Limpar
607.369 resultados

Acesso aberto

Tipo do recurso

Tipo de base de dados

Ano de criação

Produção nacional

Revisado por pares

Áreas

Idioma

Editores

Primary Document -- Manuscript Acesso aberto

Davies, Lord,

Creation of Garibaldi Corps as first step in overthrow of Fascist regime by the Italians themselves suggested by Lord Davies. Part 2. Italy. Davies, Lord. 07/01/1941. ...

1941 - Gale Group | ArchivesUnbound Western Europe

Artigo

Sian Hoe Cheong, Linda J. McCargar, Breay W. Paty, Catrine Tudor‐Locke, Rhonda C. Bell,

... eat more low–glycemic index (GI) foods (First Step First Bite Program) improved hemoglobin A1c and anthropometric and ... assigned to the First Step Program or First Step First Bite Program (n=22 in each group) and ... monitored steps per day throughout the study; First Step First Bite Program subjects also monitored daily intake of ... 01). In the First Step Program vs First Step First Bite Program groups, respectively, waist girth decreased by ... variables measured, including hemoglobin A1c. Both the First Step First Bite Program and First Step Program resulted in ...

Tópico(s): Nutritional Studies and Diet

2009 - Elsevier BV | Journal of the American Dietetic Association

Jornais Acesso aberto

From Christopher Walker and Christopher Warman, By Our Parliamentary Correspondent, By David Wood and John Groser, By Arthur Reed Air Correspondent, From Robert Fisk, From Metin Munir, From Richard Wigg, From Denis Taylor, By a Staff Reporter, By Our Business News Staff, By Our Parliamentary Staff, By Geoffrey Wansell, By Peter Waymark, By Our Social Services Correspondent, Stephen Jessel, By Our Education Correspondent, By Our Labour Staff, From Our Correspondent, By Geraldine Norman Sale Room Correspondent, By Our Bridge Correspondent, From John Chartres, By Julian Mounter Motoring Correspondent, By Our Motoring Correspondent, By Philip Howard, By Our Agricultural Correspondent, House of Commons, From Charles Hargrove, From Roger Berthoud, From Fred Emery, From Michael Leapman, From Our Own Correspondent, From Michael Knipe, By Our Political Editor, By Michael Wolfers, From David Bonavia, From Our Special Correspondent, Leonard Buckley, William Mann, Charles Lewsen, Alan Blyth, Max Harrison, Keith Horner, Irving Wardle, By Peter West Rugby Correspondent, By Jim Railton, By Gerry Harrison, By Neil Allen Athletics Correspondent, From Rex Bellamy Tennis Correspondent, By Jim Snow Northern Racing Correspondent, By Neil Allen Boxing Correspondent, Stewart Harris, Louis Heren, PHS, Stewart Tendler, GEOFFREY VICKERS., P. A. REYNOLDS., PHILIP GOODHART., JOHN SELWYN GUMMER. KENNETH CLARKE., J. J. SAUNDERS., GEOFFREY BLOCK., W. S. YARDY., H. V. HODSON., V. REYNOLDS, , REENA BHAVNANI, , VERONICA PEARSON, , H. NJOKWENI, , RAY WALKER, , PETER GILPIN, , DAVID MILNER, , B. S. DHILLON, , C. S. FENTON, , R. T. OERTON., A. L. GOODHART., M. R. Smith., GLANVILLE WILLIAMS., DAVID GREEN., ALAN THOMPSON., FRANK SMITH, , W. M. NEWTE., BY PRUDENCE GLYNN, By Our Medical Correspondent., Mr Mervyn Levy, A. H., Robert Weddle, By R. W. Shakespeare, By Our Northern Industrial Correspondent, By Peter Hill, From Frank Vogl, By Ian Murray Labour Staff, By Ian Morison, By Philip Dyer, By Our Banking Correspondent, From Anthony Thomas, By Clifford Webb Midland Industrial Correspondent, Kenneth Owen, By Melvyn Westlake, BY THE FINANCIAL EDITOR, NEWTON JONES, , IRENE M. THURLBY., A. W. MORGAN, , JAMES TOWLER, , H. H. MAINPRICE., Eric Wigham, Frank Vogl, Robin Mead,

... news in Minsk. Editorials/Leaders: A Welcome First Step, First Round To President Pompidou, How To Destroy A ...

