... pela Agência, como o credenciamento para importação pela Lei 8.010/90; instituições que pleiteiam participar desses ...
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Geralda Aparecida de Carvalho Pena,
... a expansão da Rede Federal de Educação Profissional, Científica e Tecnológica (Lei 11.892/08) apresenta novas configurações para o ...
Tópico(s): Education and Digital Technologies
2018 - INSTITUTO FEDERAL DO RIO GRANDE DO NORTE | Revista Brasileira da Educação Profissional e Tecnológica

Maiara Pereira Xavier, Bárbara Ramos Borges, Lucas Peres dos Reis, Ducineli Régis Botelho,
... O objetivo desta pesquisa é analisar a produção científica internacional, à luz da Lei de Lotka, em contabilidade aplicada ao setor elétrico. ... Utility Economics,</em> contribuíram com 18% da produção científica analisada. Não foi evidenciada na pesquisa a aplicabilidade da Lei de Lotka, dado que 92,66% dos autores ...
Tópico(s): Academic Research in Diverse Fields
2019 - UNIVERSIDADE FEDERAL DA BAHIA | Revista de Contabilidade da UFBA
Lei Ma, Haibo Xue, Xiuhao Guan, Chunmei Shu, Yujie Zhang, Junhua Zhang, Rong‐Zhen An,
Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies ...
Tópico(s): Nuclear Receptors and Signaling
2012 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
Lei Ma, Yongjun Chen, Rui Han, Shuangyi Wang,
Benzyl isothiocyanate (BITC) has been shown to inhibit invasion and induce apoptosis of various types of cancer. However, its role on human oral squamous cell carcinoma (OSCC) cells is still not well elucidated. In the present study, we investigated the effect of BITC on apoptosis and invasion of SCC9 cells, and its underlying mechanisms in vitro and in vivo. SCC9 cells were exposed to BITC (5 and 25 μM) for 24 and 48 h. Cell growth, apoptosis, invasion, and migration were detected in vitro by MTT, ...
Tópico(s): Glutathione Transferases and Polymorphisms
2019 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
Lei Zhang, Yasuo Ding, Guo-zhou Rao, D. Miao,
The effects of interleukin-10 (IL-10) and glucose on mRNA and protein expression of osteoprotegerin (OPG), and its ligand, receptor activator of nuclear factor-κB ligand (RANKL), were investigated in human periodontal ligament fibroblasts (HPDLFs). Primary HPDLFs were treated with different concentrations of IL-10 (0, 1, 10, 25, 50, and 100 ng/mL) or glucose (0, 5.5, 10, 20, 30, and 40 mmol/L). Changes in mRNA and protein expression were examined using the reverse-transcription polymerase chain reaction ( ...
Tópico(s): NF-κB Signaling Pathways
2016 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
Lei Song, Ping Duan, Yibo Gan, Ping Li, Changbin Zhao, Jie Xu, Zhexin Zhang, Qi Zhou,
MicroRNAs (miRNAs) play an important role in drug resistance and modulate the efficiency of chemotherapy. A recent study indicated that miR-340 functions as a tumor suppressor in various types of cancer. However, the role of miR-340 in chemotherapy has not been reported yet. In this study, we found that miR-340 enhanced cisplatin (CDDP)-induced cell death. Induction of miR-340-5p expression decreased the IC50 of CDDP and increased the apoptosis of CDDP-resistant MG-63 and Saos-2 cells. Moreover, miR- ...
Tópico(s): RNA Interference and Gene Delivery
2017 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research

Taylor Brandão Schnaider, Cláudio de Souza,
... 6638 que estabelece normas para a prática didático-científica da vivissecção de animais. Essa lei, entretanto, ainda aguarda regulamentação. Além dela, tramitam no ...
Tópico(s): Animal testing and alternatives
2003 - Elsevier BV | Brazilian Journal of Anesthesiology

