Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Pathogenic Neisseria Trigger Expression of Their Carcinoembryonic Antigen-related Cellular Adhesion Molecule 1 (CEACAM1; Previously CD66a) Receptor on Primary Endothelial Cells by Activating the Immediate Early Response Transcription Factor, Nuclear Factor-κB

2001; Elsevier BV; Volume: 276; Issue: 26 Linguagem: Inglês

10.1074/jbc.m006883200

ISSN

1083-351X

Autores

Petra Muenzner, Michael Naumann, Thomas F. Meyer, Scott D. Gray‐Owen,

Tópico(s)

Neuropeptides and Animal Physiology

Resumo

Neisseria gonorrhoeae express opacity-associated (Opa) protein adhesins that mediate binding to various members of the carcinoembryonic antigen-related cellular adhesion molecule (CEACAM; previously CD66) receptor family. Although human umbilical vein endothelial cells express little CEACAM receptor in vitro, we found neisserial infection to induce expression of CEACAM1, CEACAM1-3L, and CECAM1-4L splice variants. This mediates an increased Opa52-dependent binding of gonococci by these cells. The induced receptor expression did not require bacterial Opa expression, but it was more rapid with adherent bacteria. Because the time course of induction was similar to that seen for induced proinflammatory cytokines, we tested whether CEACAM1 expression could be controlled by a similar mechanism. Gonococcal infection activated a nuclear factor-κB (NF-κB) heterodimer consisting of p50 and p65, and inhibitors that prevent the nuclear translocation of activated NF-κB complex inhibited CEACAM1 transcript expression. Each of these effects could be mimicked by using culture filtrates or purified lipopolysaccharide instead of intact bacteria. Together, our results support a model whereby the outer membrane "blebs" that are actively released by gonococci trigger a Toll-like receptor-4-dependent activation of NF-κB, which up-regulates the expression of CEACAM1 to allow Opa52-mediated neisserial binding. The regulation of CEACAM1 expression by NF-κB also implies a broader role for this receptor in the general inflammatory response to infection. Neisseria gonorrhoeae express opacity-associated (Opa) protein adhesins that mediate binding to various members of the carcinoembryonic antigen-related cellular adhesion molecule (CEACAM; previously CD66) receptor family. Although human umbilical vein endothelial cells express little CEACAM receptor in vitro, we found neisserial infection to induce expression of CEACAM1, CEACAM1-3L, and CECAM1-4L splice variants. This mediates an increased Opa52-dependent binding of gonococci by these cells. The induced receptor expression did not require bacterial Opa expression, but it was more rapid with adherent bacteria. Because the time course of induction was similar to that seen for induced proinflammatory cytokines, we tested whether CEACAM1 expression could be controlled by a similar mechanism. Gonococcal infection activated a nuclear factor-κB (NF-κB) heterodimer consisting of p50 and p65, and inhibitors that prevent the nuclear translocation of activated NF-κB complex inhibited CEACAM1 transcript expression. Each of these effects could be mimicked by using culture filtrates or purified lipopolysaccharide instead of intact bacteria. Together, our results support a model whereby the outer membrane "blebs" that are actively released by gonococci trigger a Toll-like receptor-4-dependent activation of NF-κB, which up-regulates the expression of CEACAM1 to allow Opa52-mediated neisserial binding. The regulation of CEACAM1 expression by NF-κB also implies a broader role for this receptor in the general inflammatory response to infection. opacity-associated heparan sulfate proteoglycan carcinoembryonic antigen-related cellular adhesion molecule human umbilical vein endothelial cells tumor necrosis