1972 - Gale Group | TDA

Artigo Acesso aberto Revisado por pares

Thomas Döring, Jan Schnellenbach,

... of growth. It discusses this topic in two steps. First, the theoretical concept of knowledge spillovers is outlined ... of growth. It discusses this topic in two steps. First, the theoretical concept of knowledge spillovers is outlined ... of growth. It discusses this topic in two steps. First, the theoretical concept of knowledge spillovers is outlined ... of growth. It discusses this topic in two steps. First, the theoretical concept of knowledge spillovers is outlined ...

Tópico(s): Economic Growth and Productivity

2006 - Routledge | Regional Studies

Primary Document Acesso aberto

Cropper, James,

Includes: Extracts from the first report of the New England Anti-Slavery Society. Book.

0000 - Gale Group | The Making of Modern World

Artigo Acesso aberto Revisado por pares

Yi Liu, Paul R. Ortiz de Montellano,

... two other factors may alter the rate-limiting step. First, the rate of binding of heme to HO- ... two other factors may alter the rate-limiting step. First, the rate of binding of heme to HO- ... two other factors may alter the rate-limiting step. First, the rate of binding of heme to HO- ...

Tópico(s): Alcohol Consumption and Health Effects

2000 - Elsevier BV | Journal of Biological Chemistry

Livro

Springer Link

Primary Document Acesso aberto

Cropper, James,

Includes: Extracts from the first report of the New England Anti-Slavery Society. Book.

0000 - Gale Group | SAS Part 1

Artigo Acesso aberto Revisado por pares

James J. Kennelly, R.S. Hoyt, R.H. Foote, R.W. Bratton,

... two-step procedure.When the terminus of the first step was --20 ° C. nearly all the spermatozoa died, ... with 75% survival when the terminus of the first step was --27 ° C. Bialy and Smith (1) reported ... Polge ( 9) indicate that the terminus of the first step should be lower when storage is to be ... undertaken to establish the optimum temperature of the first terminus in a two-step freezing procedure with subsequent storage at --85 ° C. ...