Rony Cláudio de Oliveira Freitas, Cristhianny Bento Barreiro, Ruberley Rodrigues de Souza, Frederico Souzalima Caldoncelli Franco, Rogério Murta,
A Rede Federal de Educação Profissional, Científica e Tecnológica foi constituída pela Lei nº 11.892 de 29 de dezembro de 2008. A partir daí a rede tem experimentado um grande crescimento e, principalmente, um ...
Tópico(s): Professional Masters Programs Analysis
2017 - | Educação Profissional e Tecnológica em Revista

Ítalo Batista da Silva, Ed Francklin da Silva,
... Aspectos históricos dos Planos Nacionais de Educação; racionalidade científica; Lei de Diretrizes e Bases da Educação e concepção ...
Tópico(s): Education and Public Policy
2007 - INSTITUTO FEDERAL DO RIO GRANDE DO NORTE | Holos
Lei Zheng, Lixia Yang, Xin Zhao, Niya Long, Peifan Li, Yiming Wang,
This aim of this study was to assess the molecular mechanism of osteoporosis in schizophrenia patients with risperidone use. Here, we investigated the effects of risperidone on cellular proliferation and apoptosis of a preosteoblast cell line, MC3T3-E1. Cell viability and apoptotic rate of MC3T3-E1 were detected by cell counting kit-8 and flow cytometry at a serial dose of risperidone and at different time points, respectively. Bone transformation relevant gene serum osteocalcin (BGP), collagen 1, ...
Tópico(s): NF-κB Signaling Pathways
2019 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
Rui Xiang, Han Lei, Mianzhi Chen, Qinwei Li, Huan Sun, Jianzhong Ai, Tielin Chen, Honglian Wang, Yin Fang, Qin Zhou,
MicroRNAs (miRNAs) have gradually been recognized as regulators of embryonic development; however, relatively few miRNAs have been identified that regulate cardiac development. A series of recent papers have established an essential role for the miRNA-17-92 (miR-17-92) cluster of miRNAs in the development of the heart. Previous research has shown that the Friend of Gata-2 (FOG-2) is critical for cardiac development. To investigate the possibility that the miR-17-92 cluster regulates FOG-2 expression ...
Tópico(s): RNA modifications and cancer
2012 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
C.C. Wang, Lei Guo, Fengde Tian, Ning An, Lijun Luo, Ruihu Hao, Bo Wang, Zhi-Jie Zhou,
Inflammation of cartilage is a primary symptom for knee-joint osteoarthritis. Matrix metalloproteinases (MMPs) are known to play an important role in the articular cartilage destruction related to osteoarthritis. Naringenin is a plant-derived flavonoid known for its anti-inflammatory properties. We studied the effect of naringenin on the transcriptional expression, secretion and enzymatic activity of MMP-3 in vivo in the murine monosodium iodoacetate (MIA) osteoarthritis model. The assessment of pain ...
Tópico(s): Inflammatory mediators and NSAID effects
2017 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
Fu Xiaomeng, L. Lei, Jinghong An, Juan Jiang, Yue Qi, Dandan Yuan,
In this study, we aimed to analyze the anti-cancer effects of β-elemene combined with paclitaxel for ovarian cancer. RT-qPCR, MTT assay, western blot, flow cytometry, and immunohistochemistry were used to analyze in vitro and in vivo anti-cancer effects of combined treatment of β-elemene and paclitaxel. The in vitro results showed that β-elemene+paclitaxel treatment markedly inhibited ovarian cancer cell growth, migration, and invasion compared to either paclitaxel or β-elemene treatment alone. ...
Tópico(s): Synthesis and biological activity
2020 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research

