1) plasmid, a site-directed mutation of the HRE sequence 5′-TACGTGC-3′ in the –455 TfR1, was introduced by designing one pair of complementary oligonucleotides including the desired mutation site to replace the bases TACGT with AATTC. The pNF-κB-Luc reporter vector designed for monitoring the activation of NF-κB was purchased from BD Biosciences. The expression vector pcDNA3ARNTdelta_b (ΔARNT) (obtained from M. Schwarz, Tübingen, Germany) codes for the dominant negative mutant form of the HIF-1 ARNT subunit (35Tacchini L. De Ponti C. Matteucci E. Follis R. Desiderio M.A. Carcinogenesis. 2004; 25: 2089-2100Crossref PubMed Scopus (105) Google Scholar). The RSVIkBαMMS supersuppressor of NF-κB (38Perkins N.D. Trends Biochem. Sci. 2000; 25: 434-440Abstract Full Text Full Text PDF PubMed Scopus (334) Google Scholar) (ssNF-κB) was kindly provided by N. D. Perkins. Transient Transfection Assay—Subconfluent RAW 264.7 cells maintained in complete medium were transiently transfected (using TransIT™ LT1, Mirus, Bologna, Italy) in 24-well multiwell plates with a 50:1 mixture of the various constructs and the pRL-TK reporter vector containing Renilla luciferase, which was used to normalize transfection efficiency. When appropriate, the cells were co-transfected with dominant negative expression vectors (see above). After 24 h, the cells were collected, washed, and lysed using the reporter lysis buffer (Promega, Milan, Italy), and luciferase activities were measured in a Promega luminometer using the Dual Luciferase Reporter Assay System (Promega) (37Tacchini L. Matteucci E. De Ponti C. Desiderio M.A. Exp. Cell Res. 2003; 290: 391-401Crossref PubMed Scopus (54) Google Scholar). The empty vectors showed practically undetectable luciferase activity. All of the transfection experiments were carried out on duplicate plates and were repeated at least three times (n = 6). Short Hairpin RNA Knockdown—Short hairpin RNA (shRNA) constructs against Mus musculus HIF-1α (catalog number TR517255) were purchased from Origene, Technologies, Inc. (Rockville, MD). The targeted sequences were: CTGTTCACCAAAGTTGAATCAGAGGATA (#1), CTTCTGTTATGAGGCTCACCATCAGTTA (#2), TCAAGAAACGACCACTGCTAAGGCATCA (#3), TTACCTTCATCGGAAACTCCAAAGCCACT (#4). RAW 264.7 macrophages maintained in complete medium were plated onto 6-well culture dishes (400.000 cells/well) or onto T75 flasks (2.5 × 106 cells/flask) for TfR1 and HIF-1α immunoblot analysis, respectively. After 24 h the medium was changed, and cells were transfected with a mixture of the four plasmids (250 ng each) containing the shRNA or with the empty pRS vector using the transfection method described above. 48 h later the medium was changed, and the cells were treated for 4 h with LPS/IFNγ. The cytosolic and nuclear extracts were then prepared as described above. RNA-protein Gel Retardation Assay—The cell lysates were prepared as described (34Cairo G. Tacchini L. Pogliaghi G. Anzon E. Tomasi A. Bernelli-Zazzera A. J. Biol. Chem. 1995; 270: 700-703Abstract Full Text Full Text PDF PubMed Scopus (294) Google Scholar), and equal amounts of the supernatant proteins were incubated with a probe transcribed from the pSPT-fer plasmid containing the iron-responsive elements of the human ferritin H chain (39Mullner E.W. Neupert B. Kuhn L.C. Cell. 1989; 58: 373-382Abstract Full Text PDF PubMed Scopus (404) Google Scholar) using T7 RNA polymerase in the presence of [α-32P]UTP (Amersham Biosciences) and then treated with RNase T1 and heparin (34Cairo G. Tacchini L. Pogliaghi G. Anzon E. Tomasi A. Bernelli-Zazzera A. J. Biol. Chem. 1995; 270: 700-703Abstract Full Text Full Text PDF PubMed Scopus (294) Google Scholar). After separation on non-denaturing polyacrylamide gels, the RNA-protein complexes were visualized by means of autoradiography and quantitated by means of direct nuclear counting using an InstantImager (Packard Instrument Co.). Northern Blot Analysis—Total cell RNA was isolated, and equal amounts were electrophoresed under denaturing conditions (35Tacchini L. De Ponti C. Matteucci E. Follis R. Desiderio M.A. Carcinogenesis. 