Tony Rushton, Sue Straw, Andrew Robson, Jon Ashworth, Cath Urquhart, Terry Pratchett, Matthew Bannister, Ian Woodburn, Portia Colwell, Helen Daniel, Andrew Pierce, James Moore, Sarah Potter, Maggie Alderson, Barbara Segall, Jane MacQuitty, Simon Barnes, Joyce Bramley, David Copestake, Magnus Linklater, Paul Hoggart, jonathan meades, Gail Robinson, Richard Hobson, Martin Richards, Emma Haughton, Malcolm Pheasey, Ivo Tennant, Michael Evans Defence Editor, Spiro James, Birna Helgadottir, Philip Howard, Michael Schumacher, Hannah Betts, Helen Speed, Pam Shriver, David Chater, Ronald Grierson, Jeremy Kingston, Barry Turner, James Bone, Bruce Dear, Brian Pedley, Alison Kervin, Gabrielle Starkey, E. Jane Dickson, GS, Clare Montagu, Jeremy Whittle, John Neimer, Raymond Snoddy, Clare Stewart, Thunderer, Giles Coren, John Thicknesse, Antonia Senior, Martin Fletcher, Pat Gibson, Valerie Elliott Countryside Editor, David McVay, Martin Barrow Deputy Business Editor, Venora Bennett, Vanessa Berridge, Henry Harris, John Clarke, Steve Keenan, Thrasy Petropoulos, Anita McNaught, Stewart Tendler Crime Correspondent, David Bayliss, Melanie Tringham, Steve Bird, Ruth Gledhill, Keith P. Mitchell, Mark Relf, Victoria Segal, Andrew Brookes, Alix Ramsay Tennis Correspondent, Jill Dupleix, Tim Reid, Ian Cobain and Helen Studd, Grainne Gilmore, Ruth Gledhill Religion Correspondent, Dalya Alberge Arts Correspondent, Martin Barrow, Candida Crewe, Jo Morris, Robin Young, Alan Hamilton, Mike Rosewell Rowing Correspondent, Nicholas Roe, Andy Stephens, Peter Millar, Rodney Milnes, Dearb?il Jordan, Alice Lagnado, JK, Sam Lister and John Goodbody, James Landale Political Correspondent, David Hands, Charles Bremner, John Cashin, Russell Kempson and Matt Dickinson, Tim Teeman, Mark Court, Clive Mathieson Telecoms Correspondent, Caroline Merrell Banking Correspondent, Derwent May, James Doran City Correspondent, Angela Jameson, Micheal Bracewell, Malcolm Smith, Ivan Hewett, John Langley, John Fazackerley, Mary Gold, Ed Potton, Stephen Anderton, Amber Cowan, Sarah Johnson, David Meredith, TW, Mark Atherton, Rick Broadbent, Tom Baldwin, Jill Sherman Whitehall Editor, Paul Myles, David Neil, Mr Ogilvy, Simon de Bruxelles, Geoffrey Dean, Rob Wright, Sarah Turner, Andrew Goodrick-Clarke, Financial Editor, Raymond Keene, David Willoughby, D. A. P. Saunders-Davies, Lewis Smith, Matthew Pryor, Christopher Walker Ireland Correspondent, Clive Mathieson, Lucy Pinney, James Allcock, Jesse Crosse, Jo Morris and Sarah Turner, Barry Grieve, Deborah Brett, Oliver Holt, Helen Nugent, Michael Strutt, Christopher Martin-Jenkins Chief Cricket Correspondent, Cesaria Evora, Mick Hume, Marcel Berlins, peter marlow, mariette pathy allen, Oliver August, Nick Hasell, Michael Dynes Africa Correspondent and Craig Lord, David Hands Rugby Correspondent, Moya Sayer-Jones, James Collard, Julian Muscat, Gerald Cass, Sylvie Simmons, Nick Szczepanik, John Goodbody, Dominic Kennedy, Anne Ashworth, James Doran, william feaver, Sian Morgan, Mel Webb, Robert J. Williams, Matthew Parris, Jennai Cox, Angus Clarke, joanna coles, Michael Longhurst, Chris McGrath, Tim Wapshott, Russell Jenkins, Glen Owen Education Correspondent, Michael Austin, Alan Hamilton and Andrew Pierce, Diana M. James, Jane Owen, Alister Johnston, DC, Lea Paterson Economics Editor, Garfield Rutherford, Tony Dawe, John Mair, Richard Gollin, Alan Jenkins, Ben Macintyre, Dr J. D. Brazier, Richard Miles, John Naish, Simon Jenkins, David J. Starkey, Graham Searjeant, Annabelle Thorpe, Robert Altman, Perry Cleveland-Peck, Chris Ayres, Sue Ajax-Lewis, Danny Baker, Fran Littlewood, Mark Baldwin, Laura Peek, Ann Johnson, James Jackson, Benedict Nightingale, Angus Batey, Stephen Dalton, Jill Crawshaw, Jack Bailey, Tom Baldwin Deputy Political Editor, Fiona Beckett, Larry Rushton, John Phillips, Allan Hall, Roger Burns, Sally Patten, Barry Hyman, Will Hide, John Barclay, Nicholas Kenyon, Sally Patten Retail Correspondent, Catherine Riley Motoring Editor, Christopher Irvine, Damian Barr, Susan Emmett,
... choice: Felix da Housecat Kittenz and Thee Glitz D12 Devil's Night(Shaddy/Interscope) 1001 ?14.99 ...
