Limpar
1.659 resultados

Acesso aberto

Tipo do recurso

Ano de criação

Produção nacional

Revisado por pares

Áreas

Idioma

Editores

Jornais Acesso aberto

Max Fraser, Jonathan Northcroft, John Dugdale, William Kay, Jane Gibb, Matthew Wall, Frances Hendrix, Michael Wright, Barbara Hall, Nigel Botherway, Lucas Hollweg, Carol Faulkes, Jeff Dawson, Christine McGourty, N J, Sarah Harden's, Jim Munro, Felice Hardy, Helen Davies, P Hughes, Jonathan Leaks Science Editor, Sally Brock, Rob Hughes, John Peter, Antoni Kolodzejczyk, Ian McIlvanney, Professor Gideon Garter, Amanda Ursell, Richard Calvocoressi, Brandl Chastain, Tim Dawson, Bruce Millar, Katie Samuel, Andrew Longmore, Jane Eaton, Jess Bhamra, Susan d'Arcy, Nick Dempsey, Gareth Walsh, Frank Whitford, Neil Graham, Ivo Tennant, Natalie Portman, James Makin, Kathryn Cooper, P D, David Smith, David Cracknell Political Editor, Frederic Raphael, Neil Wormald, E P, Keron Bhattacharya, Andrew Sullivan, Clive Davis, Michael Graves, John Roblin, K R, Andrew Porter, D J Lees, Tony Allen-Mills, Bruce Page, Simon Wilde, Joan Ridsdale, Martin James, Dr Greg Spencer, Robert Winnett, Irwin Stelzer, Sarak Shoraka, Matt Rudd, Peter Wilson, Rosie Millard, Antony Pitts, David Dougill, Nicholas Hellen Social Affairs Editor, Rhianna Pratchett, John Gribbin, Frank Graham, Jim Switzer, Stuart Barnes, Paul Flynn, Maria Sharapova, David Hewson, Tanya Turner, Stephen Venables, Paul Forsyth, Alan Palmer, Hugh Canning, Geraldine Hackett Education Correspondent, Martin Harrison, Jeremy Clarkson, David Cairns, Philip Smith, Andrew Oswald, Michael Floey, A Critchley, Edward Porter, Michael Portillo, Stewart Lee, Victoria Segal, Patricia Nicol, Anthony Peregrine, Pote Oliver, Sarah Dempster, Dave Pollard, Sean Newson, Cathy Struthers, Richard Fletcher, Philip Gibbons, John Lilley, Diy Pension, Sally Kinness, Lydia Slater, Kevin Sloane, Jeremy Guscott, Hugh Thomas, Peter Parker, Mike Laws, John Edgar, Stuart Wavell, Roger Eglin, Leah Charles, Sir David Frost, Paul Donovan, Pat Cash, Tony Thorn, Duncan Campbell, Maurice Schneider, Edward Gorman, Frances Spalding, Hugh McIlvanney, Chris Woodhead, Grace Hillary, Jasper Gerard, Paul Driver, Nicholas Hellen, John Follain, Sally Jones, Felipe Fernandez-Armesto, Stuart Andrews, Shelley Von Strunckel, David Leppard, Paul Durman, Colin Harding, Jonathon Carr-Brown Health Correspondent, Mark Edwards, Helen Chislett, Jane Nottage, Alan Meirose, Susan Clark, Luke Jones, Michael Towl, Don Beadle, Adam Hart-Davis, Alan Combes, Alice …, Raymond Keene, Fiona Morrow, Karen Brady, Cosmo Landesman, Zoe Brennan, Gavin Conway, Diana Wright, Kipper Williams, S B, Sean Leslie, Emma Smith, Golf Bidder, Nick Coin, Kenneth Vettese, Stephen Jones, Ricky Hatton, Barry Flatman, Uzi Mahnaimi, Nick Cain, John Carlin, Dominic O'Connell, Louise Armitstead, Blower Spindle, Natalie Graham, Jermy Hart, Niall Toner, Adrienne Connors, Lucy Atkins, Caroline Donald, Anne Jenkins, Ali Rifaat, David Walsh, Ralph Magee, Fellce Hardy, Roksanda Ilincic, Rodney Pitham, Colin McDowell, Stephen Armstrong, John Elliott, Christopher Goodwin, Mark Turner, M L, Victoria O'brien, Jonathan Leake Environment Editor, N R, Richard Woods, Norman Stone, Brlan Doogan, Judith Boot, Derek Tonkin, Shane Watson, Stephanie Calman, Maurice Chittenden, Richard Brooks Arts Editor, Dave Hanningan, Mark Franchetti, Ioe Lovejoy, Ray Hutton, Jon Ungoed-Thomas, Claudia Croft, Jonathan Leake, Alain De Botton, Michael Sheridan, Dan Box, Clare Francis, C P O'Brien, D J Taylor, John Harlow, Brian Smyth, Simon Brooke, Mark Kleinman, Andrew Stephen, John Waples, Delia Smith, A A Gill, Matthew Campbell, Brian Glanville, Tom Robbins, Mary Braid, Mia Hamm, Jason Mellor, Stephen Pettitt, Will Iredale, Jonathan Leake Science Editor, Jessica Bown, T L, Charlie Hodgson, Gigh Cohen, Peter Johnson's, Sally Kinnes, Maria McErlane, Tom Pattinson, Slan Griffiths, Nigel Powell, Daniel Emery, Clarence Barrett, Roger Dobson, Birgit Print, Brian Doogan, Ben Dowell, Minette Marrin, John Cornwell, Graham Norwood, Christopher Higgins, P W, David Budworth, Hugh Pearman, Andrew Davidson, Gabriella Baker, Dan Cairns, Phillip Knightley, Germaine Greer, Sebastian Smith, Ken Campbell, Matt Roberts, David Smith Economics Editor, Rachel De Thame, Hugh Bradley, Sam Baker, Sarah Baxter, Brian Schofield, Walter Ellis, Rev John Ewington, Jean Fraser, Matthew Goodman, India Knight, Sara Hassan, Simon Wilde Cricket Correspondent, Simon Howard, Jason Dawe, Dominic Rushe, Richard Lewis, Karen Robinson, Helen Stewart,