factor α nuclear factor κB human dermal microvascular endothelial cells lipopolysaccharide inhibitory protein κBα tosylphenylalanyl chloromethyl ketone proteasome inhibitor reverse transcription-polymerase chain reaction base pairs Toll-like receptor glyceraldehyde-3-phosphate dehydrogenase interleukin The important human pathogens Neisseria gonorrhoeae and Neisseria meningitidis possess the ability to colonize human mucosal tissue and then penetrate into deeper tissues to cause invasive disease. Initial contact with host tissues is thought to be mediated by neisserial type IV pili, and a tight secondary interaction can then be established by the bacteria's phase-variable, colony opacity-associated (Opa)1 outer membrane proteins. There are two distinct classes of Opa proteins based on their differential binding specificity for cellular receptors. One class targets the Neisseriae to cell surface heparan sulfate proteoglycan (HSPG) receptors (1Chen T. Belland R.J. Wilson J. Swanson J. J. Exp. Med. 1995; 182: 511-517Crossref PubMed Scopus (156) Google Scholar, 2van Putten J.P. Paul S.M. EMBO J. 1995; 14: 2144-2154Crossref PubMed Scopus (214) Google Scholar) and, via binding to the extracellular matrix proteins vitronectin and fibronectin, to cell surface integrins (3Dehio M. Gomez-Duarte O.G. Dehio C. Meyer T.F. FEBS Lett. 1998; 424: 84-88Crossref PubMed Scopus (73) Google Scholar, 4Duensing T.D. van Putten J.P. Infect. Immun. 1997; 65: 964-970Crossref PubMed Google Scholar). Other Opa proteins bind to the CD66 epitope-containing members of thecarcinoembryonic antigen-relatedcellular adhesion molecules (CEACAM), which are expressed differentially on multiple tissues throughout the human host (5Prall F. Nollau P. Neumaier M. Haubeck H.D. Drzeniek Z. Helmchen U. Loning T. Wagener C. J. Histochem. Cytochem. 1996; 44: 35-41Crossref PubMed Scopus (168) Google Scholar, 6Thompson J.A. Grunert F. Zimmermann W. J. Clin. Lab. Anal. 1991; 5: 344-366Crossref PubMed Scopus (579) Google Scholar). Some Opa proteins interact with both HSPG and CEACAM receptors (7Chen T. Grunert F. Medina-Marino A. Gotschlich E.C. J. Exp. Med. 1997; 185: 1557-1564Crossref PubMed Scopus (172) Google Scholar, 8Virji M. Evans D. Hadfield A. Grunert F. Teixeira A.M. Watt S.M. Mol. Microbiol. 1999; 34: 538-551Crossref PubMed Scopus (144) Google Scholar), presumably via distinct binding sites; however, each variant appears to be able to mediate host cellular invasion only via either one or the other receptor class (9Kupsch E.M. Knepper B. Kuroki T. Heuer I. Meyer T.F. EMBO J. 1993; 12: 641-650Crossref PubMed Scopus (201) Google Scholar). CEACAM1 (previously called BGP or CD66a; new nomenclature for this and other CEA family members was introduced by Beauchemin et al.(42Beauchemin N. Drabert P. Dveksler G. Gold P. Gray-Owen S.D. Grunert F. Hammarstrom S. Holmes K.V. Karlsson A. Kuroki M. Lin S.-H. Lucka L. Naijar M. Neumaier M. Obrink B. Shively J.E. Skubitz K.M. Stanners C.P. Thomas P. Thompson J.A. Virji M. von Kleist S. Wagener C. Watt S. Zimmermann W. Exp. Cell Res. 1999; 252: 243-249Crossref PubMed Scopus (321) Google Scholar)), CEACAM3 (CGM1 or CD66d), CEACAM5 (CEA or CD66e), and CEACAM6 (NCA or CD66c) can all serve as receptors for the pathogenicNeisseria spp.; however, individual Opa variants are specific for various combinations of these closely related proteins (7Chen T. Grunert F. Medina-Marino A. Gotschlich E.C. J. Exp. Med. 1997; 185: 1557-1564Crossref PubMed Scopus (172) Google Scholar, 8Virji M. Evans D. Hadfield A. Grunert F. Teixeira A.M. Watt S.M. Mol. Microbiol. 1999; 34: 538-551Crossref PubMed Scopus (144) Google Scholar, 10Virji M. Makepeace K. Ferguson D.J. Watt S.M. Mol. Microbiol. 