Mutations in the MESP2 Gene Cause Spondylothoracic Dysostosis/Jarcho-Levin Syndrome
2008; Elsevier BV; Volume: 82; Issue: 6 Linguagem: Inglês
10.1016/j.ajhg.2008.04.014
ISSN1537-6605
AutoresAlberto S. Cornier, Karen Staehling‐Hampton, Kym Delventhal, Yumiko Saga, Jean-François Caubet, Nobuo Sasaki, Sian Ellard, Elizabeth Young, Norman Ramírez, Simón Carlo, José Acosta Torres, John B. Emans, Peter D. Turnpenny, Olivier Pourquié,
Tópico(s)ATP Synthase and ATPases Research
ResumoSpondylothoracic dysostosis (STD), also known as Jarcho-Levin syndrome (JLS), is an autosomal-recessive disorder characterized by abnormal vertebral segmentation and defects affecting spine formation, with complete bilateral fusion of the ribs at the costovertebral junction producing a “crab-like” configuration of the thorax. The shortened spine and trunk can severely affect respiratory function during early childhood. The condition is prevalent in the Puerto Rican population, although it is a panethnic disorder. By sequencing a set of candidate genes involved in mouse segmentation, we identified a recessive E103X nonsense mutation in the mesoderm posterior 2 homolog (MESP2) gene in a patient, of Puerto Rican origin and from the Boston area, who had been diagnosed with STD/JLS. We then analyzed 12 Puerto Rican families with STD probands for the MESP2 E103X mutation. Ten patients were homozygous for the E103X mutation, three patients were compound heterozygous for a second nonsense mutation, E230X, or a missense mutation, L125V, which affects a conserved leucine residue within the bHLH region. Thus, all affected probands harbored the E103X mutation. Our findings suggest a founder-effect mutation in the MESP2 gene as a major cause of the classical Puerto Rican form of STD/JLS. Spondylothoracic dysostosis (STD), also known as Jarcho-Levin syndrome (JLS), is an autosomal-recessive disorder characterized by abnormal vertebral segmentation and defects affecting spine formation, with complete bilateral fusion of the ribs at the costovertebral junction producing a “crab-like” configuration of the thorax. The shortened spine and trunk can severely affect respiratory function during early childhood. The condition is prevalent in the Puerto Rican population, although it is a panethnic disorder. By sequencing a set of candidate genes involved in mouse segmentation, we identified a recessive E103X nonsense mutation in the mesoderm posterior 2 homolog (MESP2) gene in a patient, of Puerto Rican origin and from the Boston area, who had been diagnosed with STD/JLS. We then analyzed 12 Puerto Rican families with STD probands for the MESP2 E103X mutation. Ten patients were homozygous for the E103X mutation, three patients were compound heterozygous for a second nonsense mutation, E230X, or a missense mutation, L125V, which affects a conserved leucine residue within the bHLH region. Thus, all affected probands harbored the E103X mutation. Our findings suggest a founder-effect mutation in the MESP2 gene as a major cause of the classical Puerto Rican form of STD/JLS. Congenital vertebral-segmentation abnormalities in humans are present in a wide variety of rare but well-characterized disorders, as well as in many diverse and poorly understood phenotypic patterns.1Turnpenny P.D. Alman B. Cornier A.S. Giampietro P.F. Offiah A. Tassy O. Pourquie O. Kusumi K. Dunwoodie S. Abnormal vertebral segmentation and the notch signaling pathway in man.Dev. Dyn. 2007; 236: 1456-1474Crossref PubMed Scopus (102) Google Scholar In some cases, patients with congenital scoliosis and chest-wall abnormalities present a major surgical challenge. In 1938, Jarcho and Levin described a Puerto Rican family whose two children presented with a shortened trunk, with abnormal