... goals 40 int…onal appearances for Mexico Brandi Chastain The Sunday Times When Hamma Monza forward Milene ...

2005 - Gale Group | Sunday Times HA GDA

Artigo Acesso aberto Revisado por pares

Alexandre A. Vetcher, Марек Напиерала, Robert D. Wells,

... paper (1Vetcher A.A. Napierala M. Iyer R. Chastain P.D. Griffith J.D. Wells R.D. ... this novel DNA structure was discovered (2Sakamoto N. Chastain P.D. Parniewski P. Ohshima K. Pandolfo M. ... with the disease or inhibit transcription (2Sakamoto N. Chastain P.D. Parniewski P. Ohshima K. Pandolfo M. ... article (1Vetcher A.A. Napierala M. Iyer R. Chastain P.D. Griffith J.D. Wells R.D. ... pRW3822 (1Vetcher A.A. Napierala M. Iyer R. Chastain P.D. Griffith J.D. Wells R.D. ... PDF PubMed Scopus (61) Google Scholar, 2Sakamoto N. Chastain P.D. Parniewski P. Ohshima K. Pandolfo M. ...

Tópico(s): Microtubule and mitosis dynamics

2002 - Elsevier BV | Journal of Biological Chemistry

Performance program Acesso aberto

Konzert - Programm - Austausch Klavier-Abend Jean Du Chastain. Performance Program.

0000 - Gale Group | NCCO British Theatre

Artigo Acesso aberto Revisado por pares

Xinxing Lyu, Kai‐Hang Lei, Pau Biak Sang, Olga Shiva, Megan Chastain, Peter Chi, Weihang Chai,

... Search for more papers by this author Megan Chastain Megan Chastain Department of Biomedical Sciences, ESF College of Medicine, ... Search for more papers by this author Megan Chastain Megan Chastain Department of Biomedical Sciences, ESF College of Medicine, ... by binding to ssDNA accumulated at stalled forks (Chastain et al., 2016). CST facilitates fork recovery and ... stability under replication stress (Stewart et al., 2012; Chastain et al., 2016). However, the precise molecular mechanism ... stalling to protect the stability of these sequences (Chastain et al., 2016). However, it is unknown whether ...