1996; 22: 941-950Crossref PubMed Scopus (247) Google Scholar). The closely related receptors CEACAM4, CEACAM7, and CEACAM8 are not bound by any Opa variants tested to date (16Popp A. Dehio C. Grunert F. Meyer T.F. Gray-Owen S.D. Cell. Microbiol. 1999; 1: 169-181Crossref PubMed Scopus (50) Google Scholar). Each CEACAM receptor consists of an immunoglobulin variable domain-like region followed by up to six immunoglobulin constant domain-like structures (6Thompson J.A. Grunert F. Zimmermann W. J. Clin. Lab. Anal. 1991; 5: 344-366Crossref PubMed Scopus (579) Google Scholar). CEACAM1 and CEACAM3 are inserted into the cellular membrane via a carboxyl-terminal transmembrane and cytoplasmic domain, whereas CEACAM5, CEACAM6, CEACAM7, and CEACAM8 possess glycosylphosphatidylinositol anchors. Even though each receptor is highly glycosylated, binding is a protein-protein interaction with Opa proteins recognizing CEACAM residues exposed on the GFCC′ face of the amino-terminal domain (17Billker O. Popp A. Gray-Owen S.D. Meyer T.F. Trends Microbiol. 2000; 8: 258-261Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). These different binding specificities may have important implications for the pathogenic process ofNeisseria because the distribution pattern of each CEACAM receptor should influence the cellular tropism of neisserial strains expressing different Opa variants in vivo. In addition, very different cellular processes have been linked to individual CEA family members (6Thompson J.A. Grunert F. Zimmermann W. J. Clin. Lab. Anal. 1991; 5: 344-366Crossref PubMed Scopus (579) Google Scholar, 18Kuijpers T.W. Hoogerwerf M. van der Laan L.J. Nagel G. van der Schoot L.E. Grunert F. Roos D. J. Cell Biol. 1992; 118: 457-466Crossref PubMed Scopus (151) Google Scholar), suggesting that the cellular response to neisserial binding depends upon the specific combination of CEACAM receptors engaged. Even though CEACAM receptors are part of the immunoglobulin superfamily, their functions are poorly understood. They mediate intercellular adhesion via both homotypic (CEACAM1, CEACAM5, and CEACAM6) and/or heterotypic (CEACAM5-CEACAM6 and CEACAM6-CEACAM8) interactions (22Benchimol S. Fuks A. Jothy S. Beauchemin N. Shirota K. Stanners C.P. Cell. 1989; 57: 327-334Abstract Full Text PDF PubMed Scopus (827) Google Scholar, 23Oikawa S. Inuzuka C. Kuroki M. Arakawa F. Matsuoka Y. Kosaki G. Nakazato H. J. Biol. Chem. 1991; 266: 7995-8001Abstract Full Text PDF PubMed Google Scholar). CEACAM1 and CEACAM6 are also involved in the adherence of activated neutrophils to cytokine-activated endothelial cells, both directly through their ability to present the sialylated Lewisx antigen to E-selectin and indirectly by the CEACAM6-stimulated activation of CD18 integrins (18Kuijpers T.W. Hoogerwerf M. van der Laan L.J. Nagel G. van der Schoot L.E. Grunert F. Roos D. J. Cell Biol. 1992; 118: 457-466Crossref PubMed Scopus (151) Google Scholar). The role of CEACAM receptors is not, however, restricted to simple anchorage to adjacent cells because various receptors can influence cell cycle control and cellular differentiation. For example, CEACAM1 expression inhibits the proliferation of mouse colonic carcinoma cells bothin vitro and in vivo, and this effect was abrogated by deleting the receptor's cytoplasmic domain (24Kunath T. Ordonez-Garcia C. Turbide C. Beauchemin N. Oncogene. 1995; 11: 2375-2382PubMed Google Scholar, 25Hsieh J.T. Luo W. Song W. Wang Y. Kleinerman D.I. Van N.T. Lin S.H. Cancer Res. 1995; 55: 190-197PubMed Google Scholar). Such a growth-inhibitory role is consistent with clinical observations that CEACAM1 expression is down-regulated in various colonic carcinomas (26Neumaier M. Paululat S. Chan A. Matthaes P. Wagener C. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10744-10748Crossref PubMed Scopus (229) Google Scholar, 27Kleinerman D.I. Troncoso P. Lin S.H. Pisters L.L. Sherwood E.R. Brooks T. von Eschenback A.C. Hsieh J.T. Cancer Res. 1995; 55: 1215-1220PubMed Google Scholar). Together, these features imply a role for members of the CEACAM receptor family as sensory and regulatory molecules in cell-cell adhesion events (28Obrink B. Curr. Opin. Cell Biol. 1997; 9: 616-626Crossref PubMed Scopus (232) Google Scholar). CEACAM1, CEACAM3, and CEACAM6 are expressed by human polymorphonuclear neutrophils and can mediate gonococcal binding and opsonin-independent phagocytosis by these phagocytes (10Virji M. Makepeace K. Ferguson D.J. Watt S.M. Mol. Microbiol. 1996; 22: 941-950Crossref PubMed Scopus (247) Google Scholar, 11Chen T. Gotschlich E.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14851-14856Crossref PubMed Scopus (151) Google Scholar, 14Gray-Owen S.D. Dehio C. Haude A. Grunert F. Meyer T.F. EMBO J. 1997; 16: 3435-3445Crossref PubMed Scopus (189) Google Scholar, 29Hauck C.R. Lorenzen D. Saas J. Meyer T.F. Infect. Immun. 1997; 65: 1863-1869Crossref PubMed Google Scholar). This interaction appears to play a central role in the pathogenic process because a urethral exudate consisting primarily of polymorphonuclear neutrophils associated with both extracellular and intracellular attached gonococci is the hallmark of gonorrhea. CEACAM receptors expressed by other cells also appear to play an important role during other stages of neisserial infection. Polarized T84 epithelial cells express CEACAM1, CEACAM5, and CEACAM6 on their apical surface, and Opa binding to these receptors mediates bacterial uptake, cellular transcytosis, and release at the basolateral surface (30Wang J. Gray-Owen S.D. Knorre A. Meyer T.F. Dehio C. Mol. Microbiol. 1998; 30: 657-671Crossref PubMed Scopus (95) Google Scholar). This is consistent with previous findings that N. gonorrhoeae and N. meningitidis appear in the subepithelial layers following the in vitro infection of organ cultures (31McGee Z.A. Stephens D.S. Hoffman L.H. Schlech W.F. Horn R.G. Rev. Infect. Dis. 1983; 5: S708-S714Crossref PubMed Google Scholar). Because both of these pathogens can also cause invasive disease, interactions with the endothelia must also occur. Primary human umbilical vein endothelial cells (HUVECs) grown in culture express little CEACAM receptor. There is, however, a substantial up-regulation of CEACAM1 expression after treatment with the proinflammatory cytokine tumor necrosis factor α (TNF-α) (13Gray-Owen S.D. Lorenzen D.R. Haude A. Meyer T.F. Dehio C. Mol. Microbiol. 1997; 26: 971-980Crossref PubMed Scopus (128) Google Scholar, 15Muenzner P. Dehio C. Fujiwara T. Achtman M. Meyer T.F. Gray-Owen S.D. Infect. Immun. 2000; 68: 3601-3607Crossref PubMed Scopus (86) Google Scholar, 32Majuri M.L. Hakkarainen M. Paavonen T. Renkonen R. APMIS. 1994; 102: 432-438Crossref PubMed Scopus (24) Google Scholar), which is present in serum at high levels during invasive meningococcal disease (33Waage A. Halstensen A. Espevik T. Lancet. 1987; 1: 355-357Abstract PubMed Scopus (859) Google Scholar). This increased up-regulation of CEACAM1 correlates with an increased adherence and invasion of different Opa-expressing bacteria into these cells in vitro (13Gray-Owen S.D. Lorenzen D.R. Haude A. Meyer T.F. Dehio C. Mol. Microbiol. 1997; 26: 971-980Crossref PubMed Scopus (128) Google Scholar, 15Muenzner P. Dehio C. Fujiwara T. Achtman M. Meyer T.F. Gray-Owen S.D. Infect. Immun. 