segmentation throughout the vertebral column and irregularly aligned ribs, but with normal long bones and skull.2Jarcho S. Levin P. Hereditary malformation of the vertebral bodies.Bull. Johns Hopkins Hosp. 1938; 62: 216-226Google Scholar Since then, the authors' names have frequently been used eponymously (and often inappropriately) for almost any form of costovertebral malformation. Spondylothoracic dysostosis (STD) has been well characterized as an autosomal-recessive disorder with high prevalence in the Puerto Rican population, comprising 49% of the STD cases reported in the medical literature.3Cornier A.S. Ramirez N. Arroyo S. Acevedo J. Garcia L. Carlo S. Korf B. Phenotype characterization and natural history of spondylothoracic dysplasia syndrome: a series of 27 new cases.Am. J. Med. Genet. 2004; 128: 120-126Crossref Scopus (48) Google Scholar The same phenotype has also been described in other patient populations.4Lavy N.W. Palmer C.G. Merritt A.D. A syndrome of bizarre vertebral anomalies.J. Pediatr. 1966; 69: 1121-1125Abstract Full Text PDF PubMed Scopus (46) Google Scholar, 5Moseley J.E. Bonforte R.J. Spondylothoracic dysplasia–a syndrome of congenital anomalies.Am. J. Roentgenol. Radium Ther. Nucl. Med. 1969; 106: 166-169Crossref PubMed Scopus (48) Google Scholar, 6Pochaczevsky R. Ratner H. Perles D. Kassner G. Naysan P. Spondylothoracic dysplasia.Radiology. 1971; 98: 53-58PubMed Google Scholar, 7Gellis, S.S., Feingold, M., and Pashayan, H.M. (1976). Picture of the month: the EEC syndrome. American journal of diseases of children (1960) 130, 653–654.Google Scholar, 8Solomon L. Jimenez R.B. Reiner L. Spondylothoracic dysostosis: report of two cases and review of the literature.Arch. Pathol. Lab. Med. 1978; 102: 201-205PubMed Google Scholar, 9Tolmie J.L. Whittle M.J. McNay M.B. Gibson A.A. Connor J.M. Second trimester prenatal diagnosis of the Jarcho-Levin syndrome.Prenat. Diagn. 1987; 7: 129-134Crossref PubMed Scopus (33) Google Scholar, 10Schulman M. Gonzalez M.T. Bye M.R. Airway abnormalities in Jarcho-Levin syndrome: a report of two cases.J. Med. Genet. 1993; 30: 875-876Crossref PubMed Scopus (16) Google Scholar, 11McCall C.P. Hudgins L. Cloutier M. Greenstein R.M. Cassidy S.B. Jarcho-Levin syndrome: unusual survival in a classical case.Am. J. Med. Genet. 1994; 49: 328-332Crossref PubMed Scopus (31) Google Scholar Patients with STD exhibit a short stature due to multiple defects in vertebral segmentation and spine formation, an increased antero-posterior (AP) thoracic diameter, and, radiologically, a characteristic “crab-like” appearance of the thoracic cage on AP projection. The ribs are fused posteriorly at the costovertebral junctions. The short spine and thoracic cage frequently cause respiratory insufficiency, with a mortality rate of 32% during early childhood.3Cornier A.S. Ramirez N. Arroyo S. Acevedo J. Garcia L. Carlo S. Korf B. Phenotype characterization and natural history of spondylothoracic dysplasia syndrome: a series of 27 new cases.Am. J. Med. Genet. 2004; 128: 120-126Crossref Scopus (48) Google Scholar The characteristic, periodic vertebral arrangement of the spine is established during embryogenesis when the vertebral precursors, the somites, are rhythmically produced from the presomitic mesoderm in the embryo.12Dequeant, M.L., and Pourquie, O. (2008). Segmental patterning of the vertebrate axis. Nat. Rev. Genet. Published online 15 April 2008, doi:10.1038/nrg2320.Google Scholar This striking rhythmicity, observed in vertebrate model species, of the somite formation in the presomitic mesoderm results from the periodic activation of the Notch-, FGF-, and Wnt-signaling pathways by a molecular oscillator called the segmentation clock.12Dequeant, M.L., and Pourquie, O. (2008). Segmental patterning of the vertebrate axis. Nat. Rev. Genet. Published online 15 April 2008, doi:10.1038/nrg2320.Google Scholar, 13Pourquie O. The segmentation clock: converting embryonic time into spatial pattern.Science. 