DLX5 and DLX6 Expression Is Biallelic and Not Modulated by MeCP2 Deficiency
2007; Elsevier BV; Volume: 81; Issue: 3 Linguagem: Inglês
10.1086/520063
ISSN1537-6605
AutoresBirgitt Schüle, Hong Hua Li, Claudia Fisch-Kohl, Carolin Purmann, Uta Francke,
Tópico(s)Genetic Syndromes and Imprinting
ResumoMutations in MECP2 and Mecp2 (encoding methyl-CpG binding protein 2 [MeCP2]) cause distinct neurological phenotypes in humans and mice, respectively, but the molecular pathology is unclear. Recent literature claimed that the developmental homeobox gene DLX5 is imprinted and that its imprinting status is modulated by MeCP2, leading to biallelic expression in Rett syndrome and twofold overexpression of Dlx5 and Dlx6 in Mecp2-null mice. The conclusion that DLX5 is a direct target of MeCP2 has implications for research on the molecular bases of Rett syndrome, autism, and genomic imprinting. Attempting to replicate the reported data, we evaluated allele-specific expression of DLX5 and DLX6 in mouse × human somatic cell hybrids, lymphoblastoid cell lines, and frontal cortex from controls and individuals with MECP2 mutations. We identified novel single-nucleotide polymorphisms in DLX5 and DLX6, enabling the first imprinting studies of DLX6. We found that DLX5 and DLX6 are biallelically expressed in somatic cell hybrids and in human cell lines and brain, with no differences between affected and control samples. We also determined expression levels of Dlx5 and Dlx6 in forebrain from seven male Mecp2-mutant mice and eight wild-type littermates by real-time quantitative reverse-transcriptase polymerase chain reaction assays. Expression of Dlx5 and Dlx6, as well as of the imprinted gene Peg3, in mouse forebrain was highly variable, with no consistent differences between Mecp2-null mutants and controls. We conclude that DLX5 and DLX6 are not imprinted in humans and are not likely to be direct targets of MeCP2 modulation. In contrast, the imprinting status of PEG3 and PEG10 is maintained in MeCP2-deficient tissues. Our results confirm that MeCP2 plays no role in the maintenance of genomic imprinting and add PEG3 and PEG10 to the list of studied imprinted genes. Mutations in MECP2 and Mecp2 (encoding methyl-CpG binding protein 2 [MeCP2]) cause distinct neurological phenotypes in humans and mice, respectively, but the molecular pathology is unclear. Recent literature claimed that the developmental homeobox gene DLX5 is imprinted and that its imprinting status is modulated by MeCP2, leading to biallelic expression in Rett syndrome and twofold overexpression of Dlx5 and Dlx6 in Mecp2-null mice. The conclusion that DLX5 is a direct target of MeCP2 has implications for research on the molecular bases of Rett syndrome, autism, and genomic imprinting. Attempting to replicate the reported data, we evaluated allele-specific expression of DLX5 and DLX6 in mouse × human somatic cell hybrids, lymphoblastoid cell lines, and frontal cortex from controls and individuals with MECP2 mutations. We identified novel single-nucleotide polymorphisms in DLX5 and DLX6, enabling the first imprinting studies of DLX6. We found that DLX5 and DLX6 are biallelically expressed in somatic cell hybrids and in human cell lines and brain, with no differences between affected and control samples. We also determined expression levels of Dlx5 and Dlx6 in forebrain from seven male Mecp2-mutant mice and eight wild-type littermates by real-time quantitative reverse-transcriptase polymerase chain reaction assays. Expression of Dlx5 and Dlx6, as well as of the imprinted gene Peg3, in mouse forebrain was highly variable, with no consistent differences between Mecp2-null mutants and controls. We conclude that DLX5 and DLX6 are not imprinted