Tópico(s): Genomics and Chromatin Dynamics

2020 - Springer Nature | The EMBO Journal

Artigo Acesso aberto Revisado por pares

Zheng-Guo He, Lisa F. Rezende, Smaranda Willcox, Jack D. Griffith, Charles C. Richardson,

... PDF PubMed Scopus (98) Google Scholar, 14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson ... protein-protein interactions in the replisome (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson ... lagging strand DNA synthesis in vitro (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson ... carboxyl-terminal region of gp2.5 (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson ... lagging strand DNA synthesis in vitro (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson ... The 70-mer oligonucleotide GACCATATCCTCCACCCTCCCCAATATTGACCATCAACCCTTCACCTCACTTCACTCCACTATACCACTC-3′ (14Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson ...

Tópico(s): DNA Repair Mechanisms

2003 - Elsevier BV | Journal of Biological Chemistry

Jornais Acesso aberto

Antoinette Donnelly, Leslie Thrasher, Ethel Somers, George Kibbe Turner, Frederick Tisdale, Norman S. Hall, Floyd Gibbons, Toni Jr., Alice Curtis Desmond, William F. Sturm, Douglas De Younge Silver, Bettina Bedwell, Ralph Barton, Mrs. Emory Chastain, Mabel McElliott Clarke, Sidney Sutherland, Frederick James Smith, Mary Brush Williams, Bert Green, Tom Gibbons, Edwin Balmer, Eileen Bourne,

Liberty Quaker Brand Puffed Wheat Frigidaire Dunlop Liberty The Value of Luxury In This Issue In Our Next Issue Liberty Johnston's Chocolates Law Vs. ...

1927 - Gale Group | LibertyMagazine

Artigo Revisado por pares

Kenneth Chastain,

... 14 Characteristics of Graded and Ungraded Compositions KENNETH CHASTAIN, KENNETH CHASTAIN University of VirginiaSearch for more papers by this author KENNETH CHASTAIN, KENNETH CHASTAIN University of VirginiaSearch for more papers by this ... Copy URL Share a linkShare onEmailFacebookTwitterLinkedInRedditWechat BIBLIOGRAPHY 1 Chastain, Kenneth "Learners' Language Errors," in Kenneth Chastain, Toward a Philosophy of Second-Language Learning and ...

Tópico(s): Historical Linguistics and Language Studies

1990 - Wiley | Modern Language Journal

Artigo Acesso aberto Revisado por pares

Yuchun Du, Srinivasa R. Peddi, Robert J. Spreitzer,

... L290F mutant enzyme (Fig. 1B) (24.Chen Z. Chastain C.J. Al-Abed S.R. Chollet R. ... the loss of Rubisco holoenzyme (24.Chen Z. Chastain C.J. Al-Abed S.R. Chollet R. ... for the rbcL mutations (33.Spreitzer R.J. Chastain C.J. Curr. Genet. 1987; 11: 611-616Crossref ... and 1 mm dithiothreitol (33.Spreitzer R.J. Chastain C.J. Curr. Genet. 1987; 11: 611-616Crossref ... acid-stable 14C from NaH14CO3 (24.Chen Z. Chastain C.J. Al-Abed S.R. Chollet R. ... Kc[O2]/Ko(Kc + [CO2]) (24.Chen Z. Chastain C.J. Al-Abed S.R. Chollet R. ...