2003; 301: 328-330Crossref PubMed Scopus (394) Google Scholar The study of nonsyndromic, Mendelian forms of spondylocostal dysostosis (SCD; referred to as SCDO by OMIM) has resulted in an increased understanding of the causes of abnormal vertebral segmentation in humans. Three major SCD subtypes have been characterized thus far and include: (1) SCDO type 1 (SCDO1 [MIM 277300]), which appears to be the most common form and is due to a mutation of the delta-like 3 gene (DLL3 [MIM 602768]);14Bulman M.P. Kusumi K. Frayling T.M. McKeown C. Garrett C. Lander E.S. Krumlauf R. Hattersley A.T. Ellard S. Turnpenny P.D. Mutations in the human delta homologue, DLL3, cause axial skeletal defects in spondylocostal dysostosis.Nat. Genet. 2000; 24: 438-441Crossref PubMed Scopus (296) Google Scholar, 15Turnpenny P.D. Whittock N. Duncan J. Dunwoodie S. Kusumi K. Ellard S. Novel mutations in DLL3, a somitogenesis gene encoding a ligand for the Notch signalling pathway, cause a consistent pattern of abnormal vertebral segmentation in spondylocostal dysostosis.J. Med. Genet. 2003; 40: 333-339Crossref PubMed Scopus (98) Google Scholar, 16Bonafe L. Giunta C. Gassner M. Steinmann B. Superti-Furga A. A cluster of autosomal recessive spondylocostal dysostosis caused by three newly identified DLL3 mutations segregating in a small village.Clin. Genet. 2003; 64: 28-35Crossref PubMed Scopus (31) Google Scholar (2) SCDO2 ([MIM 608681]), which is due to a mutation of the mesoderm posterior 2 homolog gene (MESP2 [MIM 605195]);17Whittock N.V. Sparrow D.B. Wouters M.A. Sillence D. Ellard S. Dunwoodie S.L. Turnpenny P.D. Mutated MESP2 causes spondylocostal dysostosis in humans.Am. J. Hum. Genet. 2004; 74: 1249-1254Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar and (3) SCDO3 ([MIM 609813]), which is due to a mutation of the LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase gene (LFNG [MIM 602576]).18Sparrow D.B. Chapman G. Wouters M.A. Whittock N.V. Ellard S. Fatkin D. Turnpenny P.D. Kusumi K. Sillence D. Dunwoodie S.L. Mutation of the LUNATIC FRINGE gene in humans causes spondylocostal dysostosis with a severe vertebral phenotype.Am. J. Hum. Genet. 2006; 78: 28-37Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar All of these genes are components of the Notch-signaling pathway and are involved in the segmentation clock.1Turnpenny P.D. Alman B. Cornier A.S. Giampietro P.F. Offiah A. Tassy O. Pourquie O. Kusumi K. Dunwoodie S. Abnormal vertebral segmentation and the notch signaling pathway in man.Dev. Dyn. 2007; 236: 1456-1474Crossref PubMed Scopus (102) Google Scholar Thus, in order to identify mutations that underlie congenital vertebral anomalies in humans, we adopted a candidate-gene approach and sequenced genes associated with somitogenesis in patients with congenital scoliosis. We selected five genes, DLL3; LFNG; MESP2; hairy and enhancer of split 7 (HES7 [MIM 608059]); and presenilin 1 (PSEN1 [MIM 104311]), on the basis of their known association with SCD and/or their mouse mutant phenotypes.19Saga Y. Hata N. Koseki H. Taketo M.M. Mesp2: a novel mouse gene expressed in the presegmented mesoderm and essential for segmentation initiation.Genes Dev. 1997; 11: 1827-1839Crossref PubMed Scopus (265) Google Scholar, 20Bessho Y. Sakata R. Komatsu S. Shiota K. Yamada S. Kageyama R. Dynamic expression and essential functions of Hes7 in somite segmentation.Genes Dev. 2001; 15: 2642-2647Crossref PubMed Scopus (281) Google Scholar, 21Koizumi K. Nakajima M. Yuasa S. Saga Y. Sakai T. Kuriyama T. Shirasawa T. Koseki H. The role of presenilin 1 during somite segmentation.Development. 