in humans and are not likely to be direct targets of MeCP2 modulation. In contrast, the imprinting status of PEG3 and PEG10 is maintained in MeCP2-deficient tissues. Our results confirm that MeCP2 plays no role in the maintenance of genomic imprinting and add PEG3 and PEG10 to the list of studied imprinted genes. Rett syndrome (RTT [MIM #312750]) is a neurodevelopmental disorder that affects females almost exclusively. An apparently normal early-postnatal period is followed by developmental stagnation and then regression, with loss of motor skills and speech, autonomic dysfunction, and seizures.1Rett A Uber ein eigenartiges hirnatrophisches Syndrom bei Hyperammonamie im Kindesalter.Wien Med Wochenschr. 1966; 116: 723-738PubMed Google Scholar De novo recurrent loss-of-function mutations of the X-linked gene MECP2 (MIM +300005) are found in almost all girls who receive a clinical diagnosis of RTT2Amir RE Van den Veyver IB Wan M Tran CQ Francke U Zoghbi HY Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.Nat Genet. 1999; 23: 185-188Crossref PubMed Scopus (3512) Google Scholar (for review, see the work of Francke3Francke U Neurogenetics of MeCP2 deficiency.Nat Clin Pract Neurol. 2006; 2: 212-221Crossref PubMed Scopus (44) Google Scholar). The incidence is estimated to be 1 in 10,000 female births, and the availability of molecular diagnostic testing leads to earlier diagnosis, before the clinical picture is fully developed. MECP2 encodes methyl-CpG binding protein 2 (MeCP2), a multifunctional protein that is expressed ubiquitously but at the highest levels in neurons. Since MECP2 is subject to X inactivation, affected females are mosaic for cells that either have normal MeCP2 levels or lack MeCP2 function completely. Classic RTT is associated with random X-inactivation patterns, but skewed X-chromosome inactivation leads to phenotypic variants.4Wan M Lee SS Zhang X Houwink-Manville I Song HR Amir RE Budden S Naidu S Pereira JL Lo IF et al.Rett syndrome and beyond: recurrent spontaneous and familial MECP2 mutations at CpG hotpots.Am J Hum Genet. 1999; 65: 1520-1529Abstract Full Text Full Text PDF PubMed Scopus (390) Google Scholar, 5Carney RM Wolpert CM Ravan SA Shahbazian M Ashley-Koch A Cuccaro ML Vance JM Pericak-Vance MA Identification of MeCP2 mutations in a series of females with autistic disorder.Pediatr Neurol. 2003; 28: 205-211Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar Most males with inactivating MECP2 mutations have congenital encephalopathy, with lack of postnatal development, and respiratory insufficiency that usually leads to early death.6Kankirawatana P Leonard H Ellaway C Scurlock J Mansour A Makris CM Dure LS Friez M Lane J Kiraly-Borri C et al.Early progressive encephalopathy in boys and MECP2 mutations.Neurology. 2006; 67: 164-166Crossref PubMed Scopus (70) Google Scholar Recent elegant experiments with genetically manipulated mouse models revealed that the symptoms can be prevented or delayed7Giacometti E Luikenhuis S Beard C Jaenisch R Partial rescue of MeCP2 deficiency by postnatal activation of MeCP2.Proc Natl Acad Sci USA. 2007; 104: 1931-1936Crossref PubMed Scopus (207) Google Scholar and even reversed8Guy J Gan J Selfridge J Cobb S Bird A Reversal of neurological defects in a mouse model of Rett syndrome.Science. 