2004; 25: 2089-2100Crossref PubMed Scopus (105) Google Scholar). To confirm that each lane contained equal amounts of RNA, the rRNA content in each lane was estimated in the ethidium bromide-stained gels by means of laser densitometry. The RNA was transferred to Hybond-N filters (Amersham Biosciences) and hybridized with 32P-labeled mouse TfR1 cDNA. The quantitative determinations were made by means of direct nuclear counting using an InstantImager (Packard Instrument Co.), with the values calculated after normalization to the amount of ribosomal RNA. Statistical Analysis—The data are expressed as the mean values ± S.D. and were compared using analysis of variance; p values of <0.05 were considered significant. LPS-IFNγ Up-regulates TfR1 Expression and Transferrin-bound Iron Uptake—To study the effect of inflammatory stimuli on TfR1, mouse RAW 264.7 macrophages were treated with the concentrations of LPS-IFNγ normally used to stimulate macrophages (which have been previously demonstrated to affect iron metabolism) (5Recalcati S. Taramelli D. Conte D. Cairo G. Blood. 1998; 91: 1059-1066Crossref PubMed Google Scholar, 6Kim S. Ponka P. J. Biol. Chem. 2000; 275: 6220-6226Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 21Mulero V. Brock J.H. Blood. 1999; 94: 2383-2389Crossref PubMed Google Scholar), and TfR1 expression was evaluated at protein and mRNA levels. Cell viability and proliferation rates were not affected by any of the treatments (results not shown). Immunoblot analysis showed that TfR1 protein levels increased in a time-dependent manner up to 6–8 h and then decreased to below those of untreated cells at 24 h (Fig. 1A). Northern blot analysis (Fig. 1B) showed that the increase in TfR1 protein levels observed in RAW 264.7 cells exposed to LPS-IFNγ for 4–6 h was accompanied by an increase in steady-state TfR1 mRNA levels. Similar results were found in another macrophage cell line (J774A.1) (results not shown). To determine whether the higher TfR1 expression also enhanced iron uptake, RAW 264.7 cells were exposed to 55Fe-labeled transferrin and the total cell content of radioactive iron was determined by means of liquid scintillation counting. The 55Fe content was more than three times higher in the LPS-IFNγ-treated RAW 264.7 cells, thus indicating that the higher TfR1 levels are functionally involved in favoring greater iron availability (Fig. 1C). Competition by a 100-fold excess of unlabeled transferrin effectively blocked iron incorporation. To investigate whether the TfR1 induction observed in the macrophage cell lines was also detectable in primary mononuclear cells, we analyzed extracts from mouse peritoneal macrophages treated with LPS-IFNγ for 4 h; exposure to LPS-IFNγ strongly increased TfR1 content with an effect similar to that obtained with the iron chelator DFO (Fig. 1D). Increased TfR1 Expression Is Mediated by HIF-1—Given the previous demonstration that TfR1 is an HIF-1-inducible gene (28Tacchini L. Bianchi L. Bernelli-Zazzera A. Cairo G. J. Biol. Chem. 1999; 274: 24142-24146Abstract Full Text Full Text PDF PubMed Scopus (297) Google Scholar, 29Lok C.N. Ponka P. J. Biol. Chem. 1999; 274: 24147-24152Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 30Bianchi L. Tacchini L. Cairo G. Nucleic Acids Res. 1999; 27: 4223-4227Crossref PubMed Scopus (152) Google Scholar) and that HIF-1 is also activated by typical inflammatory stimuli such as LPS (40Blouin C.C. Page E.L. Soucy G.M. Richard D.E. Blood. 