2000; 68: 3601-3607Crossref PubMed Scopus (86) Google Scholar). In the present study, we observed that prolonged infection of HUVECs resulted in an increased binding of gonococci expressing the CEACAM receptor-specific Opa52 adhesin. We have shown previously that N. gonorrhoeae infection induces TNF-α expression by epithelial cells (36Naumann M. Wessler S. Bartsch C. Wieland B. Meyer T.F. J. Exp. Med. 1997; 186: 247-258Crossref PubMed Scopus (123) Google Scholar). If a similar response occurs during neisserial infection of endothelial cells, then these bacteria could presumably induce an autocrine loop that results in the expression of CEACAM1. We thus determined the kinetics of CEACAM1 expression pattern after neisserial infection and related these to the induced cytokine profile. We demonstrate that the CEACAM1-4L andCECAM1-3L splice variants are both induced with a time course similar to that of proinflammatory cytokines, including TNF-α. Our results indicate that the activation of nuclear factor kappa B (NF-κB) directly triggers CEACAM1 expression and mediates increased Opa-dependent bacterial binding to HUVECs. This phenomenon could clearly contribute to neisserial attachment to and penetration into the vasculature during invasive disease. It also has broad implications for our understanding of the natural role of CEACAM1 because its regulation by the immune regulator factor NF-κB implies a role in the innate response of endothelial cells to infection. This represents the first example that we are aware of in which a human pathogen directly induces the expression of its receptor by a target host cell. HUVECs were obtained from human umbilical vein by chymotrypsin digestion as described previously (37Dehio C. Meyer M. Berger J. Schwarz H. Lanz C. J. Cell Sci. 1997; 110: 2141-2154Crossref PubMed Google Scholar) and then grown in low serum endothelial cell growth medium (PromoCell, Heidelberg, Germany) using flasks precoated with 0.2% gelatin in a humidified atmosphere at 37 °C with 5% CO2. HUVECs at passage 4 were grown to form a confluent monolayer and then seeded to new precoated flasks or into wells containing gelatin-coated glass coverslips to obtain a confluence of about 60%. Human dermal microvascular endothelial cells (HDMECs) were cultured in MCDB-131 medium (Life Technologies, Inc.) with 10% heat-inactivated fetal calf serum and used between passages 4 and 5. Construction of the recombinant strains invariantly synthesizing the 11 genetically defined Opa proteins ofN. gonorrhoeae MS11 were described previously by Kupschet al. (9Kupsch E.M. Knepper B. Kuroki T. Heuer I. Meyer T.F. EMBO J. 1993; 12: 641-650Crossref PubMed Scopus (201) Google Scholar). The cloned opa genes were expressed in the genetic background of the MS11 derivative N279, which lacks pili and carries a deletion in the epithelial cell invasion-associated opaC30 locus. Daily subculture of all strains was carried out using a binocular microscope to select for desired Opa phenotypes. Opa protein expression patterns were confirmed by SDS-polyacrylamide gel electrophoresis and immunoblot analysis of total bacterial extracts using the monoclonal antibody 4B12C11 (38Achtman M. Neibert M. Crowe B.A. Strittmatter W. Kusecek B. Weyse E. Walsh M.J. Slawig B. Morelli G. Moll A. J. Exp. Med. 1988; 168: 507-525Crossref PubMed Scopus (126) Google Scholar), which was generously provided by Dr. Mark Achtman (Berlin, Germany). Recombinant Escherichia coli strains expressing N. meningitidis Opa variants were also described previously (15Muenzner P. Dehio C. Fujiwara T. Achtman M. Meyer T.F. Gray-Owen S.D. Infect. Immun. 2000; 68: 3601-3607Crossref PubMed Scopus (86) Google Scholar). For infection experiments, HUVECs were seeded into 75-cm2flasks to obtain cultures at about 70% confluence at the time of infection. One night before infection, the medium was changed to M199 (Life Technologies, Inc.) supplemented with 10% fetal calf serum. Gonococci were harvested from fresh overnight cultures into M199 medium containing 10% heat-inactivated fetal calf serum to obtain a culture density of 108 colony-forming units/ml and then used to infect HUVECs at a multiplicity of infection of 10–20 bacteria/cell