2007; 315: 1143-1147Crossref PubMed Scopus (798) Google Scholar when normal MeCP2 function is restored postnatally. One of the functions of MeCP2 is to repress transcription of methylated genes by recruiting a chromatin remodeling complex to promoter regions.9Nan X Campoy FJ Bird A MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.Cell. 1997; 88: 471-481Abstract Full Text Full Text PDF PubMed Scopus (981) Google Scholar Therefore, lack of MeCP2 is expected to cause abnormal expression of genes that affect postnatal neuronal function. Although large-scale misregulation of gene expression has not been observed, a few target genes have been identified by global gene-expression studies.10Colantuoni C Jeon OH Hyder K Chenchik A Khimani AH Narayanan V Hoffman EP Kaufmann WE Naidu S Pevsner J Gene expression profiling in postmortem Rett syndrome brain: differential gene expression and patient classification.Neurobiol Dis. 2001; 8: 847-865Crossref PubMed Scopus (161) Google Scholar, 11Tudor M Akbarian S Chen RZ Jaenisch R Transcriptional profiling of a mouse model for Rett syndrome reveals subtle transcriptional changes in the brain.Proc Natl Acad Sci USA. 2002; 99: 15536-15541Crossref PubMed Scopus (271) Google Scholar, 12Traynor J Agarwal P Lazzeroni L Francke U Gene expression patterns vary in clonal cell cultures from Rett syndrome females with eight different MECP2 mutations.BMC Med Genet. 2002; 3: 12Crossref PubMed Scopus (81) Google Scholar, 13Ballestar E Ropero S Alaminos M Armstrong J Setien F Agrelo R Fraga MF Herranz M Avila S Pineda M et al.The impact of MECP2 mutations in the expression patterns of Rett syndrome patients.Hum Genet. 2005; 116: 91-104Crossref PubMed Scopus (63) Google Scholar, 14Nuber UA Kriaucionis S Roloff TC Guy J Selfridge J Steinhoff C Schulz R Lipkowitz B Ropers HH Holmes MC et al.Up-regulation of glucocorticoid-regulated genes in a mouse model of Rett syndrome.Hum Mol Genet. 2005; 14: 2247-2256Crossref PubMed Scopus (150) Google Scholar, 15Delgado IJ Kim DS Thatcher KN LaSalle JM Van den Veyver IB Expression profiling of clonal lymphocyte cell cultures from Rett syndrome patients.BMC Med Genet. 2006; 7: 61Crossref PubMed Scopus (32) Google Scholar, 16Deng V Matagne V Banine F Frerking M Ohliger P Budden S Pevsner J Dissen GA Sherman LS Ojeda SR FXYD1 is a MeCP2 target gene overexpressed in the brains of Rett syndrome patients and Mecp2-null mice.Hum Mol Genet. 2007; 16: 640-650Crossref PubMed Scopus (104) Google Scholar, 17Jordan C Li H-H Kwan H Francke U Cerebellar gene expression profiles of mouse models for Rett syndrome reveal novel MeCP2 targets.BMC Med Genet. 2007; 8: 36Crossref PubMed Scopus (98) Google Scholar Imprinted genes that are transcribed exclusively from the maternal or the paternal allele are attractive candidates for potential MeCP2 modulation, because their uniparental expression pattern is controlled by parent-of-origin–specific methylation of specific sites (differentially methylated regions [DMRs]).18Reik W Walter J Imprinting mechanisms in mammals.Curr Opin Genet Dev. 1998; 8: 154-164Crossref PubMed Scopus (148) Google Scholar Of the ∼80 known imprinted genes in mammals,19Morison IM Ramsay JP Spencer HG A census of mammalian imprinting.Trends Genet. 2005; 21: 457-465Abstract Full Text Full Text PDF PubMed Scopus (482) Google Scholar 5 (SNRPN, IPW, NDN, H19, and IGF2) were previously studied in RTT tissues. These genes showed monoallelic expression in MeCP2-deficient clonal cell lines and brain.20Balmer D Arredondo J Samaco RC LaSalle JM MECP2 mutations in Rett syndrome adversely affect lymphocyte growth, but do not affect imprinted gene expression in blood or brain.Hum Genet. 2002; 110: 545-552Crossref PubMed Scopus (63) Google Scholar Although Samaco et al.21Samaco RC Hogart A LaSalle JM Epigenetic overlap in autism-spectrum neurodevelopmental disorders: MECP2 deficiency causes reduced expression of UBE3A and GABRB3.Hum Mol Genet. 2005; 14: 483-492Crossref PubMed Scopus (309) Google Scholar and Makedonski et al.22Makedonski K Abuhatzira L Kaufman Y Razin A Shemer R MeCP2 deficiency in Rett syndrome causes epigenetic aberrations at the PWS/AS imprinting center that affects UBE3A expression.Hum Mol Genet. 