2001 - Gale Group | TDA
S Carrel, Stefania Salvi, Patrick Isler, Christophe Rapin, Daniel Hayoz, Philippe Gallay, Laura Giuffrè,
We describe an activation Ag Me14/D12 that appears early after T cell activation and is absent in resting T lymphocytes. Me14/D12 is a nondisulfide-linked heterodimeric structure containing two ... and 38,000 Da. The expression of Me14/D12 on resting T lymphocytes can be induced by ... CD3 mAb. The induction of mRNA for Me14/D12 (gp33-38) in PHA-activated T lymphocytes precedes ... gene transcripts by more than 20 h. Me14/D12 mRNA was detectable as early as 2 h ... after 24 h. The surface expression of Me14/D12 was detectable between 12 and 24 h after ...
Tópico(s): Immune Cell Function and Interaction
1990 - American Association of Immunologists | The Journal of Immunology
Andrew Robson, Den Dover, Robert Goodwill, Jon Ashworth, Matthew Bannister, DJM, David Brown, Andrew Connell, Zahid Hussain, Grace Bradberry, Sarah Potter, Simon Barnes, Paul Hoggart, Richard Hobson, David Rhys Jones, Nirj Deva, Philip Howard, Hilary Finch, David Chater, Alexandra Frean Social Affairs Correspondent, Edward Welsh, Richard Frith, Richard Irving, Melissa Kite Political Correspondent and Martin Fletcher European Correspondent, Kevin Eason, Geoff Brown, Raymond Snoddy, John Thicknesse, David Mellor Chief Secretary, David McVay, Iain Duncan Smith, Geoffrey Nowell-Smith, Donald Hutera, B. Human, Stewart Tendler Crime Correspondent, Dominic Walsh, Jason Ogelman, Andrew Oswald, Alix Ramsay Tennis Correspondent, Ross Dunn, Nigel ? Brassard, Alan Hamilton, Mike Rosewell Rowing Correspondent, S. M. Philp, Jenny MacArthur, Robin Pittman, Miranda Ingram, Jim Ward, David Hands, Charles Bremner, Roger Helmer, Rachel Morris, Nicholas Wapshott, Patience Wheatcroft Business Editor, James Doran City Correspondent, Angela Jameson, Jasper Gerard, Russell Kempson, John Featherstone, Neil Parish, Lisa Armstrong, Matt Dickinson Football Correspondent, Mark Henderson Science Correspondent, Christopher Martin-Jenkins, Geoffrey Dean, Rob Wright, Hyder Jawad, Raymond Keene, Patrick Duffy Navy Minister, Christopher Walker Ireland Correspondent, Christine Buckley Industrial Editor, Deborah Brett, Melissa Kite, Lea Paterson Economic Agenda, Oliver Holt, Richard Owen, J. Michael Robotham, Christopher Martin-Jenkins Chief Cricket Correspondent, Roger Boyes, Jerome Pugmire, Samuel Goldwyn, David Hands Rugby Correspondent, Nigel Farage, Tom Dart, Robin Parfitt, Headmaster, William Rees-Mogg, Nick Szczepanik, Dominic Kennedy, Dearbáil Jordan, John Goodbody, Alex O'Connell, Mel Webb, Kevin McCarra, Anjana Ahuja, George Caulkin, David Green, Russell Jenkins, Caitlin Moran, Jane Owen, Walter Gammie, Lea Paterson Economics Editor, Jeremy Hart, Carl Mortished and Robin Young, Michael Dynes, Chris Ayres, Christopher Irvine, Lisa Verrico, Michael Dynes and Dominic Kennedy, Toddy Hoare, James Jackson, Daniel Rosenthal, Alan Peacock, Stephen Dalton, David Powell, Adam Howorth, Richard Morrison, Adam Sherwin, Frankle Edozien and Philip Pank, Michael Evans, Robert Mucci, Alan Lee Racing Correspondent, Robbie Millen, Edward Gorman Sailing Correspondent, Martin Callanan, Philip Pank, W. L. B. Walker,
... Lisa Verrico In the Shady POP Detroit rappers D12 drove the crowd crazy - once best mate Eminem ...
2001 - Gale Group | TDA
B. M. Rudman, Louise B. Preer, Barry Polisky, John R. Preer,
... micronuclear deletions. Although genetic analysis shows that the d12 mutant d12(-1300) is homozygous for the allele A-1300 and the mutant d12(+1) for A+1, analysis by the polymerase ... shown to change. The deficiency present in the d12 allele A-1300 was originally determined to extend ... a derivative of this strain, homozygous for the d12 allele A+1 was isolated in which the ... in crosses between a line homozygous for the d12 allele and one homozygous for the wild-type ... alleles to undergo proper processing. We find that d12 alleles act on A51 alleles in heterozygotes such ...