2001; 128: 1391-1402PubMed Google Scholar The coding frame of these five genes was first sequenced in a cohort of 31 patients from the Children's Hospital Boston, all of whom exhibited various degrees of congenital scoliosis with abnormal segmentation. The study was approved by the appropriate Institutional Review Boards (IRBs), and informed consent was obtained from all human subjects at the Children's Hospital Boston. Informed consent was also obtained from hospitals in Puerto Rico as described previously (see ref. 3Cornier A.S. Ramirez N. Arroyo S. Acevedo J. Garcia L. Carlo S. Korf B. Phenotype characterization and natural history of spondylothoracic dysplasia syndrome: a series of 27 new cases.Am. J. Med. Genet. 2004; 128: 120-126Crossref Scopus (48) Google Scholar). Genomic DNA from patient blood samples was prepared with a PAXgene Blood DNA kit according to the manufacturer's protocol (PreAnalytiX, a QIAGEN/BD company). Polymerase chain reaction (PCR) was performed with 25 ng of genomic DNA, 0.6 μM primers, 0.5 units Biolace Taq polymerase (Bioline), 2.0 mM MgCl2, and standard PCR buffer. For products that were difficult to amplify, 0.6 units of failsafe enzyme (Epicenter) were used in place of the Biolace Taq polymerase and failsafe buffers H, J, and D were used for the PCR reaction (reaction details available upon request). The reactions were then amplified via the following thermocycler protocol: 5 min at 95°C, 40× (30 s at 95°C, 30 s at 60°C, and 60 s at 72°C), 10 min at 72°C. For some of the primer pairs, the annealing step was performed at 55°C or 65°C (Table 1). The PCR products were purified with ExcelaPure 96-well UF PCR Purification plates (Edge Biosystems) and sequenced with BigDye v3.1 chemistry on a 3730 DNA Analyzer (Applied Biosystems) with the primers described in Table 1 plus three additional primers to cover MESP2 exon 1 (5′-AAGATCGAGACGCTGCGCCT-3′, 5′-CACTGCAGACTCTCCTCGCT-3′, 5′-CAAGGGCAGGGGCAAGGACAG-3′); two additional primers to cover DLL3 exon 4 (5′-CCCTCCTTTGCCTGTCCTCG-3′, 5′-GGGTGAGTGGGTTGTGAGAGGG-3′), two additional primers to cover DLL3 exon 7 (5′-GCTGCTACGCCCACTTCTC-3′, 5′-TGGGAACTCACACCGCGCT-3′), and one additional primer to cover LFNG exon 8 (5′-ACGCACAGGCACGGCCCTAG-3′). Primer specificity was determined by blast and electronic PCR. Bioinformatic analysis and searches of pseudogene databases indicated no possibility of pseudogenes. Sequences of patient samples were compared to reference sequences in GenBank with SeqScape v2.5 software (Applied Biosystems).Table 1PCR Primers and Summary of Mutations Identified in Patient SamplesGene-ExonAnnealing Temp.PCR Primers (5′→3′)Product Size (bp)Nonsynonymous SNPsForwardReverseMESP2-Ex155GACACCTCTCTGCAACCTGCCTGGAGTAGATAAGCTGGG1117A66G, E103XMESP2-Ex260CCAGCCATACCATGGCAACCCAAGCTACAGGACTGATTC408P351HDLL3-Ex160TCAGATATAAGGCTTGGAAGCTCCCCAGGACCTTCAGGTCG208DLL3-Ex255GCGTGGAAAGGGATGAATGCTTTCGCTGGCAGGGTTAGGC465A115TDLL3-Ex360CTCCATTCCTGAACTCTGGCCACCAACCCCGTGTCTCACG208DLL3-Ex455TCCGTATGCATCCATGTTCGATACATCCGCAGCAGTCAGC493L142Q, F172CDLL3-Ex555GCCTCAGTTTCCCTATCTGTGATCCCAAATCTCCAACCTAT749L218PDLL3-Ex665CTTGAGACTGGACAAGGAGCAACCCTGGACTGTCTGAGCC396DLL3-Ex755CAGAGCTGGGAAACAGCGCGCCAGCAGCGCAAGGCGTTCG695DLL3-Ex860TTGGCCCGATTCCTTGATGCAAAGAGAAGATGGCAGGTAGC435Hes7-Ex160TTCTGGCTCCTGGAGTTCTGGGCAGAATCTGGATGTCGAAGGG294Hes7-Ex255GCCAACCAAGCTTGTGTCCCAGCGGAGAGGGATCGAATGG340Hes7-Ex355TTAACCTCGCCTCGGAGCAGAACCATTTGGTCGCGCGTTCTGTGGG367Hes7-Ex455TCCCCAACACCTGCTCGCCCTCCCTCTTTCCGTCCATCTGG699LFNG-Ex155GGTGCTGCGCTGCTGGACTGCACTGGCGTCGCCCACAGATG666G38RLFNG-Ex265AAACCAAGGCCCGGAGAAGGTGAGTAAACTGCCCTCCCTGTCC319LFNG-Ex3&465GGAAAAAGCTGCCTGAATGGGACTCCGGGTGTGCGCTCC632LFNG-Ex565ATGGAGCGGGTCAGCGAGAAAGAGTCCTGCCGGATGGTGC480LFNG-Ex665AGATTCCCTCCACAGAGAGCCACGCAGTGAAGAGAAGAGACGGCAGG581LFNG-Ex760AGTTTGGGACCTTATTCCTGGGATGCCGCTTAGAGAGACCCTGC341V346MLFNG-Ex865AAATGGGAGCTCAGCACCTGCCAGAGGCACATAAGTGGCGCTGG351PSEN1-Ex365TCTGGGAGCCTGCAAGTGACCTGTGTCCTCCAGCAATCAGC463PSEN1-Ex465TGACGGGTCTGTTGTTAATCCCCCCTCGCTCTCTCAACTG496PSEN1-Ex565GAGTTGGGGAAAAGTGACTTATGAGCCTGGCATTACACA474PSEN1-Ex655GGCGAAACCCTGTCTCTACTAGGAGCAACAGAAGAATGTCTC511PSEN1-Ex755GCCGTGATTGCACCACTTTACCATGCCCAGCCGAAATCT653PSEN1-Ex860ACCCCAGTAACGATACACTGAATCAACATCAGGTAGAAGA552PSEN1-Ex960GGAAGACTGGCGATTTGTGTATTTACTGGGCATTATCA329E318GPSEN1-Ex1060GGCCAGCTAGTTACAATGCCAAATAAAAGTTACATGTGA407PSEN1-Ex1165AACACAGCTGAAGCCTAATTTAGCTCCCAAGTGATTCTAATG453PSEN1-Ex1260TGCATAATGAACCCTATGAAAACAGTCCACTGCGATGAA584 Open table in a new tab Ten nonsynonymous, single-nucleotide polymorphisms (SNPs) were identified in the patient samples, including nine missense mutations and one nonsense mutation (Table 1). Of the nine missense mutations, three were reported in the public SNP database (DLL3 F172C, dbSNP ID no. rs8107127; DLL3 L218P, dbSNP ID no. rs1110627 and PSEN1 E318G, dbSNP ID no. rs17125721) and six were previously unreported. It is unclear whether these missense mutations are simple polymorphisms or if they contribute to the disease phenotype in the patients. In a 12-year-old female of Puerto Rican origin with a severe form of STD (atypical, with scoliosis), a tethered spinal cord, and malrotation of the right kidney (Figure 1A), we identified a previously unreported homozygous nonsense mutation in the MESP2 gene. This patient harbored a single-base-pair substitution mutation (c.307G→T) in the basic helix-loop-helix (bHLH) domain of the MESP2 gene (base-pair numbering based on accession no. BC111413). The mutation resulted in the replacement of a glutamic acid codon (GAG) at position 103 with a stop codon (TAG) and the creation of an SpeI restriction-enzyme site (Figures 2A and 2B). The mutation, E103X (p.Glu103X), occurs in exon 1 in the middle of the bHLH domain and is likely to produce a truncated nonfunctional protein and to be susceptible to nonsense-mediated RNA decay (NMD)22Chang Y.F. Imam J.S. Wilkinson M.F. The nonsense-mediated decay RNA surveillance pathway.Annu. Rev. Biochem. 2007; 76: 51-74Crossref PubMed Scopus (882) Google Scholar (Figure 2C).Figure 2Detection of the E103X Mutation by DNA Sequencing and Restriction Fragment Length Polymorphism (RFLP) AnalysisShow full caption(A) The amino acid and DNA sequences (top, orange) of MESP2 from GenBank are compared with the sequences from the patient with STD/JLS. The single-base-pair substitution mutation (c.307G→T) is indicated by a vertical box. The asterisk indicates the stop codon.(B) The c.307G→T mutation results in the addition of an SpeI site, which can be detected as an RFLP. Sample no. 01021 is from a control patient who does not have the E103X mutation. Sample no. 01022 is from a patient who is homozygous for the E103X mutation.(C) Comparison of MESP2 full-length protein versus truncated protein caused by the E103X mutation. The full-length MESP2 protein (top) has an N-terminal (N-term) domain followed by a basic helix-loop-helix domain (bHLH), a region rich in glycine and glutamine residues (GQ repeats), and a c-terminal (c-term) region. Between the bHLH domain and the GQ repeats is a conserved CPXCP motif. The predicted protein resulting from the E103X mutation (bottom) has a short, truncated bHLH domain and is missing the other domains.