2005; 14: 1049-1058Crossref PubMed Scopus (103) Google Scholar reported decreased expression levels of the brain-imprinted genes UBE3A and Ube3a in MeCP2-deficient human and mouse brain tissues, respectively, these data could not be replicated in a more extensive study of Ube3a RNA and protein expression in Mecp2-mutant mouse brains.23Jordan C Francke U Ube3a expression is not altered in Mecp2 mutant mice.Hum Mol Genet. 2006; 15: 2210-2215Crossref PubMed Scopus (25) Google Scholar Hailed as a breakthrough discovery with a major impact on RTT research was the work by Horike et al.24Horike S Cai S Miyano M Cheng JF Kohwi-Shigematsu T Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome.Nat Genet. 2005; 37: 31-40Crossref PubMed Scopus (273) Google Scholar that reported that MeCP2 regulates the expression of the distal-less homeobox 5 gene (DLX5). Under the assumption that DLX5 is imprinted, the authors claimed loss of imprinting in MeCP2-deficient cell lines and brain. In an Mecp2-mutant mouse model,25Guy J Hendrich B Holmes M Martin JE Bird A A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome.Nat Genet. 2001; 27: 322-326Crossref PubMed Scopus (1141) Google Scholar expression levels of Dlx5 and Dlx6 were reported to be increased twofold in the frontal cortex. This increase was said to be the result of "relaxed imprinting," although Dlx5 is known to be biallelically expressed in mice.26Kimura MI Kazuki Y Kashiwagi A Kai Y Abe S Barbieri O Levi G Oshimura M Dlx5, the mouse homologue of the human-imprinted DLX5 gene, is biallelically expressed in the mouse brain.J Hum Genet. 2004; 49: 273-277Crossref PubMed Scopus (29) Google Scholar Horike et al.24Horike S Cai S Miyano M Cheng JF Kohwi-Shigematsu T Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome.Nat Genet. 2005; 37: 31-40Crossref PubMed Scopus (273) Google Scholar concluded that DLX5 is a direct target of MeCP2 modulation, and this conclusion is now widely quoted in the literature. Using a wide range of methodologies, Horike et al.24Horike S Cai S Miyano M Cheng JF Kohwi-Shigematsu T Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome.Nat Genet. 2005; 37: 31-40Crossref PubMed Scopus (273) Google Scholar reported a series of observations that are not coherent. First, searching for in vivo binding sites of MeCP2, they precipitated urea-gradient–purified, formaldehyde–cross-linked chromatin, derived from whole brains of 1-d-old normal mice, with anti-MeCP2 antibody and cloned the precipitated DNA fragments. Of 100 randomly sequenced clones, only 3 contained CpG dinucleotides and were consistent with promoters. The others were located in introns or up to 100 kb away from the ends of the nearest transcription unit. Scanning the vicinity of apparent MeCP2-binding sequences for biologically interesting candidates, Horike et al.24Horike S Cai S Miyano M Cheng JF Kohwi-Shigematsu T Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome.Nat Genet. 2005; 37: 31-40Crossref PubMed Scopus (273) Google Scholar focused on DLX5 for two reasons. First, DLX5 directly regulates expression of glutamic acid dehydroxylase and promotes differentiation of GABAergic neurons,27Stuhmer T Anderson SA Ekker M Rubenstein JL Ectopic expression of the Dlx genes induces glutamic acid decarboxylase and Dlx expression.Development. 2002; 129: 245-252PubMed Google Scholar and, second, DLX5 had previously been reported to be imprinted in human lymphoblasts and brain tissues,28Okita C Meguro M Hoshiya H Haruta M Sakamoto YK Oshimura M A new imprinted cluster on the human chromosome 7q21-q31, identified by human-mouse monochromosomal hybrids.Genomics. 