Mrs. Evelyn Knox, A. Calder-marshall, P. Davidson, Jerome Henry, Marjorie M. Beal, Sir Walter Citrine, M. Hewson, F. Maddison, Stefan Lorant, Mrs. Winifred M. Pooley Mrs., Kathleen Whitehead, J. Carr Brookfield, R. C. S. Whittingham, Robert Lindsay, Miss Lilian E. Nunn, H. Butterworth, Jean W. McClintock, Miss Colleen Lee, A. Anthony Watson, H. Rawlinson, Douglas MACDONALD Hastings, H. Sinclair, Peter Johnstone, P. F., Edward Hulton, E. H. Shaw, Peggy Elliott, Stephen White, Albert Inkpin, L. Roy Hobdell,
Post Raincoats Become a Draughtsman John Knight Ltd. Horrockses Crewdson & Co. Ltd. Mother! Fight Child's Colds Minor Villiers Engineering Company Ltd. ...
1940 - Gale Group | Picture Post
Jan Filip, Lilian‐Lee B. Müller, Helmut Hillebrand, S Moorthi,
... consumer diversity effects on prey assemblages Joanna Filip*, Lilian-Lee Müller, Helmut Hillebrand, Stefanie Moorthi Carl-von-Ossietzky ...
Tópico(s): Aquatic Ecosystems and Phytoplankton Dynamics
2012 - Inter-Research Science Center | Aquatic Microbial Ecology
Alan Day, André De Silva Troy Bowler, Michael Thompson, Jon Ashworth, David Adams, Ann Ducker (Leader), DJM, Patricia Davies, Richard Ford, Home Correspondent, Ian McGEOCH, Andrew Longmore, Neil Bennett, Christopher Bowen, Inigo Gilmore, Charles Hargrove, Michael Ranken (Secretary), Ivo Tennant, Philip Howard, Jeremy Kingston, James Bone, Kevin Eason, Motoring Correspondent, Nick Nuttall, Environment Correspondent, Simon Wilde, Colin Narbrough, Ian R. Webb, Colin Narbrough, World Trade Correspondent, Arthur Leathley Political Correspondent, Martin Fletcher, Abby Tan, Pat Gibson, Edward Rayner, Ben Preston Education Correspondent, Richard Evans Racing commentary, John Rutherford, Norman Hammond, Archaeology Correspondent, Peter Ball, Richard Evans, Racing Correspondent, Ruth Gledhill Religion Correspondent, Libby Purves, Peter Ackroyd, Peter Waymark, Robin Young, Alastair Goodlad, Rodney Milnes, Sean MacCarthaigh, William Millinship, Michael Hamlyn, Tina Maclagan, J. C. Mougnibas, Ian McIntyre, Joel Brand, Hugh Cundall, Russell Kempson, Alan Hopkins, Michael Nathanson, W. J. Baker (Leader), George Brock, Michael Theodoulou, Sean Mac Carthaigh, David Miller, D. L. B. Spenser (Leader), Kevin McCarra Scottish commentary, Barry Millington, John Hopkins Golf Correspondent, David Toop, Dalya Alberge, Arts Correspondent, Stephen Seamer, Tim Jones, Transport Correspondent, Raymond Keene, Adam Sage, Peter Davalle, John Russell Taylor, Henry W. Burke, P. H. S, Lawrence Freedman, Michael Dynes, Whitehall Correspondent, Richard Evans, David Powell, Athletics Correspondent, Oliver Holt, Roger Boyes, Terry Cox (Leader), David Hands Rugby Correspondent, Kevin Barry, Richard Duce, Christopher Thomas, William Rees-Mogg, John Goodbody, Ross Tieman Industrial Correspondent, Nick Nuttall, Technology Correspondent, James Pringle, Srikumar Sen Boxing Correspondent, Matthew Parris, Graham Lacey, John Shaw, Margaret Leeson, Ian Brodie, Alan Lee Cricket Correspondent, Richard Beeston, Brian Clarke, David Campbell, Graham Searjeant, Ben Lynfield, Kate Bassett, Charles Lambert, Benedict Nightingale, Ruth Gledhill and Catherine Milton, Alyson Rudd, David Powell, Michael Henderson, John Phillips, Elaine Fullard, Peter Robinson, Catherine Milton,
... on September 24,1934 Personal Column Lee Soon Lee Soon, Chinese trader, died in Bangkok on August 8 aged 83. He was born in Pholeng, China, on April 10,1911 Lilian Duff Lilian Duff, radio broadcaster, died on August ...