2004; 103: 1124-1130Crossref PubMed Scopus (364) Google Scholar, 41Frede S. Stockmann C. Freitag P. Fandrey J. Biochem. J. 2006; 396: 517-527Crossref PubMed Scopus (330) Google Scholar), we investigated whether HIF-1 was involved in the TfR1 induction response to LPS-IFNγ. RAW 264.7 cells were exposed to LPS-IFNγ, and the DNA binding activity of HIF-1 was evaluated by electrophoretic mobility shift assay using a probe spanning the HRE present in the TfR1 promoter (28Tacchini L. Bianchi L. Bernelli-Zazzera A. Cairo G. J. Biol. Chem. 1999; 274: 24142-24146Abstract Full Text Full Text PDF PubMed Scopus (297) Google Scholar, 30Bianchi L. Tacchini L. Cairo G. Nucleic Acids Res. 1999; 27: 4223-4227Crossref PubMed Scopus (152) Google Scholar). The treatment increased HIF-1 activity in a time-dependent manner, and activation was already detectable at 1–2 h; binding peaked after 4 h and then declined (Fig. 2A). Similar binding activity was found in extracts of cells exposed to the iron chelator DFO, a well known inducer of HIF-1 (42Wang G.L. Semenza G.L. Blood. 1993; 82: 3610-3615Crossref PubMed Google Scholar). Competition experiments using both specific and unspecific unlabeled oligonucleotides demonstrated the specificity of the interaction between the DNA probe and the induced nuclear factors. The complex that migrates faster is a so-called constitutive factor that is closely related or identical to the transcription factors ATF-1 and CREB-1 and has been shown to be induced by hypoxia, iron chelation, and adenosine (32De Ponti C. Carini R. Alchera E. Nitti M.P. Locati M. Albano E. Cairo G. Tacchini L. J. Leukocyte Biol. 2007; 82: 392-402Crossref PubMed Scopus (66) Google Scholar, 43Kvietikova I. Wenger R.H. Marti H.H. Gassmann M. Nucleic Acids Res. 1995; 23: 4542-4550Crossref PubMed Scopus (192) Google Scholar, 44Agani F. Semenza G.L. Mol. Pharmacol. 1998; 54: 749-754Crossref PubMed Scopus (88) Google Scholar, 45Nemeth Z.H. Leibovich S.J. Deitch E.A. Sperlagh B. Virag L. Vizi E.S. Szabo C. Hasko G. Biochem. Biophys. Res. Commun. 2003; 312: 883-888Crossref PubMed Scopus (62) Google Scholar). Immunoblot analysis of the nuclear extracts showed that HIF-1 protein levels were also greatly increased in the cells exposed to LPS-IFNγ, with a time response reflecting that shown by DNA binding activity (Fig. 2B). Similar HIF-1 activation was found in LPS-IFNγ-treated J774A.1 macrophages (results not shown). We then used transactivation capacity experiments to verify whether the HIF-1 induced by LPS-IFNγ was transcriptionally active. In RAW 264.7 cells transiently transfected with a luciferase reporter gene controlled by a DNA fragment containing multiple consensus HREs, which has previously been shown to drive HIF-1-dependent transcription in response to hypoxia and hypoxiamimics (32De Ponti C. Carini R. Alchera E. Nitti M.P. Locati M. Albano E. Cairo G. Tacchini L. J. Leukocyte Biol. 2007; 82: 392-402Crossref PubMed Scopus (66) Google Scholar, 37Tacchini L. Matteucci E. De Ponti C. Desiderio M.A. Exp. Cell Res. 2003; 290: 391-401Crossref PubMed Scopus (54) Google Scholar), the expression of the reporter gene increased more than 3-fold in response to LPS-IFNγ (Fig. 2C). Further indications of the involvement of HIF-1 in the LPS-IFNγ-dependent activation of luciferase activity were obtained by means of experiments in which the transactivating capacity of HIF-1 was almost completely abolished by the co-transfection of a plasmid expressing a dominant negative of the β subunit of the HIF-1 heterodimer (ΔARNT), which retains the capacity to form a heterodimer but cannot bind DNA (35Tacchini L. De Ponti C. Matteucci E. Follis R. Desiderio M.A. Carcinogenesis. 2004; 25: 2089-2100Crossref PubMed Scopus (105) Google Scholar) (Fig. 2C). Having demonstrated that HIF-1 activity is induced by LPS-IFNγ in RAW 264.7 cells, we investigated the role of HIF-1-mediated transcriptional regulation in the induction of TfR1 expression. To this end, RAW 264.7 cells were transfected with a luciferase reporter gene under the control of a 455-bp fragment of the human TfR1 promoter (wild type or mutated in the HRE) (Fig. 3A); it has been previously demonstrated that this fragment is sufficient for the efficient transcriptional induction of a reporter gene in response to hypoxia and that the mutation is effective i
Referência(s)