2003; 81: 556-559Crossref PubMed Scopus (68) Google Scholar although not in mouse brain.26Kimura MI Kazuki Y Kashiwagi A Kai Y Abe S Barbieri O Levi G Oshimura M Dlx5, the mouse homologue of the human-imprinted DLX5 gene, is biallelically expressed in the mouse brain.J Hum Genet. 2004; 49: 273-277Crossref PubMed Scopus (29) Google Scholar DLX genes encode a family of transcription factors that contain a homeobox DNA-binding domain related to that of the Drosophila gene distal-less.29Panganiban G Rubenstein JL Developmental functions of the Distal-less/Dlx homeobox genes.Development. 2002; 129: 4371-4386Crossref PubMed Google Scholar In mammalian genomes, the six known DLX genes occur in pairs that are closely linked. DLX5 and DLX6 are located within a 20-kb region in a tail-to-tail configuration on human chromosome 7q21.3 and mouse chromosome 6A1. During development, DLX5 and DLX6 are expressed in defined regions of the brain and in skeletal structures. DLX5 induces bone formation and is expressed in later stages of osteoblast differentiation. Dlx5-knockout mice have multiple defects in their ears, noses, mandibles, and skull bones and die shortly after birth.30Acampora D Merlo GR Paleari L Zerega B Postiglione MP Mantero S Bober E Barbieri O Simeone A Levi G Craniofacial, vestibular and bone defects in mice lacking the Distal-less-related gene Dlx5.Development. 1999; 126: 3795-3809Crossref PubMed Google Scholar A proportion of them have exencephaly.31Depew MJ Liu JK Long JE Presley R Meneses JJ Pedersen RA Rubenstein JL Dlx5 regulates regional development of the branchial arches and sensory capsules.Development. 1999; 126: 3831-3846PubMed Google Scholar Early developmental defects in neurogenesis have also been recognized.32Perera M Merlo GR Verardo S Paleari L Corte G Levi G Defective neuronogenesis in the absence of Dlx5.Mol Cell Neurosci. 2004; 25: 153-161Crossref PubMed Scopus (45) Google Scholar Notably, developmental defects were seen only in homozygous mutants, not in heterozygotes with a parent-of-origin–dependent effect, as would be expected if Dlx5 were an imprinted gene. Evidence that DLX5 is imprinted in humans was first reported by Okita et al.,28Okita C Meguro M Hoshiya H Haruta M Sakamoto YK Oshimura M A new imprinted cluster on the human chromosome 7q21-q31, identified by human-mouse monochromosomal hybrids.Genomics. 2003; 81: 556-559Crossref PubMed Scopus (68) Google Scholar who studied somatic cell hybrid (SCH) lines containing a single human chromosome 7 of defined parental origin. DLX5 was not expressed in SCHs containing a paternal chromosome 7 but was expressed in cells containing a maternally derived chromosome 7. The hybrid cell studies of 76 ESTs from the 7q21-q31 region revealed monoallelic expression for six transcripts, but DLX5 was the only one for which imprinting status could be confirmed by studies of human lymphoblastoid cell lines (LCLs) and brain. Specifically, Okita et al.28Okita C Meguro M Hoshiya H Haruta M Sakamoto YK Oshimura M A new imprinted cluster on the human chromosome 7q21-q31, identified by human-mouse monochromosomal hybrids.Genomics. 2003; 81: 556-559Crossref PubMed Scopus (68) Google Scholar studied LCLs from 15 individuals who were heterozygous for an intragenic polymorphism in DLX5 (c.*163dupC [rs5886002]; the alleles are referred to as "-/G" in dbSNP). RT-PCR products were sequenced and were said to reveal monoallelic expression in 13 of the 15 samples. In all eight cases in which the parental origin of the alleles could be determined, DLX5 was reported to be expressed only from the maternal allele. The authors also examined the allelic expression of DLX5 in brain tissue samples from three c.