1994 - Gale Group | TDA
Ryan J. Smith, Hongpan Zhang, Shengen Hu, Theodora Yung, Roshane Francis, Lilian Lee, Mark W. Onaitis, Peter B. Dirks, Chongzhi Zang, Tae-Hee Kim,
Abstract Development of the gastrointestinal system occurs after gut tube closure, guided by spatial and temporal control of gene expression. However, it remains unclear what forces regulate these spatiotemporal gene expression patterns. Here we perform single-cell chromatin profiling of the primitive gut tube to reveal organ-specific chromatin patterns that reflect the anatomical patterns of distinct organs. We generate a comprehensive map of epigenomic changes throughout gut development, demonstrating ...
Tópico(s): Epigenetics and DNA Methylation
2022 - Nature Portfolio | Nature Communications
Mr. Kenworthy, Caradoc Evans, E. C. A-L., H. A., Charles White, Mr. Walsh, "Boss" Croker, W. F. Anstey, Keble Howard, Miss Cave, Walter Crick, Leon Bertrand, Harold Dearden, Leonard Spalding, E. D. Telford, Hugh Macnaghten, Sir Harry Goschen, Mr. Ramsay MacDonald, E. R. Grimes, Maitland Davidson, E. K. Baxter, E. E. Cowan, M. A., Dr. Vaughan Cornish, Alfred Docker, H. Charles Woods, Mr. Hailwood, J. E. Woolacott (Late Editor of the "Pioneer, " Allahabad), Joseph J. Norman, Lilian Arrow, Cecil V. Bagot, W., F. R. G. S., Sir J. Walker, K. C. B., Kathleen Lee, Lord Cushendun, Dell Leigh, W. Herbert Kent, Maurice Hewlett, Frank Rutter, Sir Martin Conway M. P., K., Arthur N. Gillman, D. R. Gent, Henry Adams, D. Gordon Denoon, Rt. Hon. T. P. O'connor P. C., M. P., Mr. Lloyd George, Mr. W. N. Marcy (L.), Rev. D. R. Davies (Lab.), J. E. E., Mr. H. Ramsbotham (Con.), H. F., Pandora, J. L. Davenport, George Dunning Gribble, S. N. Behrman, A. H. Davis, Clare Annesley (Lab), E. A. James, Ernest Newman, Sir Henry Rew, W. C. Johnson, Sir Alfred Robbins, T. G. Hume, Ralph Straus, Prof. Eoin Macneill, Mark Savage, Edmund Gosse, Sydney W. Carroll, Edward Shillito, L. C., Hendry Ryder, Henry Tristram, John Ibbertson, Rev. "Pat" McCormick, Sir Fredric Wise, Eugene O'Neill, T. H. L. Hony, Frank H. Simonds (the American Publicist), Michael P. Kerney, Sir John Simon, R. J. Barrett Financial Editor, General Goethals, W. J. B., Miss Nuthall, E. Waddy, Yarborough, St. Thomas, Mr. R. Hugh Tennant, Mr. C. T. Culverwell (C.), A. A. Burton, Dr. George Miles, Roland Atkinson ("Sunday Times" Paris Correspondent), Professor E. C. Worden Ph. C., B. S., M. A., F. C. S., George A. MacMillan, L. J. Maxse, Prof. Soothill, Mr. R. P. Tomlinson (Lib.), W. S. Branch, F. A. Mackenzie Author of "The Unveiled East", Vigilant, George C. Stead, Mayfair, H. C. Minchin, Rt. Hon. Philip Snowden M. P., L. Van Vliet, M. A. Gaskell, Right Hon. Reginald McKenna, Mr. Joseph Chamberlain as Guardamak, R. F. Tiltman, Harold Cox,
Bluthner & Co., Ltd. J. Lyons & Co., Ltd. Gleneagles There is only One Romano's Multiple Display Advertising Items Royal Palace Hotel Howard Hotel Hotel Somerset ...