(D) Sequence comparison of the bHLH domain of MESP2 to other bHLH proteins. The asterisk indicates the L125V mutation in patient 0600905-01. Identical residues are highlighted in yellow, conserved residues are highlighted in blue, and blocks of similar residues are highlighted in green. Swiss-Prot accession numbers for the sequences are: human MESP2, Q0VG99 ; human MESP1, Q9BRJ9 ; mouse Mesp2, O08574 ; human Twist1, Q15672 ; human Myogenin, P15173 ; human HEN1, Q02575 ; mouse dHAND, Q9EPN2 ; Xenopus Thylacine1, O73623 ; Xenopus Thylacine2, O73624 ; mouse Neurogenin-2, P70447 ; and Drosophila AS-C/T5, P10083 .View Large Image Figure ViewerDownload Hi-res image Download (PPT) (A) The amino acid and DNA sequences (top, orange) of MESP2 from GenBank are compared with the sequences from the patient with STD/JLS. The single-base-pair substitution mutation (c.307G→T) is indicated by a vertical box. The asterisk indicates the stop codon. (B) The c.307G→T mutation results in the addition of an SpeI site, which can be detected as an RFLP. Sample no. 01021 is from a control patient who does not have the E103X mutation. Sample no. 01022 is from a patient who is homozygous for the E103X mutation. (C) Comparison of MESP2 full-length protein versus truncated protein caused by the E103X mutation. The full-length MESP2 protein (top) has an N-terminal (N-term) domain followed by a basic helix-loop-helix domain (bHLH), a region rich in glycine and glutamine residues (GQ repeats), and a c-terminal (c-term) region. Between the bHLH domain and the GQ repeats is a conserved CPXCP motif. The predicted protein resulting from the E103X mutation (bottom) has a short, truncated bHLH domain and is missing the other domains. (D) Sequence comparison of the bHLH domain of MESP2 to other bHLH proteins. The asterisk indicates the L125V mutation in patient 0600905-01. Identical residues are highlighted in yellow, conserved residues are highlighted in blue, and blocks of similar residues are highlighted in green. Swiss-Prot accession numbers for the sequences are: human MESP2, Q0VG99 ; human MESP1, Q9BRJ9 ; mouse Mesp2, O08574 ; human Twist1, Q15672 ; human Myogenin, P15173 ; human HEN1, Q02575 ; mouse dHAND, Q9EPN2 ; Xenopus Thylacine1, O73623 ; Xenopus Thylacine2, O73624 ; mouse Neurogenin-2, P70447 ; and Drosophila AS-C/T5, P10083 . Because of the Puerto Rican origin of the patient and the high frequency of STD in the Puerto Rican population, we sequenced the MESP2 gene in a cohort of 14 Puerto Rican patients with STD. We first examined the MESP2 gene in ten Puerto Rican probands and family members previously reported.3Cornier A.S. Ramirez N. Arroyo S. Acevedo J. Garcia L. Carlo S. Korf B. Phenotype characterization and natural history of spondylothoracic dysplasia syndrome: a series of 27 new cases.Am. J. Med. Genet. 2004; 128: 120-126Crossref Scopus (48) Google Scholar Eight of the ten probands were homozygous for the E103X mutation (Table 2). The unaffected parents were heterozygous carriers. An additional patient (0600905-01) was heterozygous for the E103X mutation and an L125V (c.373C→G, p.Leu125Val) missense MESP2 mutation (Table 2). The L125V mutation occurs in a conserved leucine residue in the bHLH domain (Figure 2D) and is predicted to be deleterious by the Sorting Intolerant From Tolerant (SIFT) prediction program23Ng P.C. Henikoff S. Predicting deleterious amino acid substitutions.Genome Res. 2001; 11: 863-874Crossref PubMed Scopus (1763) Google Scholar but predicted to be neutral by the PMUT algorithm.24Ferrer-Costa C. Gelpi J.L. Zamakola L. Parraga I. de la Cruz X. Orozco M. PMUT: a web-based tool for the annotation of pathological mutations on proteins.Bioinformatics. 