for the indicated time points. For immunofluorescence analysis, HUVECs were infected as outlined above except that cells were initially seeded onto gelatin-coated 12-mm glass coverslips, and the samples were fixed after the final washing step postinfection by incubating in 3.7% paraformaldehyde in 200 mm HEPES buffer, pH 7.4, for 30 min at room temperature. To determine the levels of gonococcal adherence and invasion, the gonococci were stained for immunofluorescence and then analyzed by confocal laser scanning microscopy as described previously (15Muenzner P. Dehio C. Fujiwara T. Achtman M. Meyer T.F. Gray-Owen S.D. Infect. Immun. 2000; 68: 3601-3607Crossref PubMed Scopus (86) Google Scholar, 30Wang J. Gray-Owen S.D. Knorre A. Meyer T.F. Dehio C. Mol. Microbiol. 1998; 30: 657-671Crossref PubMed Scopus (95) Google Scholar). Where indicated, various other stimuli were added directly to the culture medium. TNF-α was purchased from R&D Systems. Where indicated, purified mouse anti-human TNF-α monoclonal antibodies (BD PharMingen, San Diego) were added at 15 μg/ml just prior to infection. The polyclonal anti-human CEACAM antiserum was puchased from DAKO (Glostrup, Denmark). Experiments involving LPS were done using LPS prepared from E. coli serotype O111:B4 and/orSalmonella typhimurium by phenol extraction (Sigma). LPS suspensions were sonicated in endotoxin-free water (Life Technologies, Inc.) to disperse any aggregates formed and were then diluted to the indicated final concentration in supplemented medium. Neisserial LPS was purified according to the method of Galanos et al.(62Galanos C. Lüderitz O. Westphal O. Eur. J. Biochem. 1969; 9: 245-249Crossref PubMed Scopus (1350) Google Scholar) and was generously provided by Dr. Anne Muller from our group (Berlin). CEACAM1 protein expression in response to exposure to bacterial strains, TNF-α, or other stimuli was determined by immunoblot analysis of total cellular protein essentially as described before (15Muenzner P. Dehio C. Fujiwara T. Achtman M. Meyer T.F. Gray-Owen S.D. Infect. Immun. 2000; 68: 3601-3607Crossref PubMed Scopus (86) Google Scholar). Protein concentration in each sample was determined by colorimetric Bradford protein assay (Bio-Rad), and equal amounts of protein were separated by SDS-polyacrylamide gel electrophoresis (10–11%) and blotted onto Immobilon P transfer membranes (Millipore). Western blot analysis was performed using the CEACAM1, CEACAM3, CEACAM5, and CEACAM6 cross-specific monoclonal antibody D14HD11, the CEACAM6-specific antibody 9A6 (Immunotech, Marseille, France), and the CEACAM1 and CEACAM5 cross-specific antibody 4/3/17. D14HD11 and 4/3/17 were both generously provided by Dr. Fritz Grunert, University of Freiburg, Germany. Bound antibodies were detected using a peroxidase-conjugated goat anti-mouse secondary antibody and the ECL chemiluminescent detection system (Amersham Pharmacia Biotech). To test for IκBα degradation, cytosolic fractions obtained from HUVECs exposed to various stimuli were analyzed by immunoblot analysis using an IκBα-specific polyclonal antibody that does not cross-reactive with other IκB family members (C-21; Santa Cruz Biotechnology). NF-κB SN50 (BIOMOL Research laboratories, Inc.) is a cell-permeable peptide that inhibits the translocation of active NF-κB complex into the nucleus. Cells were pretreated with 50 μg/ml of this peptide for 15 min at 37 °C before TNF-α or the bacteria were added. To confirm the role of NF-κB in CEACAM1 expression, two other inhibitors with different mechanisms of action were also used. The cells were pretreated either with the serine protease inhibitor tosylphenylalanyl chloromethyl ketone (TPCK; Sigma) or a proteasome inhibitor (PSI) obtained from Calbiochem-Novabiochem Ltd. (U. K.) for 30 min before addition of