1928 - Gale Group | Sunday Times HA GDA
Produção Nacional
Revisado por pares
Patty Sachamitr, Jolene Caifeng Ho, Felipe E. Ciamponi, Wail Ba-Alawi, Fiona J. Coutinho, Paul Guilhamon, Michelle Kushida, Florence M.G. Cavalli, Lilian Lee, Naghmeh Rastegar, Victoria Vu, María Sánchez‐Osuna, Jasmin Coulombe‐Huntington, Evgeny Kanshin, Heather Whetstone, Mathieu Durand, P Thibault, Kirsten Hart, Maria Mangos, Joseph Veyhl, Wenjun Chen, Nhat Tran, Bang-Chi Duong, Ahmed Aman, Xinghui Che, Xiaoyang Lan, Owen Whitley, Olga Zaslaver, Dalia Baršytė-Lovejoy, Laura M. Richards, Ian J. Restall, Amy A. Caudy, Hannes Röst, Zahid Bonday, Mark Bernstein, Sunit Das, Michael D. Cusimano, Julian Spears, Gary D. Bader, Trevor J. Pugh, Mike Tyers, Mathieu Lupien, Benjamin Haibe‐Kains, H. Artee Luchman, Samuel Weiss, Katlin B. Massirer, Panagiotis Prinos, C.H. Arrowsmith, Peter B. Dirks,
Abstract Glioblastoma (GBM) is a deadly cancer in which cancer stem cells (CSCs) sustain tumor growth and contribute to therapeutic resistance. Protein arginine methyltransferase 5 (PRMT5) has recently emerged as a promising target in GBM. Using two orthogonal-acting inhibitors of PRMT5 (GSK591 or LLY-283), we show that pharmacological inhibition of PRMT5 suppresses the growth of a cohort of 46 patient-derived GBM stem cell cultures, with the proneural subtype showing greater sensitivity. We show that ...
Tópico(s): CAR-T cell therapy research
2021 - Nature Portfolio | Nature Communications
Michael Clark, Stock Market Correspondent, Nanette Moore, Jon Ashworth, Meryl Docker, C. Leonard-Woolley, Bill Frost, Ronald Faux, Sheila Gunn and Richard Ford, Michael Hamilton Sharp, Mike Campbell, , Philip Jacobson and Paul Bompard, Angela MacKay, Ross Tieman, Industrial Correspondent, Julian Le Grand, , Philip Howard, P. M. Jackson, , Rodney E. B. Atkinson, Vernon Bogdanor, , Norman De Mesquita, S. J. Bowskill, Stewart Ranson, , Alan Alexander, , Wolfgang Münchau, European Business Correspondent, Murray Stewart, Richard Streeton, Richard Eaton, Kevin Eason, Motoring Correspondent, Stuart Jones Football Correspondent, Neil Bennett, Banking Correspondent, Ann MacInnes, John Russell, David Watts, Diplomatic Correspondent, Colin Narbrough Economics Correspondent, Michael Tate, City Editor, Joe Joseph, Brian Robson, , Mitchell Platts, Golf Correspondent, Peter Davenport, Bruce Clark, Stewart Tendler Crime Correspondent, Norman Hammond, Archaeology Correspondent, Derek John Hillier, Douglas Broom, Peter Bills, R. A. W. Rhodes, , Alan Hamilton, Robin Young, Peter Millar, Tony Pristavec, Jenny MacArthur, Bruce H. Garner, Michael Clark, Philip Robinson, John Young, Martin Loughlin, , Peter John, , Michael Tate City Editor, Peter Barnard, Edward Gorman, Christopher Lowney, Edward Fennell, Gavin Bell, John Woodcock, Mark Hedley, George Brock, Michael Theodoulou, Martin Hoyle, Nicholas Harling, David Miller, Philip Webster, Chief Political Correspondent, J. D. Stewart, , David Powell Athletics Correspondent, Lindsay Cook, Money Editor, Marcus Binney, Jonathan Prynn, John Ashworth, Raymond Keene, Chess Correspondent, Paul Wilkinson, Paul Griffiths, Nigel Hawkes, Edwina Currie, Jeffrey Stanyer, , Roger Boyes, Ian Ross, Sue Moore, Malcolm Grant, John Gyford, Dilys Hill, , Michael Dynes, Transport Correspondent, Jamie Dettmer, Richard Duce, Joanna Pitman, Nurver Nures, Nicholas Deakin, , Ross Tieman Industrial Correspondent, Nick Nuttall, Technology Correspondent, Timothy Raison, Chairman, Matthew Parris, Liz Smith, Sarah Jane Checkland Art Market Correspondent, Sheila Gunn Political Correspondent, John Bennington, , Scrivenor, Alan Lee, Owen Jenkins, Thomson Prentice, Medical Correspondent, Roy Hattersley, Peter Victor, Michael Phillips, David Sinclair, Alan Coren, Benedict Nightingale, David Tytler, Education Editor, Jack Bailey, Frances Gibb, Derek Morgan, Vince Wright, Andrew Finkel, Richard Ford, Political Correspondent, Matthew Bond, Colin Campbell, Susan Ellicott, Peter Robinson, John Goodbody, Sports News Correspondent, Jan Raath, Adam Kelliher and Robin Oakley, David Hands, Rugby Correspondent, Barry Jones, Valerie Karn, , Nicholas Wood and Robin Oakley, Michael Hornsby Agriculture Correspondent,
... of Fox Scottish Amicable Life Assurance Society Mandarin: Lilian Bayliss can ... new season. Alan Lee, Cricket Correspondent, looks forward to the end of ...