Romero Gomes Pereira da Silva, Cláudia Lins Lima, Carlos Hiroo Saito,
... de áreas verdes urbanas parecer cristalizado na literatura cientifica brasileira, após a promulgação da Lei nº 12.651/2012 (conhecida como Novo Código ...
Tópico(s): Urban Arborization and Environmental Studies
2020 - UNIVERSIDADE FEDERAL DE SANTA CATARINA | Geosul
Maria José Veloso da Costa Santos,
Identifica a viabilidade de aplicação das leis de Zipf e Ponto de Transição de Goffman em um arquivo pessoal, o de Bertha Maria Júlia Lutz (1894-1976), com vistas a encontrar palavras com alto conteúdo semântico para sua indexação. Filha do cientista brasileiro Adolpho Lutz, Bertha foi cientista formada pela Sorbonne, feminista, deputada federal e professora emérita da UFRJ. Especializou-se em anfíbios anuros e exerceu seu trabalho no Museu Nacional/UFRJ e no Instituto Oswaldo Cruz. Zipf foi linguista ...
Tópico(s): Linguistics and Language Studies
2009 - UNIVERSIDADE FEDERAL DA BAHIA | PontodeAcesso

Sérgio Luiz do Amaral Moretti, Milton de Abreu Campanário,
... das obras citadas, não há adequação a esta lei, indicando pouca maturidade científica na RSE. A análise mostra também que a ...
Tópico(s): Education and Public Policy
2009 - Associação Nacional de Pós-Graduação e Pesquisa em Administração (ANPAD) | Revista de Administração Contemporânea

Rafael Maximiano Ferreira, Samuel Lyncon Leandro de Lima, Adhmir Renan Voltolini Gomes, Gilmar Ribeiro de Mello,
... a temática. Os resultados apresentaram uma boa produção cientifica por periódicos, entretanto o presente estudo não conseguiu constatar a validação da Lei de Lotka, uma vez a produção se encontra bastante pulverizada. Além disso, a Lei de Zipf foi aplicada sobre os títulos e palavras-chave dos artigos que analisados, constatando-se que os termos governança corporativa, estrutura, análise e desempenho são alguns dos termos mais utilizados na produção cientifica estudada.
Tópico(s): Business and Management Studies
2018 - Programa de Pós-Graduação em Administração da Faculdade de Administração e Economia | Revista organizações em contexto/Organizações em Contexto
Chao Ma, Huan Luo, Lei Fan, Xiaoyan Liu, Chengshan Gao,
Heart failure (HF) with preserved ejection fraction (HFpEF) is a clinical syndrome in which patients have symptoms and signs of HF with normal or near-normal left ventricular ejection fraction (LVEF ≥50%). Roughly half of all patients with HF worldwide have an LVEF ≥50% and nearly half have an LVEF <50%. Thanks to the increased scientific attention about the condition and improved characterization and diagnostic tools, the incidence of HF with reduced ejection fraction (HFrEF) dropped while that of HFpEF ...
Tópico(s): Cardiac pacing and defibrillation studies
2020 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
Tópico(s): Education Pedagogy and Practices
2012 - | De Jure - Revista Jurídica do Ministério Público do Estado de Minas Gerais
María Fernanda Rollo, Paula Meireles, Madalena Ribeiro, Tiago Brandão,
... da tecnologia, assim como o desenvolvimento da cooperação científica e tecnológica internacional.” (Decreto-Lei n.º 152/2007, art.º 3.º). ...
Tópico(s): History, Culture, and Society
2012 - Coimbra University Press | Boletim do Arquivo da Universidade de Coimbra
Yiwen Li, Yuqing Xu, Bo Lei, Wenxiu Wang, Xin Ge, Jingrui Li,
Rhein is a primary anthraquinone found in the roots of a traditional Chinese herb, rhubarb, and has been shown to have some anticancer effects. The aim of the present study was to investigate the effect of rhein on the apoptosis of the human gastric cancer line SGC-7901 and to identify the mechanism involved. SGC-7901 cells were cultured and treated with rhein (0, 50, 100, 150, and 200 µM) for 24, 48, or 72 h. Relative cell viability assessed by the MTT assay after treatment was 100, 99, 85, 79, ...
Tópico(s): Cell death mechanisms and regulation
2012 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research