*163dupC heterozygotes. Sequence analysis of RT-PCR products revealed biallelic but unequal expression, preferentially from a single allele of unknown parental origin. Nevertheless, Okita et al. concluded that "DLX5 is imprinted and maternally expressed in normal human lymphoblasts and brain tissues."28Okita C Meguro M Hoshiya H Haruta M Sakamoto YK Oshimura M A new imprinted cluster on the human chromosome 7q21-q31, identified by human-mouse monochromosomal hybrids.Genomics. 2003; 81: 556-559Crossref PubMed Scopus (68) Google Scholar(p557) Horike et al.24Horike S Cai S Miyano M Cheng JF Kohwi-Shigematsu T Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome.Nat Genet. 2005; 37: 31-40Crossref PubMed Scopus (273) Google Scholar used the same c.*163dupC polymorphism to assess the imprinting status of DLX5 in LCLs from individuals with RTT and controls. By using RT-PCR with 40 cycles, they reported monoallelic expression in two normal control LCLs and in only one of four RTT LCLs. They interpreted these results to indicate "loss of imprinting" in RTT. In the mouse, Kimura et al.26Kimura MI Kazuki Y Kashiwagi A Kai Y Abe S Barbieri O Levi G Oshimura M Dlx5, the mouse homologue of the human-imprinted DLX5 gene, is biallelically expressed in the mouse brain.J Hum Genet. 2004; 49: 273-277Crossref PubMed Scopus (29) Google Scholar reported that Dlx5 is not imprinted. They studied offspring of interspecies crosses, distinguished by a SNP in the 3′ UTR of Dlx5, as well as heterozygous Dlx5-knockout mice that had inherited the knockout allele from either parent. Both approaches revealed that Dlx5 is expressed in a biallelic fashion in cerebral cortex, diencephalon, olfactory bulb, hippocampus, and testis, with no allele-specific preference. Furthermore, the CpG islands of the Dlx5 and Dlx6 promoters were unmethylated on both alleles in wild-type and Mecp2 Y/- mice.24Horike S Cai S Miyano M Cheng JF Kohwi-Shigematsu T Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome.Nat Genet. 2005; 37: 31-40Crossref PubMed Scopus (273) Google Scholar Moreover, no differential methylation was detected at other CpG sites in the Dlx5/Dlx6 region between the two alleles, either in wild-type or in Mecp2-mutant mice. The absence of DMRs is consistent with the observed lack of imprinting of Dlx5 and Dlx6 in mouse brain. Horike et al.24Horike S Cai S Miyano M Cheng JF Kohwi-Shigematsu T Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome.Nat Genet. 2005; 37: 31-40Crossref PubMed Scopus (273) Google Scholar assessed expression of Dlx5 and Dlx6 in mouse brain, first by quantitative RT-PCR (qRT-PCR) experiments on brain samples from an unspecified number of 8-wk-old wild-type and Mecp2-mutant mice. When relative expression levels for Dlx5 and Dlx6, as well as for other imprinted and nonimprinted genes, were compared, only Dlx5 and Dlx6 showed an approximately twofold increase in the mutant samples compared with in the wild-type samples. To determine whether the increased expression was allele specific, Horike et al. examined the SNP in the 3′ UTR of Dlx5 in interspecies crosses, as was done previously by Kimura et al.26Kimura MI Kazuki Y Kashiwagi A Kai Y Abe S Barbieri O Levi G Oshimura M Dlx5, the mouse homologue of the human-imprinted DLX5 gene, is biallelically expressed in the mouse brain.J Hum Genet. 