1991 - Gale Group | TDA
Laura M. Richards, Owen Whitley, Graham MacLeod, Florence M.G. Cavalli, Fiona J. Coutinho, Julia E. Jaramillo, N. Svergun, Mazdak Riverin, Danielle Croucher, Michelle Kushida, Kenny Yu, Paul Guilhamon, Naghmeh Rastegar, Moloud Ahmadi, Jasmine K. Bhatti, Danielle Bozek, Naijin Li, Lilian Lee, Clare Che, Erika Luis, Nicole I. Park, Zhiyu Xu, Troy Ketela, Richard A. Moore, Marco A. Marra, Julian Spears, Michael D. Cusimano, Sunit Das, Mark Bernstein, Benjamin Haibe‐Kains, Mathieu Lupien, H. Artee Luchman, Samuel Weiss, Stéphane Angers, Peter B. Dirks, Gary D. Bader, Trevor J. Pugh,
Tópico(s): Neuroinflammation and Neurodegeneration Mechanisms
2021 - Nature Portfolio | Nature Cancer
M. A. Oxon, Driver M. Wright R. A. S. C., C. M. F., Llanwrtyd Wells, (Miss) Libeth Goldbergerova, Lilian Nunn, T. Alaric Millington, Nesta Lewis, L. W., W. C. Blatchford, H. W. Bush, P. G., J. S. Tennant, John W. Lee, D. Williams, R. A. F., J. L. Coverdale,
Picture Post William Crawford & Sons Ltd. H. P. Bulmer & Co. Ltd. The fact that goods made of raw materials in short supply owing to war conditions are advertised ...
1944 - Gale Group | Picture Post
Ahmed El‐Sehemy, Hayden Selvadurai, Arturo Ortín-Martínez, Nenad T. Pokrajac, Yasin Mamatjan, Nobuhiko Tachibana, Katherine Rowland, Lilian Lee, Nicole Park, Kenneth Aldape, Peter B. Dirks, Valerie A. Wallace,
Glioblastoma multiforme (GBM) contains a subpopulation of cells, GBM stem cells (GSCs), that maintain the bulk tumor and represent a key therapeutic target. Norrin is a Wnt ligand that binds Frizzled class receptor 4 (FZD4) to activate canonical Wnt signaling. Although Norrin, encoded by NDP, has a well-described role in vascular development, its function in human tumorigenesis is largely unexplored. Here, we show that NDP expression is enriched in neurological cancers, including GBM, and its levels ...
Tópico(s): Epigenetics and DNA Methylation
2020 - American Society for Clinical Investigation | Journal of Clinical Investigation
Craig Harris, Lucy Barker Founder of Barker Brooks Media, Sally Brock, Michael Burleigh, V S, Professor Gideon Garter, Jonathan Miller, Gareth Walsh, Dennis Pallis, Neil Wormald, Graham Livings, Dominic Bradbury, Martin James, Anthony Sattin, Rosie Millard, Anthony Harrison, Tony Marcus, Ben Armitage, Antonia Churchman, David Hewson, Hugh Canning, Roger Graef, Ryan Gilbey, Sarah Dempster, Katie Melua, Anita Chaudhuri, James Delingpole, Ali Rifat, Giles Hattersley, Nicholas Hellen, Shelley Von Strunckel, Christopher Morgan, David Meredith, Dave Hannigan, Dr Betty Chambers, Lindsay Duguid, Uzi Mahnaimi, Michael Wright, Nick Rennison, William Horwood, Henry Carter, John Elliott, Burlington Bertie, Lorraine Dockery, Karen Leggett, Ali Allen, David Groundwater, Maurice Chittenden, Richard Brooks Arts Editor, Craig Lord, Ginny West, Clive Lloyd, Sarah Ebner, Angela Missoni, Matthew Campbell, Mary Braid, Liam Clarke, Miss F Robb, James Knight, Graham Norwood, David Budworth, William Lewis Business editor, Stewart Mitchell, Ben Rooney, Susannah Price, Sarah Baxter, Ed Hughes, Jason Dawe, Alan Wesson, Jonathan Northcroft, Collette Lyons, Sir Peter Hall, Robert Hewlson, Matthew Wall, Chris Walker, Wynne Winn-Moon, Jim Munro, John Stoddart, R L, Richard Green, Andrew Sullivan, Clive Davis, Kevin Donn, Bernard Clayton, Cally Law, Mark Edward, Victoria Segal, Richard Wilson, Edward Porter, Dave Pollard, David Eimer, Adam Nathan, Ryan Giibey, Peter Parker, Robin Scott-Elliot, Christopher Silvester, Tony Thorn, Hugh McIlvanney, Steve Boyd, Stephen