Tópico(s): Reproductive biology and impacts on aquatic species

1960 - Elsevier BV | Journal of Dairy Science

Livro

Springer Link

Jornais Acesso aberto

From HUGH NOYES, By DAVID WOOD, By Our Foreign Staff, From PAUL MARTIN, From Our Own Correspondent, From Our Correspondent, From BRIAN MacARTHUR, From ANTHONY SMITH, By GERALDINE KEEN, BY OUR LABOUR STAFF, PHILIP HOWARD, By Our Labour Staff, By a Staff Reporter, From EDWARD MORTIMER, FROM OUR CORRESPONDENT, By PETER HOPKIRK, From DESSA TREVISAN, A Special Correspondent, From JAMES RESTON, From MICHAEL HORNSBY, FROM OUR OWN CORRESPONDENT, From GEOFFREY GREEN, Football Correspondent, By ROGER MACDONALD, By PETER WEST, By PETER MARSON, By ALAN GIBSON, From REX BELLAMY, Tennis Correspondent, By RAY CAIRNS, By JOHN WOODCOCK, Cricket Correspondent, From ST. JOHN DONN-BYRNE, By Our Racing Correspondent, By Our Newmarket Correspondent, By Our Northern Correspondent, By MICHAEL PHILLIPS, Racing Correspondent, By ANDREW PORTER, From PETER RYDE, Golf Correspondent, By NEIL ALLEN, Athletics Correspondent, By JOHN NICHOLLS, By Our Political Staff, John Chartres, From RICHARD SHARPE, By Our Local Government Correspondent, Tony Aldous, From a Staff Reporter, David Wood Political Editor, Leonard Beaton, From Paul Routledge, PHS, IAN COATES., ROY MARSHALL, PETER GREEN, M. E. WYKES., CHRISTOPHER BARRY, JULIAN HUXLEY., GERALD SPARROW., KENNETH WRIGHT., ERIC DADSON., K. M. CHITTENDEN., ERIC LUBBOCK., CHARLES WHEELER., GWYN WILLIAMS., By Our Bridge Correspondent, By Nature-Times News Service, By Stanley Sadie, By Joan Chissell, By Alan Blyth, By John Percival, By John Russell Taylor, by Harriet Chare, by Penny Hunter, By LEONARD AMEY, BY OUR ASTRONOMICAL CORRESPONDENT, By BOB TROW-SMITH, By Peter Sills, By GERALD ELY, By DENNIS DWYER, By CHRISTOPHER MARLEY, Financial Editor, Frank Vogl, European Business Correspondent, From PETER STRAFFORD, By CLIVE CALLOW, By HUGH STEPHENSON, By ANTHONY ROWLEY, From ANTHONY THOMAS US Economics Correspondent, By ROSS DAVIES, By MICHAEL THOMAS, Labour Correspondent, By INNIS MACBEATH, From JOHN EARLE, MALCOLM BROWN, STRONG FINANCIAL POSITION, DAVID MILLHAM, BY THE FINANCIAL EDITOR, From FRANK VOGL, From MICHAEL WOLFERS, Africa Correspondent, RONALD KERSHAW, G. M. WILSON, PETER WEEKS, T. Q. ANNAN, J. HOSIER., PHILIP de HAVILLAND., Anthony Thomas, Anthony Vice, Edited by Robert Jones, Innis Macbeath, Ross Davies, Robert Jones, Roger Vielvoye, Joe Roeber, BERRY RITCHIE,

... Tronoh Mines, BRIEFLY FROM THE boardroom, Six take first step towards common currency, Company Meeting Compagnie Financière De ...

1970 - Gale Group | TDA

Artigo

Ivory V. Nelson, Reynold T. Iwamoto,

... dependency of the half-wave potential of the first step on the logarithm of the CDMBC1 concentration, indicates ... choride ion, only one step, corresponding to the first step in the two-step polarograms obtained at low ... acetonitrile. In addition, the catalytic nature of the first step has been established.

Tópico(s): Spectroscopy and Quantum Chemical Studies

1963 - Elsevier BV | Journal of Electroanalytical Chemistry (1959)

Livro

Springer Link

Jornais Acesso aberto

Boardman Reed,

... Picture Plays, Extraordinary Clearance Sale of Books, The First Step toward Health, Postal Life Insurance Company, The Battle ...

1914 - Gale Group | NCCO-STM 1of2

Artigo Acesso aberto Revisado por pares

Hyoung Seok Kim, Tae Sun Kang, Joon Sik Hyun, Hyen Sam Kang,

... the pga promoter derivatives were constructed in two steps. First, the largest DNA fragment of pUCK-C1 was ... into pUC18. pMAK705 derivatives were constructed in three steps. First, the pga promoter in pUCK-C3 had undergone ... 705-del-lacZ plasmid was constructed in three steps. First, the upstream and downstream regions of the lacZ ...