2004; 49: 273-277Crossref PubMed Scopus (29) Google Scholar On the basis of the intensity of restriction-enzyme fragments of RT-PCR products, Horike et al. confirmed that Dlx5 was biallelically transcribed in frontal cortex, but transcript levels were said to be higher for the maternal allele. However, in an Mecp2-mutant male mouse, which was heterozygous for the Dlx5 SNP, both parental-specific restriction fragments were present at equal levels, which led the authors to conclude that MeCP2 deficiency abolished the albeit incomplete imprinting pattern. Notably, the transcript levels and parental-specific expressions of four other, truly imprinted genes (Calcr, Sgce, Peg10, and Asb4), located in the same gene cluster on chromosome 6, were not affected by MeCP2 deficiency. To examine the validity of the fundamental claims that led to the identification of DLX5 as a primary target of MeCP2, we attempted to reproduce the reported data in a systematic fashion. First, in two sets of SCHs with single paternal or maternal copies of chromosome 7, we found expression of both alleles of human DLX5 and DLX6. Second, both genes were consistently expressed in a biallelic fashion in LCLs and brain samples from normal individuals and in clonal RTT LCLs. To evaluate whether MeCP2 deficiency relaxes the imprinting of truly imprinted genes in humans, we studied allele-specific expression of Paternally expressed gene 3 (PEG3) on chromosome 19 and Paternally expressed gene 10 (PEG10) near the DLX5 and DLX6 genes on 7q. We demonstrated strictly monoallelic expression of PEG3 and PEG10 in tissues from males and females with MECP2 mutations. Third, to evaluate the alternative hypothesis—also put forward by Horike et al.,24Horike S Cai S Miyano M Cheng JF Kohwi-Shigematsu T Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome.Nat Genet. 2005; 37: 31-40Crossref PubMed Scopus (273) Google Scholar that differential chromatin loop formation affecting the expression of both alleles, rather than allele-specific imprinting, could control Dlx5 transcript levels in different brain regions—we compared expression levels of Dlx5 and Dlx6 in the forebrain of Mecp2-mutant male mice and normal male littermates. We saw no differences when we combined data from seven different litters of mice aged 7–9 wk. Our results provide strong evidence against the claim that DLX5 and DLX6 are targets of MeCP2 and play a role in the pathogenesis of RTT. Human blood leukocytes from unaffected donors were fused with the Hprt-deleted mouse cell line A9. SCHs were selected in hypoxanthine-aminopterin-thymidine medium, which forces retention of the human X chromosome. Hybrid cell clones were genotyped for eight microsatellite markers on human chromosome 7, to identify those that had retained a single copy of chromosome 733Yan H Papadopoulos N Marra G Perrera C Jiricny J Boland CR Lynch HT Chadwick RB de la Chapelle A Berg K et al.Conversion of diploidy to haploidy.Nature. 2000; 403: 723-724Crossref PubMed Scopus (20) Google Scholar (performed by GMP Genetics). Genotyping of the donors' parents for the loci with distinguishing alleles allowed us to assign maternal or paternal origin of the chromosome 7 that was present. Chromosome 7 retention was not selected for in the hybrid clones, and we did not determine the copy numbers. Hybrid cell lines were grown in Dulbecco's modified Eagle medium with 10% fetal calf serum, 2 mM glutamine, and 1× hypoxanthine and thymidine and were subcultured at 1:3 with TrypLE (GIBCO), by use of standard tissue-culture techniques. For detection and genotyping of DLX5 and DLX6 polymorphisms, we sequenced 14 LCLs previously established in our laboratory from RTT-affected individuals with known MECP2 mutations, 22 unaffected control LCLs, and six fetal and six adult control brain samples. For DLX5, 15 additional control brain samples were genotyped. For two PEG3 SNPs, we genotyped the RTT LCLs and seven brain samples from individuals with RTT, including two hemizygous males with known MECP2 mutations (University of Maryland Brain and Tissue Bank for Developmental Disorders [numbers 1238, 1420, 1748, 1815, 4516, and 4852]). One sample