Magill, Richard McComb, Julie Earle-Levine, John Follain, Alasdair MacDougall, David Leppard, Tony Geraghty, Herbert Winterflood, Gareth Huw Davies, David Cracknell, Diana Wright, J Boyd, John Bell, David Walsh, Stephen Armstrong, Jim Scott, Mark Anstead, Caroline Rees, Rich Miniter, Ray Hutton, Mel Webb, Lilian McDermott, Jennifer Hall, A A Gill, Brian Glanville, T L, Alan English, Daniel Emery, Nigel Powell, Sophie Harrison, Brian Doogan, Ben Dowell, Jeremy Lazell, John Cornwell, Trevor McDonald, Jonathan Futrell, Hugh Pearman, Anthony Clark, Huw Beynon, Simon Wilde Cricket Correspondent, Richard Lewis, Helen Stewart, John Dugdale, Barbara Hall, Edward Owen, Nicholas Rufford, Rob Hughes, Ruth Tenne, John Peter, Maggie Alderson, Katie Samuel, Susan d'Arcy, Ivo Tennant, David Gower, Kenneth Hunt, David Smith, Tim Richards, David Cracknell Political Editor, Sir Michael Salt, Guy Bellamy, Tom Walker, Dipesh Gadher Transport Correspondent, Adrian Furnham, Nicholas Hellen Social Affairs Editor, John Arlidge, Brendan O'Neill, Emma John, Christopher Hart, Philip Kingsley, Ian McAllister, Sir Simon Rattle, Stewart Lee, Peter Conradi, Michael Portillo, Patricia Nicol, Dick Townsend, Richard Fletcher, Lilian Pizzichini, Jeremy Guscott, David Walsh Chief Sports Writer, Charles Chesshire, Sarah-Kate Templeton, Edward Gorman, Chris Woodhead, Sara Macefield, Daniel Green, Alex Clark, Mark Edwards, Heather Dixon, Rachel Bridge, Susan Clark, Kira Cochrane, David Baddiel, Sean Newsom, Raymond Keene, Stanley Stewart, Zoe Brennan, Louise Armitstead, Nick Cain, S C, Trevor Lewis, Victoria O'brien, Roland White, Danny Roth, Suzanne Slarsky School of Geography and the Environment University of Oxford, Colin Bernard, Richard Rae, Mark Franchetti, Jon Ungoed-Thomas, Michael Sheridan, Barry Collins, Dipesh Gadher, Hunter Davies, Deborah Fink, Stephen Pettitt, Justin Sparks, Sylvia Turner, Mark Hodson, Dan Cairns, David Smith Economics Editor, Penny Perrick, James Luckhurst, Chris Feetenby, Simon Howard, Gavin Newsham, Dominic Rushe, Karen Robinson, Gus Watson, Dan Crirns, Helena Frith Powell, Kate Stocks, Helen Davies, Pam Barrett, Richard Lofthouse, Robin Eggar, Christopher Somerville, Frank Whitford, Kathryn Cooper, Humphrey Carpenter, Elton Flatley, Mike Rutherford, Tony Allen-Mills, Simon Wilde, David Ogden, Robert Sandall, Ariel Leve, Robert Winnett, Irwin Stelzer, Peter Wilson, David Dougill, Margarette Driscoll, Jeremy Clarkson, Philip Smith, Nick Hale, Greg Struthers, Nikon, Lydia Slater, Roger Eglin, Lucinda Kemeny, Jasper Gerard, Derek Clements, Paul Driver, Ian Hawkey, Paul Durman, Walter Wolff, Jonathon Carr-Brown Health Correspondent, Dr Julia Matthews, Christina Lamb, Victoria O'Brien, Fiona Morrow, Cosmo Landesman, Mark Bostridge, Gavin Conway, L F, Dominic O'Connell, Adrienne Connors, Tracey Richardson, Caroline Donald, Liat Joshi, Colin McDowell, Russell Miller, Steward Lee, Ben Newton, Shane Watson, Yuba Bessaoud, Judith O'Reilly, Philip Baker, Jonathan Leake, Clare Francis, Karin Goodwin, James Foxall, David Craik, David Sanderson, Will Iredale, Jonathan Leake Science Editor, Lawrence Grobel, Naomi Caine, David Wickers, Minette Marrin, Annie Jacobsen, Tom Auderson, Amir Taheri, Mark Hollingsworth, Gerald Edmend, Martyn Zeigler, Matt Roberts, Clive Spendlove, David Robertson, Matthew Goodman, India Knight, Jon Bennett, Tom Norrington-Davies, Annabelle Newton,
Contents All children to go on 'big brother' computer Top official sacked over Blair jibe Three ministers opposed Mandelson comeback Contents BT Picture ...