Tópico(s): Bacterial Genetics and Biotechnology

2004 - Elsevier BV | Journal of Biological Chemistry

Livro

Project Gutenberg

Jornais Acesso aberto

By Peter Hennessy, By a Staff Reporter, By David Spanier Diplomatic Correspondent, By Clifford Longley Religious Affairs Correspondent, From Michael Hornsby Brussels, June 16, By Donald Macintyre Labour Staff, From Patrick Brogan, By George Clark Political Correspondent, By Our Political Correspondent, From Our Correspondent, By Our Labour Staff, From David Nicholson-Lord, By Ronald Faux, By Annabel Ferriman, By Alan Hamilton, From Christopher Warman Local Government Correspondent, From Michael Hornsby, From Charles Hargrove, From Our Own Correspondent, From Nicholas Ashford, By Peter Strafford, By Our Foreign Staff, From Peter Godfrey, From Michael Binyon, From Charles Harrison, From Christopher Walker, by Louis Heren, Phillip Venning, David Robinson, DAVID WADE, John Higgins, Stanley Sadie, John Percival, Michael Church, Max Harrison, Harry Golombek, John Carter, Roy Hay, Bevis Hillier, Edward Mayer, Sheila Black, Fred Emery, Dan van der Vat, Pat Davis, Geraldine Norman Sale Room Correspondent, Philip Howard, Yevgeny Smirnov, , ALAN LONG, , GEOFFREY CATCHPOLE, , JOHN F. W. BUSHELL, , HUMPHREY PHELPS, , PAMELA RUBEN, , ANNE FLETCHER, , ROBIN BRYER, , RICHARD G. LARGE, , B. A. MARTELLI, , FRANK D. THOMAS, , ELEANOR J. WARNER, , TULIA LANGDON, , D. J. MANNING, , JOHN LATUSEK, , ELIZABETH ROBSON, , JOHN BOULTON, , ANN R. FOLEY, , NICHOLAS KALDOR, , RAYMOND NOTTAGE, , CLAUD DICKENS, , David Martin, By Geraldine Norman Sale Room Correspondent, C.W.M.C., A correspondent writes:, By Our Economics Correspondent, From Peter Norman, By Our Economics Staff, By Caroline Atkinson, By Richard Allen, By Ray Maughan, By Peter Wainwright, By Kenneth Owen, AGC, Margaret Stone, MS, EDITED BY MARGARET STONE, Vera Di Palma, Peter Wainwright, By Michael Clark, By Tony May, By John Woodcock Cricket Correspondent, By Rex Bellamy Tennis Correspondent, From Peter Ryde Golf Correspondent, Michael Seely, By Lavinia Watson, From Norman Fox Football Correspondent, By Jim Railton, Anderstorp, , European Parliament,

... price plan, Sino-Pakistan route illegal, Delhi claims, First step by Namibia to universal suffrage, Collecting Time to ...

1978 - Gale Group | TDA

Artigo Acesso aberto Revisado por pares

Chao-Jung Tu, Danja Schuenemann, Norman E. Hoffman,

... LHCPs) into the thylakoid membrane proceeds in two steps. First, LHCP interacts with a chloroplast signal recognition particle ( ... LHCPs) into the thylakoid membrane proceeds in two steps. First, LHCP interacts with a chloroplast signal recognition particle ( ... insert from pGTK+chaos was subcloned in two steps. First, pGTK+chaos was PCR-amplified with AGTATCCATGGCCCCTATACTAGG, which ...

Tópico(s): Protist diversity and phylogeny

1999 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Ifat Sher, Tamar Lang, Sharon Lubinsky-Mink, Jonathan Kuhn, Noam Adir, S Chatterjee, Dietmar Schomburg, Dina Ron,

... that of FGF-7, was created in two steps. First, two chimeric fragments were generated utilizing the polymerase ... underlined). The R101A mutant was generated in three steps. First, a mutated segment encoding for FGF-7 residues ... gene product. Then the amplified products of the first step were annealed and amplified with primers p1 and ...

Tópico(s): Metabolism, Diabetes, and Cancer

2000 - Elsevier BV | Journal of Biological Chemistry

Artigo Revisado por pares

Roxana Moreno, Martin Reisslein, Gamze Özoğul,

... increasing number of steps starting with the first step first (forward‐fading practice) produced higher near‐transfer scores ... number of steps but starting with the last step first (backward‐fading practice). Second, students who received feedback immediately after attempting each problem‐solving step outperformed those who received total feedback on near ...

Tópico(s): Evaluation of Teaching Practices

2009 - Wiley | Journal of Engineering Education

Artigo Revisado por pares

F.L. Crane, Jens G. Hauge, Helmut Beinert,

... CoA oxidases and dehydrogenases, enzymes responsible for the first step of β-oxidation. Subcellular localization of the differentially ... the reference strain, indicating that engineering of the first step of β-oxidation successfully redirected a larger fraction ...

Tópico(s): Nitric Oxide and Endothelin Effects

1955 - Elsevier BV | Biochimica et Biophysica Acta