Tópico(s): Microbial Community Ecology and Physiology
1991 - Oxford University Press | Genetics
Andrew Robson, Gabriele Marcotti, Phil Yates, Amrit Dillon, Edward Owen, Robert Dawson Scott, Jeff Rooker Office of the Deputy Prime Minister, Djm, Peter Lansley, Paul Hoggart, Kleran Falconer, Mark Souster, Martin Richards, Richard Hobson, Ivo Tennant, Philip Howard, Nicola Woolcock and Sean O'Neill, Mark Hudson President, David Chater, James Bone, Gabrielle Starkey, James Hider, Tony Halpin and David Charter, Raymond Snoddy, Sam Lister, Lauriearle, David Thompson, Ben Webster Transport Correspondent, Pat Gibson, David McVay, Richard Morrisck, Donald Hutera, Christina McLellan, Stewart Tendler Crime Correspondent, Jennai Cox Fitness Editor, Ernie Els, Tom Bawden, Debra Craine, Shirley English, Jullan Muscat, Bill Melville, Gary Jacob, Jill Dupleix, Tim Reid, Ruth Gledhill Religion Correspondent, Phoebe Greenwood, Stephen Farrell, Robin Young, Phil Gordon, Dave Calhoun, Keith Pike, Richard Lloyd Parry, John Treble Vice President, Mike Sinclair, Ron Lewis, Mark Pougatch, David Alexander, Stefanie Marsh, David Charter, Nicholas Wapshott, Patience Wheatcroft Business Editor, Caroline Merrell Banking Correspondent, Matthew Pinsent, Simon Tait, Russell Kempson, John Ralfe, Oliver Kay, Sarah Vine, Rick Broadbent, Ayesha Hudson, Jenny Booth, Robert Freer, John Hopkins, John Hopkins Golf Correspondent, Rob Wright, Geoffrey Dean, Hannah Hennessy, Neil Harman Tennis Correspondent, Raymond Keene, Christine Buckley, Richard Miles Investment Editor, Peter Bryan, Sean O'Neill, David Hunt, Jeremy Page, Cathy Harris, Richard Owen, Catherine Lantsbery, Christopher Martin-Jenkins Chief Cricket Correspondent, Mick Hume, David Mattin, Emily Davies, David Hands Rugby Correspondent, Tony Cascarino, Tom Dart, Andrew Clennell, William Rees-Mogg, Dominic Kennedy, John Goodbody, Nick Szczepanik, James Doran, Suna Erden, King Kong, James Hider and Tim Reid, Jane Shilling, Tim Hames, Craig Lord, Ian Johns, Mel Webb, Graham Searjeant Financial Editor, George Caulkin, Walter Gammie, David Charter Chief Political Correspondent, Jack Malvern Arts Reporter, Cecilia Powell, Lewis Stuart, Jason Mellor, Paul Schoonenberg, Chris Ayres, Eric Brown, Nigel Hawkes Health Editor, William Shakespeare, Benedict Nightingale, Stephen Dalton, Dr Thomas Stuttaford, Nicola Woolcock, David Powell, Bill Edgar, Alyson Rudd, Patrick Magee, Alex O'connell, Katrine Sporle Chief Executive, Mark Venables, Ian McKinnon, Randy Cohen, Owen Slot, Christopher Jackson, Hugo Charlton, Sam Lister Health Correspondent, Lisa Verrico,
... much the boss First Choice The Sunday Times D12 Shepherds Bush Empire Dance Russell Maliphant Barbicon Exclusive! ...
2004 - Gale Group | TDA
Linda Granlund, Lene Kristine Juvet, Jan I. Pedersen, Hilde I. Nebb,
... stimulated with 5 μM CLA from D0 until D12, at which days lipid content was visualized by ... Day 0 (D0) until D11 (3T3-L1) or D12 (SGBS). The adipocytes were treated with 25 μM ... visualize lipid content on D11 (3T3-L1) and D12 (SGBS) of differentiation. B: TAG level in the cells at D11 (3T3-L1) (upper panel) and D12 (SGBS) (lower panel) of differentiation. The results are ... cells on D11 (3T3-L1) (upper panel) and D12 (SGBS) (lower panel) of differentiation. The results are ... Day 0 (D0) until D11 (3T3-L1) or D12 (SGBS). The adipocytes were treated with 25 μM ...