2004 - Gale Group | Sunday Times HA GDA
Hayden Selvadurai, Erika Luis, Kinjal Desai, Xiaoyang Lan, Maria C. Vladoiu, Owen Whitley, Ciaran Galvin, Robert J. Vanner, Lilian Lee, Heather Whetstone, Michelle Kushida, Tomasz J. Nowakowski, Phedias Diamandis, Cynthia Hawkins, Gary D. Bader, Arnold R. Kriegstein, Michael D. Taylor, Peter B. Dirks,
Medulloblastoma (MB) is a neoplasm linked to dysregulated cerebellar development. Previously, we demonstrated that the Sonic Hedgehog (SHH) subgroup grows hierarchically, with Sox2+ cells at the apex of tumor progression and relapse. To test whether this mechanism is rooted in a normal developmental process, we studied the role of Sox2 in cerebellar development. We find that the external germinal layer (EGL) is derived from embryonic Sox2+ precursors and that the EGL maintains a rare fraction of Sox2+ ...
Tópico(s): Single-cell and spatial transcriptomics
2020 - Cell Press | Cell Reports
Basil Eastland, Gladys Mortimer S. R. N., Tom Hopkinson, H. F. Pearce, Bernard Acworth, E. A. Hemingway, Maurice Sampson, C. M. Tripp, Harry Skewers, E. Lloyd Lucas, A. Lee, Stanley E. A. Underhill, Margaret Barham, W. J. Meredith, Geoffrey M. Pearson, Maud G. Macklethwaite, H. E. Hope-Clarke O. B. E., Lilian M. Underhill, D. T. Wellstead, William Alexander, H. G. Larcher, A. Sheril, H. H. Hewitt, Mrs. Doris Slann, Croydon Lane, G. Griffiths, Peter Hodge, A. W. Meredith, D. J. N. Bozaegette, J. S. Benson, Italian Journalist, Edward Hulton, Alan D. Caston, W. Padley, Arthur Hobby, Edith Summerskill M. P., Caecilia E. M. Pugh, J. MacDonald,
Post Mischief Crompton Lamps Housewife "DeReszke" Minors Lotus Ltd. Rheumatic Acids D & W. Gibbs Ltd. Cadbury's Bourn-vita O. K Meltis Ltd. Allen & Hanburys ...
1940 - Gale Group | Picture Post
Lilian Lee Yen Wei, Ag Asri Ag Ibrahim, Kashif Nisar, Zamhar Ismail, Ian Welch,
Many works have been done on the topic of Geographic Visual Display with different objectives and approaches. There are studies to compare the traditional cartography techniques (the traditional term of Geographic Visual Display (GVD) without Human-Computer Interaction (HCI)) to Modern GIS which are also known as Geo-visualization, some literature differentiates and highlight the commonalities of features and architectures of different Geographic Visual Display tools (from layers and clusters to dot ...
Tópico(s): Data Visualization and Analytics
2020 - Elsevier BV | Journal of Industrial Information Integration
FROM OUR AERONAUTICAL CORRESPONDENT, FROM OUR CORRESPONDENT, FROM OUR OWN CORRESPONDENT, FROM OUR DIPLOMATIC CORRESPONDENT, FROM OUR SPECIAL CORRESPONDENT, FROM A CORRESPONDENT, From Our Special Correspondent, FROM OUR OTTAWA CORRESPONDENT, From a Special Correspondent, From Our Own Correspondent, FROM OUR POLITICAL CORRESPONDENT, From Our Correspondent, FROM OUR LABOUR CORRESPONDENT, F. C. ROBERTS., ALAN T. PEACOCK., HUGH MERRICK., HAROLD BOWDEN., K. LINDSAY., WILFRED KITCHING., B. P. REES., By Roger Miles, GILBERT DOLD., J. D. LOVERIDGE, FROM OUR SALE ROOM CORRESPONDENT, FROM OUR YACHTING CORRESPONDENT, A correspondent, FROM OUR CRICKET CORRESPONDENT, FROM OUR ROWING CORRESPONDENT, FROM OUR RUGBY FOOTBALL CORRESPONDENT, FROM OUR BOXING CORRESPONDENT, From Our Association Football Correspondent, FROM OUR NORTHERN CORRESPONDENT, By Our City Editor, From Our Motoring Correspondent,
... Service In India, Mr. H. W. Thomas, Dr. Lilian Lindsay First Qualified Woman Dentist In Britain, Mrs. Winifred Dakyns, Obituary, Miss Lilian Brake. Feature Articles (aka Opinion): From The Times ...