Tópico(s): Porphyrin Metabolism and Disorders

2003 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Naoaki Sakamoto, Jacquelynn E. Larson, Ravi R. Iyer, Laura Montermini, Massimo Pandolfo, Robert D. Wells,

... GAA·TTC repeats from FRDA patients (12Sakamoto N. Chastain P.D. Parniewski P. Ohshima K. Pandolfo M. ... between two R·R·Y triplexes (12Sakamoto N. Chastain P.D. Parniewski P. Ohshima K. Pandolfo M. ... that required for the disease phenotype (12Sakamoto N. Chastain P.D. Parniewski P. Ohshima K. Pandolfo M. ... associate with the FRDA disease state (12Sakamoto N. Chastain P.D. Parniewski P. Ohshima K. Pandolfo M. ... DNA strand was performed as described (12Sakamoto N. Chastain P.D. Parniewski P. Ohshima K. Pandolfo M. ...

Tópico(s): DNA Repair Mechanisms

2001 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Jason A. Stewart, Feng Wang, Mary F. Chaiken, Christopher Kasbek, Paul D. Chastain, Woodring E. Wright, Carolyn M. Price,

... for more papers by this author Paul D Chastain II Paul D Chastain II Department of Pathology and Laboratory Medicine, University ... for more papers by this author Paul D Chastain II Paul D Chastain II Department of Pathology and Laboratory Medicine, University ...

Tópico(s): CRISPR and Genetic Engineering

2012 - Springer Nature | The EMBO Journal

Artigo Acesso aberto Revisado por pares

Sharmistha Ghosh, Boriana Marintcheva, Masateru Takahashi, Charles C. Richardson,

... leading and lagging strand DNA synthesis (26Lee J. Chastain 2nd., P.D. Kusakabe T. Griffith J.D. ... Full Text PDF PubMed Google Scholar, 46Lee J. Chastain 2nd, P.D. Griffith J.D. Richardson C. ... mini-circle substrate as described previously (26Lee J. Chastain 2nd., P.D. Kusakabe T. Griffith J.D. ... is identical to that described previously (26Lee J. Chastain 2nd., P.D. Kusakabe T. Griffith J.D. ... 5101Crossref PubMed Scopus (77) Google Scholar, 26Lee J. Chastain 2nd., P.D. Kusakabe T. Griffith J.D. ...

Tópico(s): Bacterial Genetics and Biotechnology

2009 - Elsevier BV | Journal of Biological Chemistry

Artigo Revisado por pares

M. Abou‐Gabal, C. B. Chastain, R. M. Hogle,

... Search for more papers by this authorC. B. Chastain, C. B. Chastain Departments of Veterinary Microbiology and Preventive Medicine and ... Search for more papers by this authorC. B. Chastain, C. B. Chastain Departments of Veterinary Microbiology and Preventive Medicine and ...

Tópico(s): Autoimmune Bullous Skin Diseases

2009 - Wiley | Mycoses

Artigo Revisado por pares

Kenneth Chastain,

... 14 Characteristics of Graded and Ungraded Compositions KENNETH CHASTAIN, KENNETH CHASTAIN University of VirginiaSearch for more papers by this author KENNETH CHASTAIN, KENNETH CHASTAIN University of VirginiaSearch for more papers by this ...

Tópico(s): EFL/ESL Teaching and Learning

1990 - Wiley | Modern Language Journal

Artigo Revisado por pares

Kenneth Chastain,

... Cognitive Code-Learning Theory—A Continuation Kenneth D. Chastain, Kenneth D. Chastain Purdue UniversitySearch for more papers by this author Kenneth D. Chastain, Kenneth D. Chastain Purdue UniversitySearch for more papers by this author ...

Tópico(s): Multilingual Education and Policy

1970 - Wiley | Modern Language Journal

Artigo Revisado por pares

Kenneth Chastain, Frank J. Woerdehoff,

... and the Cognitive Code-Learning Theory Kenneth D. Chastain, Kenneth D. Chastain Purdue, UniversitySearch for more papers by this authorFrank ... for more papers by this author Kenneth D. Chastain, Kenneth D. Chastain Purdue, UniversitySearch for more papers by this authorFrank ...