Tópico(s): Lipid metabolism and biosynthesis
2003 - Elsevier BV | Journal of Lipid Research
Charles Langley, Malcolm Brown, John Coleman, Barbara Hall, J B Cronin, Joan Bakewell, Richard Ellis, John Jay City Editor, John Davison, Jon Swain, Rob Hughes, John Peter, David Weeks, Hazhir Teimourian, Jonathan Miller, Jill Hartley, Sarah Miller, Christopher Smallwood Economics Editor, James Rusbridger, John Jay, Karen Cure, Willy Russell, Nick Rufford, John Diamond, Neville Hodgkinson Medical Correspondent, Graham Rose, Norman Howell, John Barham, A P Jobson, G U Rands, Alistair Scott, Elizabeth Bartlett, Sally Payne, Stephen Milligan, Jo Revill, Jason Tomas, Cal McCrystal, Ludovic Kennedy, Edward Welsh, Carol Sarler, Stephen Hall, Caroline St John-Brooks, Nicholas Crane, John Westwell, Caroline Baker, Jon Craig, Geordie Greig, Neville Hodgkinson, Patrick Stoddart, Susan Marling, Lyn Appleton, Robert Sandall, Leslie Geddes Brown, Iain Johnstone, Lis Leigh, Barry Humphries, David Brierley, John Sturrock, Irwin Stelzer, R Baxter, Peter Godwin, Robert Hewison, Anat Arkin, Deryk Brown, Ivan Fallon, David Dougill, Mark Ottaway, Dymphna Byrne, Cliff Temple, Sally Vincent, Joy Nelson, Christine Walker, Stan Hibbert Assistant General Secretary, John Witherow, Elizabeth Foley, Justine Picardie, Russell Harty, Susan Crosland, David Cairns, David Goldsmith, Peter Kemp, Norman Harris, Anne Jacobs, Frederic Rephael, Paul Eddy, Geoff Whitten, Michael Jones, George Perry, John Cassidy, Arnold Wilson, C. Maslanka, Bernard Cafferty, K Harrap, James Adams, Graham Jenkins, Austin MacCurtain, David Leppard, Tim Rayment, Mazher Mahmood, Moria Billinge, Elizabeth Grice, Tavleen Singh, David Lawrenson, James Young, Alan MacKie, Brian Walden, Eric Bishop, Peter Wilsher, Gareth David, Simon Freeman, Richard Cook, Marie Colvin, Craig Brown, Diana Wright, Christopher Smallwood, Stephen Jones, Sally Brampton, Michel Syrett, Brian Deer, Peter John, Bryan Gould Mp, Malcolm Turnbull, Richard Palmer, Don McCullin, Patrick Rowley, Anne Byrnes, Bruce Kemble Education Correspondent, Dilys Powell, Frederick C Copleston, Charles Oulton Religious Affairs Correspondent, Brough Scott, Richard Woods, Clive Everton, W Baldwin Fletcher, David Profumo, Max Prangnell, Iola Smith, Felix Aprahamian, David Hughes Political Correspondent, Brian MacArthur, Michael Jones Political Editor, John Harrison, Roger Clarke, Margaret Drabble, Rick Jolly, Steve Tongue, Simon Callow, Philip Beresford, Dr Carl Bridge, Sarah Myint, Brian Clarke, Brian Glanville, Angus Roxburgh, John Carey, Peter Bottomley, Steve Wright, Edward Pearce, David Sinclair, Simon Jenkins, Godfrey Golzen, Deirdre Fernand, David Wickers, Ian Williams, Jean Overton Fuller, Hugo Sabogal, Richard Lander, Valerie Grove, Paul Pickering, Marina Vaizey, Marta Wöhrle, Gill Weston, Margaret Park, Angela Long, Angela Long Innovation Editor, Dorothy Wade, Jim Kelly, Tony Hetherington, David Roberts Director, Peter Roebuck, James Neilson, Joanna Simon, Samuel Hynes, Mickey's Empire, Guy Williams, Boris Schapiro,
... Link Management Selection Appointments Also Appear on Pages D12, D13, G13 Ogilvie Executive Personnel and Menagement Conslants ...
1988 - Gale Group | Sunday Times HA GDA
David Ho, A. Jane Bardwell, Seema Grewal, Corey Iverson, Lee Bardwell,
... TCGACTGCAAAATTCAACTTCAGTGCTTTGCGTTTACCCTGCATGCTGpGEX-MKK4-DsMKK7D1mutForGAGAACCGGGAGGCCGAGGAGGAGATCGACGCCAACGCGGATATCAGCCCGCAGCGGCCCAGGpGEX-MKK7 D1 mutants, pcDNA-MKK7-D12-FLAGMKK7D1mutRevCCTGGGCCGCTCGGGCTGATATCCGCGTTGGCGTCGATCTCCTCCTCGGCCTCCCGGTTCTCpGEX-MKK7 D1 mutants, pcDNA-MKK7-D12-FLAGMKK7D2mutForCCTCAACCTGGATATCAGCCCGCAGGAGCCCGAGCCCACCGCGCAGGCCCGGCTGGCCAACGATGGGpGEX-MKK7 D2 mutants pcDNA-MKK7-D12-FLAGMKK7D2mutRevCCCATCGTTGGCCAGCCGGGCCTGCGCGGTGGGCTCGGGCTCCTGCGGGCTGATATCCAGGTTGAGGpGEX-MKK7 D2 mutants pcDNA-MKK7-D12-FLAGMKK7D3mutForCCCGCAGCACCCGACGCCACCCGCCGAGCCCGAACACATGGCGGGCCTCCCGTCAACCCTGTTCACACpGEX- ...