2005; 21: 3176-3178Crossref PubMed Scopus (387) Google Scholar The L125V mutation was not present in a panel of ethnically matched controls, suggesting that the L125V mutation is not a common polymorphism in the Puerto Rican population (n = 24, data not shown). The other patient (000408-05) was heterozygous for the E103X mutation, but a second MESP2 mutation was not identified, nor was there any mutation in the DLL3 or LFNG genes (data not shown). It is unclear how the E103X mutation contributes to the STD phenotype in this particular patient. The father of this patient was of Puerto Rican and Chinese ethnicity, which could explain the lack of a second MESP2 gene mutation. It is possible that this patient has a partial gene deletion or a mutation in the promoter or regulatory region, given that only coding exons and exon/intron junctions were sequenced. Alternatively, this patient might carry a mutation in an as-yet-unidentified gene. Two variants of the MESP2 gene—A66G and S220F—were identified in two parental carriers (Table 2) and were believed to be polymorphisms, given that these variants were not transmitted to their affected offspring.Table 2MESP2 Mutations in Patients of Puerto Rican OriginFamily No.RelationshipPatient IDAffected StatusE103stop StatusOther MESP2 Mutations1Proband990706-01AFHom1Parent990706-03OCHet1Parent990706-04OCHet2Father980615-01OCHet2Mother980615-03OCHet2Proband980615-04AFHom3Proband980524-01AFHom3Father980524-03(A)OCHet3Mother980504-04BOCHet4Proband980712-01AFHom4Parent980712-02OCHetA66G (Het)4Parent980712-03OCHet5Proband000308-01AFHom5Parent000308-02OCHet6Proband980507-01AFHom6Parent980725-02OCHet7Proband990617-01AFHom7Parent990602-02OCHet8Proband000201-01AFHom8Parent000201-03OCHet8Parent000201-02OCHet9Proband0600905-01AFHetL125V (Het)9Parent0600905-02OCWTL125V (Het), S220F (Het)9Parent0600905-03OCHet10Proband000408-05AFHet10Parent000408-07OCWT10Parent000427-02OCHetAF denotes affected, OC denotes obligate carrier, Hom denotes homozygous, Het denotes heterozygous, and WT denotes wild-type. Open table in a new tab AF denotes affected, OC denotes obligate carrier, Hom denotes homozygous, Het denotes heterozygous, and WT denotes wild-type. The MESP2 gene was sequenced in two other affected families of Puerto Rican origin (Figures 3A and 3B), for whom radiographs were unavailable. The two probands of these families were homozygous for the E103X mutation. Unexpectedly, however, two affected third cousins of the proband in one of these families (Figure 3B) were compound heterozygotes for E103X and a second nonsense mutation, E230X. This mutation (c.688G→T) results in the replacement of glutamic acid at position 230 with a premature termination codon (p.Glu230X). Heterozygous carriers were unaffected. To determine whether these mutations are responsible for the phenotype, transcriptional activities of MESP2 variants were analyzed with luciferase reporter assays. Previous studies in mouse revealed that Mesp2 exhibits synergy with Notch signaling to activate transcription from an Lfng reporter in cultured cells.25Morimoto M. Takahashi Y. Endo M. Saga Y. The Mesp2 transcription factor establishes segmental borders by suppressing Notch activity.Nature. 2005; 435: 354-359Crossref PubMed Scopus (184) Google Scholar We confirmed that the human MESP2 also retained similar activity on the mouse Lfng reporter, albeit weaker than the mouse Mesp2 protein (Figure 4A). For the luciferase reporter assays, a 2.5Kb EcoRI-NotI fragment of the mouse Lfng enhancer was cloned upstream of luciferase in the pGL4.10 vector (Promega, Madison, WI, USA). The reporter was transfected into NIH 3T3 cells with or without constructs expressing the Notch intracytoplasmic domain (NICD) fused to the venus variant of the yellow fluorescent protein (YFP) (50 ng) and one of the following: 3 × Flag-tagged mouse Mesp2 (50 ng), human MESP2 (50 ng), human MESP2 E103X (50 ng), human MESP2 500-503 dup (50 ng) or human MESP2 L125V (50 ng). In this assay the NICD-YFP expression construct acts as a constitutively