Tópico(s): Linguistic Variation and Morphology

1968 - Wiley | Modern Language Journal

Artigo Revisado por pares

Young‐Rock Hong, Amir Alishahi Tabriz, Kea Turner,

... 1870 Crossref PubMed Scopus (177) Google Scholar ,2 Chastain DB Osae SP Henao-Martínez AF Franco-Paredes C Chastain JS Young HN. Racial disproportionality in COVID clinical ... the development of more inclusive clinical trials. 2 Chastain DB Osae SP Henao-Martínez AF Franco-Paredes C Chastain JS Young HN. Racial disproportionality in COVID clinical ...

Tópico(s): Health Systems, Economic Evaluations, Quality of Life

2021 - Elsevier BV | American Journal of Preventive Medicine

Artigo Acesso aberto Revisado por pares

Christine D. Jones, Kathryn H. Bowles,

... and a related loss in revenue.3Shang J. Chastain A.M. Perera U.G.E. et al. ... HHAs conducted by Shang and colleagues.3Shang J. Chastain A.M. Perera U.G.E. et al. ... layoffs for HHC nurses and therapists.3Shang J. Chastain A.M. Perera U.G.E. et al. ... increased telehealth usage during this time.3Shang J. Chastain A.M. Perera U.G.E. et al. ...

Tópico(s): COVID-19 and healthcare impacts

2020 - Elsevier BV | Journal of the American Medical Directors Association

Artigo Revisado por pares

Michael J. Maloni, Robert C. Paul,

... Coles College of Business, Kennesaw State University, 1000 Chastain Road, Kennesaw, GA 30144, e-mail: mmaloni@kennesaw. ... of Science and Mathematics, Kennesaw State University, 1000 Chastain Road, Kennesaw, GA 30144, e-mail: rpaul@kennesaw. ... Coles College of Business, Kennesaw State University, 1000 Chastain Road, Kennesaw, GA 30144, e-mail: mmaloni@kennesaw. ... of Science and Mathematics, Kennesaw State University, 1000 Chastain Road, Kennesaw, GA 30144, e-mail: rpaul@kennesaw. ...

Tópico(s): Sustainability in Higher Education

2011 - Wiley | Decision Sciences Journal of Innovative Education

Artigo Revisado por pares

Satya S. Chakravorty, Richard M. Franza,

... Coles College of Business, Kennesaw State University, 1000 Chastain Rd., Kennesaw, GA 30144-5591, e-mail: satya_ ... Coles College of Business, Kennesaw State University, 1000 Chastain Rd., Kennesaw, GA 30144-5591, e-mail: satya_ ... Coles College of Business, Kennesaw State University, 1000 Chastain Rd., Kennesaw, GA 30144-5591, e-mail: satya_ ... Coles College of Business, Kennesaw State University, 1000 Chastain Rd., Kennesaw, GA 30144-5591, e-mail: satya_ ...

Tópico(s): Operations Management Techniques

2005 - Wiley | Decision Sciences Journal of Innovative Education

Artigo Acesso aberto Revisado por pares

Pei-Wen Chiang, Lauren E. Carpenter, Paul J. Hagerman,

... B. Blonden L.A.I. Riggins G.J. Chastain J.L. et al.Cell. 1991; 65: 905- ... al. (12Feng Y. Zhang F. Lokey L.K. Chastain J.L. Lakkis L. Eberhart D. Warren S. ... B. Blonden L.A.I. Riggins G.J. Chastain J.L. et al.Cell. 1991; 65: 905- ... Scholar, 12Feng Y. Zhang F. Lokey L.K. Chastain J.L. Lakkis L. Eberhart D. Warren S. ...

Tópico(s): RNA regulation and disease

2001 - Elsevier BV | Journal of Biological Chemistry

Artigo Revisado por pares

Christoph Adami,

... algorithm (MWUA; Arora et al., 2012; see also Chastain et al., 2014). This is not a new ... algorithm is fairly simple (Arora et al., 2012; Chastain et al., 2014). Suppose that at time point ... ln(n)/T is a good trade-off (Chastain et al., 2014).This learning algorithm is easy ...