1960 - Gale Group | TDA
Nishani Rajakulendran, Katherine Rowland, Hayden Selvadurai, Moloud Ahmadi, Nicole I. Park, Sergey Naumenko, Sonam Dolma, Ryan Ward, Milly So, Lilian Lee, Graham MacLeod, Clarissa C. Pasiliao, Caroline Brandon, Ian D. Clarke, Michael D. Cusimano, Mark Bernstein, Nizar N. Batada, Stéphane Angers, Peter B. Dirks,
Developmental signal transduction pathways act diversely, with context-dependent roles across systems and disease types. Glioblastomas (GBMs), which are the poorest prognosis primary brain cancers, strongly resemble developmental systems, but these growth processes have not been exploited therapeutically, likely in part due to the extreme cellular and genetic heterogeneity observed in these tumors. The role of Wnt/βcatenin signaling in GBM stem cell (GSC) renewal and fate decisions remains controversial. ...
Tópico(s): Pluripotent Stem Cells Research
2019 - Cold Spring Harbor Laboratory Press | Genes & Development
Victoria McKee, David Wade, Frances Gibb, Legal Affairs Correspondent, Robert Dawson Scott, Clifford Longley, Andrew McEwen, DJM, Anatol Lieven, Simon Barnes, David Miller Chief Sports Correspondent, Harry Golombek, Chess Correspondent, David Lee, Cliff Feltham, Andrew Moger and Edward Gorman, Angus Nicol, Ivo Tennant, Douglas Broom, Education Reporter, Marie Colvin and David Bernstein, Rosemary Unsworth, Retail Affairs Correspondent, Robin Oakley, Sally Brompton, Clifford Longley Religious Affairs Editor, C. M. Fletcher, Richard Evans, Media Editor, Carol Leonard, Stewart Tendler and Martin Fletcher, Richard Streeton, Philip Hunt, Director, John Spicer, Employment Affairs Correspondent, Bernard Levin, Henry Gee, Jim Railton, Peter Davenport, Ralph Cropper, Chairman, Norman Hammond, Archaeology Correspondent, Anita Hughes, Peter Ball, David J. Feaviour, Rodney Cowton, Transport Correspondent, Thomson Prentice Science Correspondent, Peter Waymark, Jenny MacArthur, Charles Bremner, Ian McIntyre, John Percival, Geoffrey Matthews, John Young, Agriculture Correspondent, Martin Fletcher Political Reporter, C. M. Clothier, Chairman, Robin Webb, Andrew Hislop, George Rae, John Woodcock, Sydney Friskin, Mary Lutyens, Chris Thau, Peter Dear and Ruth Sharman, Barry Millington, Mitchell Platts Golf Correspondent, (Michael Phillips), Maxwell Fendt, Vanda A. Martin, Christopher Hordern, Kerry Gill, Peter Davalle, David Brewerton Executive Editor, Alan Lee, Cricket Correspondent, David Fraser, Paul Griffiths, Andrew McEwen, Diplomatic Correspondent, Peter Bryan, Heather Kirby, John Blunsden, Stewart Tendler, Crime Reporter, Barry Pickthall, Maxwell Newton, Michael Scott, Derek Harris, Industrial Editor, G. M. Tricks, David Brewerton, Christopher Thomas, John England, Carol Ferguson, Graham Searjeant, Financial Editor, Clive White, Malcolm McKeag, Alan Franks, Martin Brown, John Sankey (High Commissioner), David Walker, Martin Waller, Michael Horsnell, John Spicer Employment Affairs Correspondent, John Young Agriculture Correspondent, Bailey Morris, Pat Butcher Athletics Correspondent, Richard Morrison, Robert Atkinson, Susan MacDonald, Vladislav Balashov, Carol Leonard and Michael Clark, Pearce Wright, Science Editor, Penny Perrick, Jimmy Hill, Roger Nightingale, Clement Freud, Rodney Lord Economics Editor, Richard Wyndham, M. G. G. Pillai, John Watson,
... novels Mr Brian Brake Mr Mangestu Lemma Mrs Lilian Bilocca Mrs Lilian Bilicca Jesus said. I thank thee. O Father. ...