Tópico(s): Microbial Metabolism and Applications
2006 - Elsevier BV | Journal of Biological Chemistry
Edward Lucie-Smith, John Huxley, Kenneth McLeish, Alex Finer, Barbara Hall, Joan Bakewell, Richard Ellis, John Jay City Editor, Shena MacKay, John Davison, Catherine Bennett, George Levy Director, Peter Gillman, Royston Webb Legal Director, John Peter, S Webb-Jones Aids Advisor, Jonathan Miller, Eric Dymock, Sarah Miller, Jill Hartley, John Jay, Peter Harland, Dr J Turner, Michael Graham, John Diamond, Neville Hodgkinson Medical Correspondent, John Stansell, Nicolette Jones, Diana Wright Personal Finance Editor, Robert Burchfield, Ian Williams Business Correspondent, Stephen Milligan, Adam Nicolson, Frederic Raphael, Jo Revill, Cal McCrystal, Mark Hosenball, Caroline St John-Brooks, Richard Eaton, Caroline Baker, Jon Craig, Geordie Greig, Patrick Stoddart, Judi Bevan Deputy City Editor, Susan Marling, Kevin Mitchell, Robert Sandall, Iain Johnstone, David Brierley, Irwin Stelzer, John Newell, Adrian Furnham, Peter Godwin, Ivan Fallon, Robert Hewison, David Dougill, Kenneth R Lake, Cliff Temple, Jane Bird, Norman McLeod, Philip Beresford Industrial Editor, Ned Sherrin's, Robin Hamilton, Hugh Ap Simon, Maria Laura Avignolo, Matthew Hamilton, Sally Brampton Editor, James McKay, Egon Ronay, J Atwell, Norman Harris, Jeanette Winterson, Geoff Whitten, Sue Mott, John Cassidy, Robin Marlar, Michael Clark, Charlotte Atkins, Bernard Cafferty, Lesley Abdela, Marie Colvin Middle East Correspondent, Paul Donovan, James Power, Geordie Grieg, Janette Marshall, Sally Courtis, Roger Hall, Jeff Randall, Paul Driver, Austin MacCurtain, David Leppard, Tim Rayment, Elle, Lois Mellor, Marina Valzey, Elizabeth Grice, Derek Jameson, John Hopkins, Judi Bevan, Brian Walden, (The Revd) Alan Tanner, Gareth David, M J Aldeen, Jonathan Gibson, David Robson, Gerry Gorman, Simon Freeman, Stephen Pile, Paul Brown, Jonathan Mille, Malcolm Winton, Marie Colvin, Craig Brown, Diana Wright, B T Jeeves, Hal Rubinstein, Chris Partridge, Phillip Beresford, Richard Palmer, Frank Hamilton Director, Andrew Grice, Lord Plumb, Patrick Rowley, R Ransford, Dilys Powell, Ben Pimlott, Brough Scott, Elizabeth Meugens, Richard Woods, George Ace, Maurice Chittenden, Barrie Penrose, Ian Dunning, Felix Aprahamian, Ray Mgadzah, Julia Berney, Kamran Khan, Michael Jones Political Editor, Rick Sanders, Philip Beresford, Sue Thomas, Roy Greenslade, Brian Glanville, Angus Roxburgh, Bill Martin, Edward Pearce, Nadine Meisner, Wayne Turnbull, Simon Jenkins, Caroline Silver, Godfrey Golzen, Martin Scorsese, Peter Inston, Hamilton Bland, Ian Williams, Caroline Moore, W Grey, Rosemary Collins, Margaret Park, Tony Hetherington, Hilary Rubinstein, Richard Nixon, Joanna Simon, Boris Schapiro, Mark Brennan, Mark Wallington,
... Advertising Items Motors continue on D6, D8, D11, D12 and D13 Rolls-Royce Frank Dale & Stepsons Saab ...
1988 - Gale Group | Sunday Times HA GDA
Evgeniy V. Petrotchenko, В. К. Ольховик, Christoph H. Borchers,
... an isotopically coded ethylene glycol bis(succinimidylsuccinate) derivate (D12-EGS), which contains 12 deuterium atoms for easy ... an isotopically coded ethylene glycol bis(succinimidylsuccinate) derivate (D12-EGS), which contains 12 deuterium atoms for easy ... we have used a custom-synthesized cross-linker, D12-ethylene glycol bis(sulfosuccinimidylsuccinate) (D12-EGS), 1The abbreviations used are: D12-EGS, D12-ethylene glycol bis(sulfosuccinimidylsuccinate); HIV, human immunodeficiency virus; RT, reverse transcriptase. 1The abbreviations used are: D12-EGS, D12-ethylene glycol bis(sulfosuccinimidylsuccinate); HIV, human ...