Tópico(s): Cognitive Science and Mapping

2023 - The MIT Press | Artificial Life

Carta Acesso aberto Revisado por pares

Penghui Wei, Wenyuan Lyu, Tiantian Wan, Qiang Zheng, Wenxi Tang, Jian‐Jun Li, Jianjun Yang,

... in the CNS than other coronaviruses.9Amruta N. Chastain W.H. Paz M. et al.SARS-CoV- ... 305Crossref PubMed Scopus (73) Google Scholar,9Amruta N. Chastain W.H. Paz M. et al.SARS-CoV- ... increases SARS-CoV-2-mediated neuroinflammation.9Amruta N. Chastain W.H. Paz M. et al.SARS-CoV- ...

Tópico(s): Cardiac, Anesthesia and Surgical Outcomes

2021 - Elsevier BV | British Journal of Anaesthesia

Artigo Acesso aberto Revisado por pares

Jingsong Yang, Michael A. Trakselis, Rosa Maria Roccasecca, Stephen J. Benkovic,

... of the Okazaki fragment synthesis (38.Lee J. Chastain II, P.D. Griffith J.D. Richardson C. ... PubMed Scopus (54) Google Scholar, 43.Lee J. Chastain II, P.D. Kusakabe T. Griffith J.D. ... PubMed Scopus (54) Google Scholar, 43.Lee J. Chastain II, P.D. Kusakabe T. Griffith J.D. ...

Tópico(s): Bacteriophages and microbial interactions

2003 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Donald E. Johnson, Charles C. Richardson,

... Cell. 1994; 77: 157-166Google Scholar, 16Lee J. Chastain II, P.D. Kuskabe T. Griffith J.D. ... Cell. 1994; 77: 157-166Google Scholar, 16Lee J. Chastain II, P.D. Kuskabe T. Griffith J.D. ... Cell. 1994; 77: 157-166Google Scholar, 16Lee J. Chastain II, P.D. Kuskabe T. Griffith J.D. ...

Tópico(s): Bacteriophages and microbial interactions

2003 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Michael A. Trakselis, Rosa Maria Roccasecca, Jingsong Yang, Ann M. Valentine, Stephen J. Benkovic,

... from the Escherichia coli host (14.Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson ... alter the Okazaki fragment size (14.Lee J. Chastain P.D. Kusakabe T. Griffith J.D. Richardson ... polymerase after priming by gp4 (15.Lee J. Chastain P.D. Griffith J.D. Richardson C.C. ...

Tópico(s): Protein Structure and Dynamics

2003 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Lisa F. Rezende, Smaranda Willcox, Jack D. Griffith, Charles C. Richardson,

... PDF PubMed Scopus (44) Google Scholar, 12Lee J. Chastain 2nd, P.D. Kusakabe T. Griffith J.D. ... Full Text PDF PubMed Google Scholar, 12Lee J. Chastain 2nd, P.D. Kusakabe T. Griffith J.D. ... lagging strand DNA synthesis in vitro (12Lee J. Chastain 2nd, P.D. Kusakabe T. Griffith J.D. ...

Tópico(s): Bacteriophages and microbial interactions

2003 - Elsevier BV | Journal of Biological Chemistry

Artigo Revisado por pares

Kenneth Chastain,

... to Instructor-Identified Student Second-Language Errors KENNETH CHASTAIN, Search for more papers by this author KENNETH CHASTAIN, Search for more papers by this author First ...

Tópico(s): Second Language Learning and Teaching

1980 - Wiley | Modern Language Journal

Artigo Revisado por pares

Kenneth Chastain,

... Native Speaker Evaluation of Student Composition Errors Kenneth Chastain, Kenneth ChastainSearch for more papers by this author Kenneth Chastain, Kenneth ChastainSearch for more papers by this author ...

Tópico(s): Multilingual Education and Policy

1981 - Wiley | Modern Language Journal

Artigo Acesso aberto

MaryLou Cheal, Garvin Chastain,

... central precue, even though it is presented peripherally (Chastain, 1996; Chastain & Cheal, in press). Five experiments were conducted to ...

Tópico(s): Neural and Behavioral Psychology Studies

1998 - Springer Science+Business Media | Perception & Psychophysics