from the Harvard tissue bank is brain sample number b4160. Only the brain samples were genotyped for PEG10 SNPs. Frozen tissue used for the expression studies was from frontal cortex. All human materials were obtained and studied under a protocol approved by the Stanford Human Research Protection Program. We extracted DNA from cultured cells, by using phenol-chloroform, and from brain tissue, by using DNA Stat 60 (Tel-Test). For PCR, we used Promega Go Taq in accordance with the manufacturer's instructions, with the primers listed in table 1, in a 25-μl reaction. The PCR cycling program included an initial denaturation at 95°C for 4 min, followed by five cycles at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. The annealing temperature was reduced by 0.5°C in the second to fifth cycle. For 30 additional cycles, the annealing temperature was 54°C for the DLX5 genomic DNA (gDNA) primers and was 57°C for the DLX5 cDNA primers, as well as for the DLX6, PEG3, and PEG10 primers. The gel-purified PCR amplicons were sequenced using BigDye Terminator chemistry on an ABI 3100 sequencer (Applied Biosystems). For confirmatory studies of the DLX5 c.*163dupC polymorphism, we used a proofreading DNA polymerase (Platinum Pfx [Invitrogen]) to minimize slippage errors during the amplification of the mononucleotide strings.Table 1Primers for Genotyping and Expression AnalysisgDNA Primer (5′→3′)cDNA Primer (5′→3′)Organism and Gene/SNPAllelesForwardReverseProduct Size (bp)ForwardReverseProduct Size (bp)Human: DLX5 c.*163dupC (rs5886002)-/GTTTTTTGGGACTACTGTGTTTTGCAGATTTCAAGGCACCATTGAAAG203GCTGGGATTGACACAAACACAGGCACCATTGAAAGTGTCC568 DLX5 c.*142T→CT/CSame as aboveSame as aboveSame as aboveSame as above DLX5 5′ UTR…………GCCACAACAGCAAGGACAGTTTGCCATTCACCATTCTCA440 DLX6 c.*9A→G (rs3213654)A/GCTCCAGTCTGGGACGTTTCTGCTCTCCTAAGCCTGCTCCT232TCGCTTTCAGCAGACACAGTCGGCTTCTTGCCACACTTAT457 DLX6 c.*775dupC-/CAAGGGAATGCTGCATGTTTTTAGCTTTGTGAATGCCACCA202Same as for gDNASame as for gDNA… DLX6 c.*771C→T (rs2272280)C/TSame as aboveSame as aboveSame as aboveSame as above PEG3 c.*703A→G (rs1055359)A/GCTTGTGAAGCTGTAGGCATGACTGGGTCACAAAAAGCCAAT163Same as for gDNASame as for gDNA… PEG3 c.42C→T (rs1860565)C/TGGGATGGGTACTCACCACTGCAGGTCATTCCAACCATGTG218AAGCCGGAGAACTGTGAGAACTTCTTGGGTTCCTGGTGTG239 PEG10 c.*2923T→C (rs13073)C/TGTGTCATTTTCCTGCCTGGTAGGAGCCTCTCATTCACAGC410Same as for gDNASame as for gDNAMouse: Dlx5…………TCTCTAGGACTGACGCAAACAGTTACACGCCATAGGGTCGC132 Dlx6…………TTCCCGAGAGAGCCGAACTGTGGGTTACTACCCTGCTTCA117 Peg3A…………CACGAAGACGACACCAACAGGTCTCGAGGCTCCACATCTC150 Peg3B…………ACAGTGACGACGACATGAGCGTCTCGAGGCTCCACATCTC122 Rps28…………TAGGGTAACCAAAGTGCTGGGCAGGACATTTCGGATGATAGAGCGG103 β-actin…………TGACCCTGAAGTACCCCATTGACCATGTCGTCCCAGTTGGTAAC 54 Snca…………GCAGCCAGAAGTCGGAAATGAACACATCCATGGCTAAAGA 58 Open table in a new tab We extracted total RNA from mouse × human SCH lines and frozen human cortex, using RNA Stat 60 (Tel-Test). From the LCLs, we extracted mRNA by use of Oligotex Direct mRNA Mini Kit (Qiagen). We treated the RNA with 20 U RNase-free DNaseI (Roche) for 20 min, followed by 10 min of inactivation of the enzyme at 75°C. For reverse transcription, 5 μg total RNA or 1 μg mRNA was incubated with Superscript III (Invitrogen), as recommend by the manufacturer, in a 40-μl reaction. For each reaction, we used a "minus RT" control, to which no Superscript III was added. For DLX5, DLX6, PEG3, and PEG10 RT-PCR assays, we used gene-specific primers (table 1) and 4 μl of the cDNA reaction with Promega Go Taq Flexi, in accordance with the manufacturer's instructions. PCR cycling and sequencing of amplicons were done as described above. Female mice heterozygous for the Mecp2tm1.1Bird mutation25Guy J Hendrich B Holmes M Martin JE Bi
Referência(s)