the stimuli. To inhibit phosphorylation-dependent steps involved in the activation of NF-κB, HUVECs seeded in 75-cm2 flasks were either not pretreated or were pretreated with 1 μmherbimycin A for 24 h or 100 mm genistein for 1 h and then either infected with N309 or stimulated with TNF-α. The effects of these inhibitors on CEACAM1 expression levels were then determined as indicated. Total RNA was isolated from HUVECs that had been treated with various stimuli, as indicated, using either Trizol reagent (Life Technologies, Inc.) or the Qiagen RNEasy Kit, as outlined by the manufacturers, and then treated further with RNase-free DNase-I. Equal amounts of RNA were reverse transcribed into single-stranded cDNA using Superscript IIRT (Life Technologies, Inc.) and oligo(dT) primers. As a control, the synthesis of cDNA was performed in the absence of reverse transcriptase. Subsequent amplification of CEACAM1 was carried out using CEACAM1-specific primers for 30 cycles at 56 °C annealing temperature. The differential amplification of CEACAM1 splice variants was performed using Taq polymerase (Life Technologies, Inc.) for 33 cycles with an annealing temperature of 56 °C. The primers used were 5′-primer B1 (ACAGTCAAGACGATCATAGT) and 3′-primer C2 (ATCTTGTTAGGTGGGTCATT), resulting in amplified fragments of between 189 and 530 bp (39Kammerer R. Hahn S. Singer B.B. Luo J.S. von Kleist S. Eur. J. Immunol. 1998; 28: 3664-3674Crossref PubMed Scopus (117) Google Scholar). Amplification of cytokine DNA was done using the primers that we have described previously (36Naumann M. Wessler S. Bartsch C. Wieland B. Meyer T.F. J. Exp. Med. 1997; 186: 247-258Crossref PubMed Scopus (123) Google Scholar). To detect Toll-like receptor (TLR) expression, PCR amplification of the cDNA template was performed using Taq polymerase for 28 cycles at 95 °C for 40 s, 54 °C for 40 s, and 72 °C for 1 min. PCR primers used for TLR-2 were GCCAAAGTCTCTTGATTGATTCC and TTGAAGTTCTCCAGCTCCTG, and those used for TLR-4 were TGGATACGTTTCCTTATAAG and GAAATGGAGGCACCCCTTC (40Zhang F.X. Kirschning C.J. Mancinelli R. Xu X.P. Jin Y. Faure E. Mantovani A. Rothe M. Muzio M. Arditi M. J. Biol. Chem. 1999; 274: 7611-7614Abstract Full Text Full Text PDF PubMed Scopus (535) Google Scholar). Depending on which primer sets were used for the primary amplification, primers specific for the constitutively expressed housekeeping gene GAPDH or β-actin was also included within the reaction mixture to provide an internal control that allowed samples to be loaded equally. In each case, PCR products were visualized by ethidium bromide staining after agarose gel electrophoresis. At the indicated time points after infection, cytoplasmic and nuclear extracts were prepared by using the non-ionic detergent method described previously (36Naumann M. Wessler S. Bartsch C. Wieland B. Meyer T.F. J. Exp. Med. 1997; 186: 247-258Crossref PubMed Scopus (123) Google Scholar). Gel retardation assays for the detection of active NF-κB complex were performed using an Igκ oligonucleotide that had been labeled using the large fragment DNA polymerase (Klenow) in the presence of deoxy-[α-32P]ATP. The DNA binding reactions were performed in 20 μl of binding buffer for 20 min at 30 °C. Competition experiments and supershift assays were performed with antibodies as described previously (36Naumann M. Wessler S. Bartsch C. Wieland B. Meyer T.F. J. Exp. Med. 1997; 186: 247-258Crossref PubMed Scopus (123) Google Scholar). The reaction products were analyzed by electrophoresis in a 5% polyacrylamide gel using 12.5 mm Tris, 12.5 mm boric acid, and 0.25 mm EDTA, pH 8.3, and the gels were then dried and exposed to Amersham TM films (Amersham Pharmacia Biotech) at −70 °C using an intensifying screen. Previously, we had found very little CEACAM1 receptor expression by HUVECs unless they were prestimulated with the proinflammatory cytokine TNF-α. Other members of the CEA receptor family were not found in either unstimulated or stimulated HUVECs. Consistent with this, N. gonorrhoeae or recombinant E. coli expressing either gonococcal or meningococcal CEACAM-specific Opa proteins showed only low levels of binding to HUVECs using standard (i.e. 3 h) in vitro infection assays unless the HUVECs were pretreated with TNF-α (13Gray-Owen S.D. Lorenzen D.R. Haude A. Meyer T.F. Dehio C. Mol. Microbiol. 