Tópico(s): Enzyme Structure and Function
2005 - Elsevier BV | Molecular & Cellular Proteomics
Akiko Okumura, Kiyotaka Hatsuzawa, Taku Tamura, Hisao Nagaya, Kazuko Saeki, Fumihiko Okumura, Kenji Nagao, Mitsuo Nishikawa, Akihiko Yoshimura, Ikuo Wada,
... this study, we describe the molecular properties of D12, which was identified from a mouse expression library. ... recently identified human syntaxin 18-binding protein, p31. D12 formed a tight complex with syntaxin 18 as ... Sec22b and bound to α-SNAP, indicating that D12 is a SNARE protein. Although the majority of D12 is located in the endoplasmic reticulum and endoplasmic ... compartments at steady state, overexpression or knockdown of D12 had no obvious effects on membrane trafficking in the early secretory pathway. However, suppression of D12 expression caused rapid appearance of lipofuscin granules, accompanied ...
Tópico(s): Calcium signaling and nucleotide metabolism
2005 - Elsevier BV | Journal of Biological Chemistry
Narumol Jariyasopit, Melissa L. McIntosh, Kathryn Zimmermann, Janet Arey, Roger Atkinson, Paul Ha‐Yeon Cheong, Rich G. Carter, Tianwei Yu, Roderick H. Dashwood, Staci L. Massey Simonich,
The heterogeneous reactions of benzo[a]pyrene-d12 (BaP-d12), benzo[k]fluoranthene-d12 (BkF-d12), benzo[ghi]perylene-d12 (BghiP-d12), dibenzo[a,i]pyrene-d14 (DaiP-d14), and dibenzo[ ... agents in transforming PAHs to NPAHs, with BaP-d12 being the most readily nitrated. Reaction of BaP-d12, BkF-d12, and BghiP-d12 with NO2 and NO3/N2O5 resulted in the ...
Tópico(s): Toxic Organic Pollutants Impact
2013 - American Chemical Society | Environmental Science & Technology
... co-expressing ErbB-1 with either ErbB-2 (D12 cells), or with ErbB-3 (D13 cells) (Pinkas- ... basal proliferation rate of the resulting cell line, D12, in agreement with previous reports (Kokai et al., ... only a 2-fold activation was displayed by D12 cells. Interestingly, however, co-expression of ErbB-2 together with ErbB-1 (D12 cells) resulted in remarkable potentiation of the mitogenic ... 7 ng/ml was necessary to stimulate the D12 cells (Figure 1A, compare D1 with D12 panels). In contrast, ErbB-2 co-expression only ...
Tópico(s): Cell Adhesion Molecules Research
1998 - Springer Nature | The EMBO Journal
Katarina Butorac, Jasna Novak, Barbara Bellich, Lucrecia C. Terán, Martina Banić, Andreja Leboš Pavunc, Slaven Zjalić, Paola Cescutti, Jagoda Šušković, Blaženka Kos,
Abstract Lactobacillus (Limosilactobacillus) fermentum D12 is an exopolysaccharide (EPS) producing strain whose genome contains a putative eps operon . Whole-genome analysis of D12 was performed to disclose the essential genes correlated ... an additional 2% w/v glucose, L. fermentum D12 secreted up to 200 mg/L of a ... to evaluate the functional potential of L. fermentum D12. Strain D12 survived simulated gastrointestinal tract (GIT) conditions, exhibited antibacterial ... vivo functionality. The EPS crude extract positively influenced D12 strain capacity to survive during freeze-drying and ...
Tópico(s): Gut microbiota and health
2021 - BioMed Central | Microbial Cell Factories
Ananya Mukundan, Chang‐Hyeock Byeon, Cynthia S. Hinck, Kyle T. Cunningham, Tiffany Campion, Danielle J. Smyth, Rick M. Maizels, Andrew P. Hinck,
... kinetic analysis of a single injection series.TβRITGM-D12(6.7 ± 0.1) × 104(1.6 ± 0. ... used for TβRI:TGM-D2 and TβRI:TGM-D12.TGM-FL(5.9 ± 0.1) × 104(7. ... used for TβRI:TGM-D2 and TβRI:TGM-D12. Open table in a new tab TGM-D3' ... both TGM-D1 and TGM-D2, designated TGM-D12, to TβRI and TβRII using SPR. This didomain ... KD derived from kinetic analysis of the TGM-D12:TβRI sensorgrams was 24 nM, which is within ... the SPR results, titration of TGM-D2, TGM-D12, and TGM-FL into TβRI and TGM-D3 ... the fitted KD values for binding of TGM-D12 to TβRI and TGM-D3 to TβRII were ...
Tópico(s): Coagulation, Bradykinin, Polyphosphates, and Angioedema
2022 - Elsevier BV | Journal of Biological Chemistry
Roger E. Gerkin, Arthur M. Winer,
... paramagnetic resonance absorptions by phosphorescent chrysene-h12 and -d12 in single crystals of p-terphenyl-h14 and - ... splittings of the lowest triplet state of chrysene-d12 have been determined very precisely in experiments at ... for the twenty resonance absorptions observed for chrysene-d12 in p-terphenyl (at ·0.116, 0.063, ... species. Only six absorptions were observed for chrysene-d12 in OHA, and these could be correlated into ... 26 resonance absorptions observed arise solely from chrysene-d12 and not (in part) from impurities. For p- ...