José Francisco de Carvalho Rezende, Ana Cristina de Oliveira Lott, Guilherme Quintanilha,
... pontos em comum, foram identificados: a obrigatoriedade por lei; o incentivo à produção científica, cultural, artística e tecnológica; a análise de experiência ...
Tópico(s): University-Industry-Government Innovation Models
2019 - Associação Nacional dos Cursos de Graduação em Administração | Administração Ensino e Pesquisa

Tópico(s): Historical Astronomy and Related Studies
1980 - Brazilian Academy of Sciences | Anais da Academia Brasileira de Ciências
Ningning Dang, Shuguang Pang, Hui Song, Lei An, Xiaochun Ma,
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected ...
Tópico(s): Allergic Rhinitis and Sensitization
2014 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
Yang Bi, Yun He, Jiayi Huang, Lei Xu, Ni Tang, Tong‐Chuan He, Tao Feng,
Hepatic progenitor cells (HPCs) are a potential cell source for liver cell transplantation but do not function like mature liver cells. We sought an effective and reliable method to induce HPC maturation. An immortalized HP14.5 albumin promoter-driven Gaussian luciferase (ALB-GLuc) cell line was established from HPCs isolated from fetal mouse liver of post coitus day 14.5 mice to investigate the effect of induction factors on ALB promoter. HP14.5 parental cells were cultured in DMEM with different ...
Tópico(s): Organ Transplantation Techniques and Outcomes
2013 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
Yang Zhang, Qingqing Zhang, Cong Fu, Lei Wang, Guanqun Zhang, Pei‐Wei Cao, Guofang Chen, Xinmin Fu,
This study explores the safety and effect of acute cerebral infarction treatment by microcatheter injection of tirofiban combined with a Solitaire AB stent and/or stent implantation. Emergency cerebral angiograms showing the responsible vascular occlusion of 120 acute cerebral infarction patients who underwent emergency endovascular thrombectomy were included in the study. These patients were randomly divided into two groups using the random number table method: treatment group (n=60) that received ...
Tópico(s): Traumatic Brain Injury and Neurovascular Disturbances
2019 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
Shanqin Peng, Congqi Hu, Xi Liu, Lei Lei, Guodong He, Chenming Xiong, Wenqian Wu,
Rheumatoid arthritis (RA) is an autoimmune disease of knee joints involving pain and inflammation. Rhoifolin is a plant flavonoid known to have antioxidant and anti-inflammatory properties. This study was taken to identify the effect of rhoifolin on complete Freund's adjuvant (CFA)-induced arthritis in the rat model. Treatment with rhoifolin (10 and 20 mg/kg) showed a significant improvement in the overall health parameters such as paw edema and weight loss. This improvement in morphological parameters ...
Tópico(s): Phytochemistry and Biological Activities
2020 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research
Renzhi Yu, Miao Wang, M Wang, Lei Han,
The purpose of this study was to investigate the anti-cancer effect of melittin on growth, migration, invasion, and apoptosis of non-small-cell lung cancer (NSCLC) cells. This study also explored the potential anti-cancer mechanism of melittin in NSCLC cells. The results demonstrated that melittin suppressed growth, migration, and invasion, and induced apoptosis of NSCLC cells in vitro. Melittin increased pro-apoptotic caspase-3 and Apaf-1 gene expression. Melittin inhibited tumor growth factor (TGF)- ...
Tópico(s): Medicinal plant effects and applications
2020 - Associação Brasileira de Divulgação Científica | Brazilian Journal of Medical and Biological Research

Alessandra Carla Ceolin, José Aldo Cavalcanti de Almeida, Maria do Carmo Maracajá Alves,
... natureza descritiva e qualitativa, fundamentado na análise bibliográfica científica, bem como, na análise das legislações específicas: Lei 12.527, de 18 de novembro de 2011 ...
Tópico(s): Business and Management Studies
2016 - UNIVERSIDADE DO EXTREMO SUL CATARINENSE | Desenvolvimento Socioeconômico em Debate