1997; 26: 971-980Crossref PubMed Scopus (128) Google Scholar, 15Muenzner P. Dehio C. Fujiwara T. Achtman M. Meyer T.F. Gray-Owen S.D. Infect. Immun. 2000; 68: 3601-3607Crossref PubMed Scopus (86) Google Scholar). However, we found that extended infection resulted in consistently increasing levels of Opa-mediated bacterial binding to otherwise unstimulated HUVECs, and this correlated with an increased level of bacterial internalization (Fig. 1 A). To demonstrate that the increased binding was caused by interactions with CEACAM receptor(s), HUVECs were pretreated with polyclonal anti-CEACAM antibody prior to infection. This treatment blocked interaction with the HUVECs almost completely, and the increased bacteria binding with time was no longer evident (Fig. 1 B). To determine whether these increased interactions could result from increased CEACAM receptor expression, we performed immunoblot analysis of cellular lysates prepared at various intervals after infection. The HUVECs were either left untreated, infected with various gonococcal strains, or stimulated with TNF-α as a positive control. Expression of the CEACAM1 protein was found to be induced during neisserial infection, and the time course of this induction was similar to that seen when stimulating the cells with purified TNF-α (Fig.2 A). No other CEACAM family member(s) were detected in either stimulated or unstimulated cells. The rapid induction of CEACAM1 expression after infection was also confirmed by FACS analysis (data not shown) and by semiquantitative RT-PCR to detect CEACAM1-encoding transcript (Fig. 2 B). Importantly, N. gonorrhoeae strains expressing either the HSPG receptor-specific Opa50 or the CEACAM receptor-specific Opa52, and the nonadherent Opa− strain N302 induced CEACAM1 expression (Fig. 2,A and B). This implies that this effect was not likely the result of a specific signal directly downstream of Opa binding to one of its cellular receptors. We generally observed increased levels of three defined protein bands by immunoblot analysis using the CEACAM receptor-specific monoclonal antibody D14HD11 (Fig.2 A) and have confirmed that all three bands represent the CEACAM1 receptor by comparing blots probed with various CEACAM-specific antibodies (data not shown). This banding pattern likely results from a combination of the variable glycosylation of CEACAM1 and/or the expression of multiple splice variants because the relative levels of each of these can vary among cells and cell lines (41Hefta S.A. Paxton R.J. Shively J.E. J. Biol. Chem. 1990; 265: 8618-8626Abstract Full Text PDF PubMed Google Scholar). 13 different CEACAM1 splice variants are known to exist. To analyze which splice variant(s) are induced in endothelial cells, we performed RT-PCR experiments with RNA from unstimulated, TNF-α-treated, and gonococcal-infected HUVECs. The primer pair used amplifies the mRNA fragment that spans from the middle of the Ig constant domain-like B1 region to the carboxyl-terminal end of the cytoplasmic domain. Using these primers, it is possible to discriminate among known splice variants according to the size of the RT-PCR products (39Kammerer R. Hahn S. Singer B.B. Luo J.S. von Kleist S. Eur. J. Immunol. 1998; 28: 3664-3674Crossref PubMed Sco

Referência(s)