Tópico(s): Photochemistry and Electron Transfer Studies
1972 - American Institute of Physics | The Journal of Chemical Physics
... effect independent of the pituitary after day 12 (D12) of pregnancy in the rat, when the pituitary ... was begun immediately after hypophysectomy (hypx) on either D12 or D13 of pregnancy and was continued until ... by resorbing fetal sites) in 19% of the D12 hypophysectomized (hypx) control rats and 0% of the ... pregnancy in 87% and 94%, respectively, of the D12 hypx rats and in 79% and 100%, respectively, ... not significantly different in control rats hypx on D12 or D13 from intact controls (811 ± 75, 799 ± ... 92 ng/ml) in 35–50% of the D12 and D12 hypx animals receiving LHRH and in ...
Tópico(s): Water Quality and Resources Studies
1981 - Oxford University Press | Endocrinology
Robert P. Chapuis, Michel Aubertin,
... D10] can be found in Dullien (1992). Equation [D12] is similar to the Seelheim (1880) equation. It ... research has moved from the concept of eq. [D12] towards eq. [1], in a direction opposite to ... and partly empirical) solution to the conceptual eq. [D12], which can in principle be applied to any type of soil. The discusser nevertheless prefers eq. [D12] to eq. [1]. The authors can understand why ... not share this preference, being aware that eq. [D12], which can work for artificial one-size media ... 1997) still refer to equations similar to eq. [D12] as the “Kozeny-Carmen” equation, but do not ...
Tópico(s): Soil and Unsaturated Flow
2004 - NRC Research Press | Canadian Geotechnical Journal
Lanlan Li, Jing Zheng, Xi Wu, Hui Jiang,
... Remarkably, Msp1 recognizes this feature through the acidic D12 residue in its IMS domain. This dual-recognition ... their mistargeting and are recognized by the Msp1 D12 residue through electrostatic interactions. Introduction Mitochondria are essential ... and most of them are evolutionarily conserved. Notably, D12 is lost in the Msp1TOM70(N) mutant. Click ... ID: 5W0T) and hexameric structures 21 (Fig 1E): D12 is a negatively charged residue in the inter- ... by Msp1 Degradation of GFP-Pex15Δ30 by Msp1 D12 mutants. Schematic illustration of the Outer mitochondrial membrane ...
Tópico(s): Mitochondrial Function and Pathology
2019 - Springer Nature | EMBO Reports
... msec) at spinal segments S1–S3, under the D12 spine. This entry time coincided with the onset ... large voltage of the spinal response at the D12 spine probably results from summation of N21 with ... SEP to median nerve stimulation. Spinal conduction between D12-C7 spines was spuriously overestimated because the true ... P21 is synchronous with the N21 at the D12 spine and reflects the initial volley in the ... S1–S3, sous l'épine de la vertèbre D12. Ce moment d'entrée correspond au début de ... médian. Le grand voltage de la réponse en D12 résulte de la sommation du N21 avec un ...
Tópico(s): Transcranial Magnetic Stimulation Studies
1983 - Elsevier BV | Electroencephalography and Clinical Neurophysiology
... brain cuts from animals entrained on a L12:D12 cycle and dissected at the indicated circadian times ( ... or knock-out mice entrained on a L12:D12 cycle and dissected at the indicated circadian times ( ... brain cuts from animals entrained on a L12:D12 cycle. At CT14 on the third day in ... of light and 12 h of darkness (L12:D12 or LD), before being put in constant darkness ( ... the SCN in mice entrained under a L12:D12 cycle and then placed in DD for 2 ... the SCN, mice were entrained on a L12:D12 cycle and, after being placed in DD, a ...
Tópico(s): Sleep and Wakefulness Research
2001 - Springer Nature | The EMBO Journal
... the cellular protein was undetectable when mutant viruses D12 and E52X were used (Figure 5B). Viruses D12 and E52X have deletions which remove Vmw110 codons ... HeLa cells or cells infected with viruses 17+, D12 or E52X as indicated. The samples were Western ... 11060 showed that wild-type, but not mutant D12 or E52X Vmw110, was co-precipitated with HAUSP ( ... some r29 immunoprecipitation experiments, trace amounts of mutant D12 Vmw110 were detected (data not shown, but it ... or the r29 antibodies stabilize a weak HAUSP–D12 interaction. This result suggests that the Vmw110 sequences ...
Tópico(s): Cutaneous lymphoproliferative disorders research
1997 - Springer Nature | The EMBO Journal
... the cellular protein was undetectable when mutant viruses D12 and E52X were used (Figure 5B). Viruses D12 and E52X have deletions which remove Vmw110 codons ... HeLa cells or cells infected with viruses 17+, D12 or E52X as indicated. The samples were Western ... 11060 showed that wild-type, but not mutant D12 or E52X Vmw110, was co-precipitated with HAUSP ( ... some r29 immunoprecipitation experiments, trace amounts of mutant D12 Vmw110 were detected (data not shown, but it ... or the r29 antibodies stabilize a weak HAUSP–D12 interaction. This result suggests that the Vmw110 sequences ...