active Notch receptor. pGL4.74 (Promega) was cotransfected as an internal control (10 ng) to normalize for differences in transfection efficiency. After 36 hr, luciferase activities were measured with a Dual Luciferase Assay kit (Promega), and the activities shown in Figure 4B represent average values, obtained from at least three independent experiments. We examined three different MESP2 mutant cDNA constructs harboring two mutations reported in this paper, E103X and L125V, as well as the 4-bp duplication (c.500–503 dupACCG) reported previously.17Whittock N.V. Sparrow D.B. Wouters M.A. Sillence D. Ellard S. Dunwoodie S.L. Turnpenny P.D. Mutated MESP2 causes spondylocostal dysostosis in humans.Am. J. Hum. Genet. 2004; 74: 1249-1254Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar The results indicate that all three mutations lack transcriptional activities in this assay (Figure 4B). We compared the genotypes of ten patients with STD with their respective clinical phenotypes and natural histories. The two patients who died during early infancy were homozygous for the E103X mutation, but fewer clinical measurements and data were available for them. Clinical data are summarized in Table 3, and representative images of the skeletal defects are presented in Figures 1B–1H. Axial skeletal dimensions were compared to normal standards.26Dimeglio A. Bonnel F. Growth of the Spine.in: AJ R. M C. C D.R. The Pediatric Spine. Springer-Verlag, New York1989: 39-83Crossref Google Scholar Phenotypical data suggest that heterozygosity for the E103X mutation produces a milder phenotype in terms of the thoracic measurements (Figures 1F and 1G), although due to the small sample size the differences were not statistically significant.Table 3Summary of Clinical and Radiological Findings in Affected SubjectsObservation or MeasurementSubjects and FindingsGenotypesE103X/E103X (n = 8); E103X/L125V (n = 1); E103X/unknown (n = 1)AgeDeceased (n = 2; 4 mos, 3 mos)Preschool (n = 2; 2 yrs, 4 yrs)School-age (n = 4; avg. 12.2 yrs; range: 8–18)Adults (n = 2; 34 yrs, 35 yrs)Hospital treatment< 1 yr: 3.7 admissions; avg. length 4.8 days (range: 2–18)> 24 mos: 1.3 admissions per yr (range: 0–4)Abdomen/inguinal herniaProtuberant, no visceromegaly; bilateral herniotomy (n = 8, i.e., all survivors)Height1.15 percentile (range: 1–3)Weight1.1 percentile (range: 1–3)Upper/lower limbsWithin normal range (i.e., short stature due to truncal shortening)BMI16.15 (range: 12–22.9)Thoracic circumference: nipple line33rd percentile (range: 1st–68th)Thoracic circumference: height ratio0.621 (range: 0.386–0.739) (expected 0.534 [range: 0.481-0.643]; p > 0.0001). No differences between children and adults, between survivors and nonsurvivors, or between genotypes.Lung volumes compared with the normal range for age/genderAverage: 23%; range: 15.4–28% for E103X homozygotes (n = 6: survivors); 38–41% for E103X heterozygotes (n = 2)Lung volumes compared with the normal range for height/age and thoracic spinal height/age (allowing for short stature)Average: 40.5%; range: 16.2–101.3%Spinal radiology CervicalClinically: neck rigid and extremely shortAtlas fused to occiput and axis fused with vertebrae—not possible to determine vertebral number Thoracic cageAsymmetrically shortened, with posterior aspect more severely affected. Fusion of all ribs at costovertebral junctions (Figures 1A–1C); extent of rib fusion ranged from 30–60% of thoracic rib circumference.Median vertebral number: 6 (range: 5–8), on the basis of normal pedicle shadows. Multiple segmentation and formation defects. Thoracic vertebrae showed anterior and posterior sagittal clefts (Figure 1D).Scoliosis rare—one subject (Cobb angle 21°)Median rib number: 10 per hemithorax (
Referência(s)