Tópico(s): Virus-based gene therapy research
1997 - Springer Nature | The EMBO Journal
Thomas Schmidt‐Rose, Thomas J. Jentsch,
... was tolerated in "split" channels. Membrane domains D9–D12 can insert into the membrane without adding a ... was tolerated in "split" channels. Membrane domains D9–D12 can insert into the membrane without adding a ... Fig. 1, top). The topology of the D9–D12 region, a long hydrophobic stretch interrupted only once ... 4). Replacing lysine 585 at the end of D12 with glutamate leads to channels deactivating more slowly ... D1–D8, a central one containing the D9–D12 block and part of the cytoplasmic carboxyl terminus, ...
Tópico(s): Glycogen Storage Diseases and Myoclonus
1997 - Elsevier BV | Journal of Biological Chemistry
Sumiko Kobayashi, Sadaaki Koizumi,
ABSTRACT. Mutant strain d48 and d12 cannot express serotype A. In d48, the A i‐antigen gene is present in the micronucleus, but not in the macronucleus. It has recently been shown that d12 contains the A gene in its micronucleus, but ... type 51 enucleated cells into which were transplanted d12 micronuclei could not express A. Amiccronucleate d12 cells into which were transplanted normal micronuclei from ... results show that even if the micronucleus of d12 contains the A gene, it must be abnormal, ... as d48. Genetic analysis showed that heterozygote of d12 and wild type 51 or d48 caused a ...
Tópico(s): Plant and fungal interactions
1990 - Wiley | The Journal of Protozoology
Jinkyung Jung, Mu‐Shik Jhon, Francis H. Ree,
... equal diameter d, having an unequal collision diameter d12 between unlike species, favors a hetercoordinated arrangement if d12 lies between 0.65d and d, and a homocoordinated packing below d12=0.65d. At d12<0.65d, hard spheres of one type ... MC) simulations over large ranges of density and d12 and originates in the fact that collisions between ... prevent collisions of unlike-species at shorter distance d12<d. The observed shift of hetero- to ... MC data suggest a fluid phase separation at d12≳d.
Tópico(s): Thermodynamic properties of mixtures
1994 - American Institute of Physics | The Journal of Chemical Physics
B.E.H. Sumner, Richard B. D’Eath, Mark J. Farnworth, Sheena K. Robson, John A. Russell, A.B. Lawrence, Susan Jarvis,
... three different ages (12, 21 and 42 days; d12, d21, d42). Pigs were habituated to an open ... subsequent days (days 77–79). Early-weaned pigs (d12) showed behavioural inhibition (reduced vocalisations and lower activity) ... reflect more rapid habituation to the test in d12 pigs. Long-term effects on mood-related 5- ... 90 days in a random sample of the d12 (n = 8) and d42 pigs (n = 8), using ... receptor antagonist) to any brain region studied. In d12 pigs, 5-HT1A receptor mRNA expression per unit ... in the pars horizontalis of the PVN in d12 pigs. Conversely, 5-HT2A receptor mRNA was expressed ...
Tópico(s): Stress Responses and Cortisol
2008 - Elsevier BV | Psychoneuroendocrinology
Nathan T. Balcom, Britta Berg‐Johansen, Kristin J. Dills, Jennifer R. Van Donk, Gregory M. Williams, Albert C. Chen, Scott J. Hazelwood, Robert L. Sah, Stephen M. Klisch,
... 1 (D6 IGF), 12 days with IGF-1 (D12 IGF), or 6 days with IGF-1 followed by 6 days with TGF-β1 (D12 SEQ, i.e., sequential). Following treatment, all specimens ... biochemical, and compressive mechanical properties. Relative to D0, D12 SEQ treatment enhanced volumetric growth, but to a lower value than that for D12 IGF. Furthermore, D12 SEQ treatment maintained compressive moduli and Poisson's ... values higher and lower, respectively, than those for D12 IGF. Considering the previously described effects of 12 ...
Tópico(s): Lower Extremity Biomechanics and Pathologies
2012 - ASM International | Journal of Biomechanical Engineering
Patricia A. Labosky, Michael P. Weir, Laura Grabel,
... 4), B2 (2.8), C8 (3.1), and D12 (4.7). Whole mount in situ hybridization analysis, ... transcripts, suggests a possible role for the Hox-D12 gene during endoderm differentiation in F9 EBs. Whereas ... genes are essentially uniform throughout the aggregates, Hox-D12 expression is restricted to the outer surface of ... order to establish the relationship between the Hox-D12 expression pattern and the role of RA in ... show similar temporal and spatial localization of Hox-D12 when compared to F9 EBs. These data suggest ...
Tópico(s): Animal Genetics and Reproduction
1993 - Elsevier BV | Developmental Biology