1988 - Gale Group | TDA
Lilian‐Lee B. Müller, Gerhard Zotz, Dirk C. Albach,
Genome size is known to vary widely across plants. Yet, the evolutionary drivers and consequences of genome size variation across organisms are far from understood. We investigated genome size variation and evolution in two major subfamilies of the Neotropical family Bromeliaceae by determining new genome size values for 83 species, testing phylogenetic signal in genome size variation, and assessing the fit to different evolutionary models. For a subset of epiphytic bromeliad species, we also evaluated ...
Tópico(s): Plant and animal studies
2019 - Nature Portfolio | Scientific Reports
Ian Key, Jonathan Northcroft, Kevin Dunn, Waldemar Januszczak, John Dugdale, Hala Jaber, Julia Llewellyn Smith, Maggie O'Farrell, Philip Green, Richard Brundle, Matthew Wall, Helena Frith Powell, Robin Egga, Nigel Botherway, Barbara Hall, Rev J Graham Smith, Kathleen Riley, David Mills, Peter Whittle, Helen Davies, Sally Brock, Rob Hughes, Jason Dawe, John Peter, Ross Noble, Professor Gideon Garter, Clarence Birdseye, Jonathan Miller, Jason Page, Andrew Longmore, Fred Beckett, Alexander Frater, Dr D Ian Calvert, Jane Mulkerrins, Susan d'Arcy, Gareth Walsh, Richard Thomas, Frank Whitford, Ivo Tennant, Reg Tripp, Frank Chapman's, Ferdinand Mount, David Gower, Kathryn Cooper, Sam Gilpin, Tim Ewington, Lucy Hughes-Hallett, David Smith, David Lovibond, Kenneth Wood, Roger Norman, Nick Pitt, Sarah Milstein, Jenny Morrison, Neil Wormald, Clive Davis, E P, Edward Hopper, Andrew Porter, Tony Allen-Mills, Simon Wilde, Alex Clarke, Tristram Hunt, Martin James, Tom Walker, Anthony Sattin, Bette Graham, Robert Winnett, Irwin Stelzer, Robert Hewison, Peter Wilson, Rosie Millard, Tom McEnaney, Lawrence Dallaglio, Neil Leighton, David Dougill, Dale DeGroff, Syed Rashid Husain, Christopher Hart, Matt Stevenson, Allen Esterson, Geoff Williams, David Hewson, Cally Law, David Bond, Sue Hyde, Hugh Canning, Alasdair Reid, Lewis Peake, Geraldine Hackett Education Correspondent, Margarette Driscoll, Jeremy Clarkson, Mike Pattenden, Edward Porter, David Cairns, Trevor Nelson, Nicola Smith, Stewart Lee, Michael Portillo, Richard Newton, Victoria Segal, Patricia Nicol, Anthony Peregrine, Sarah Dempster, Kelly Holmes, Dave Pollard, Kevin Jackson, Richard Fletcher, Lilian Pizzichini, Brian Rowe, Dr Barry Clayton, Bill Lewis, Adam Nathan, Andrew Porter Deputy Political Editor, Paul Bailey, Lizzie Enfield, Brendan Bourne, Mike Laws, Paul Ham, Stuart Wavell, Sarah-Kate Templeton, Roger Eglin, Paul Donovan, Peter Hounam, Mark Espiner, Pat Cash, Chris Barber, Chris Woodhead, Cosmo Landerson, Jasper Gerard, Derek Clements, Paul Driver, John Follain, Richard Brooks, Dr Alistair Sinclair, Julie Earle-Levine, Ian Hawkey, Sally Jones, Stuart Andrews, Peter Kemp, David Leppard, Shelley Von Strunckel, Paul Durman, Lisa Grainger, Mark Edwards, Heather Dixon, Rachel Bridge, Sarah Gracie, Trevor Hamley, Simon Periam, Paul Sexton, Donna H Pidgeon, Phil Baker, Christina Lamb, Krystian Zimerman, Lois Rogers, Sue Peakall, Raymond Keene, Mark Brownrigg Director-General, Mimi Spencer, David Cracknell, Cosmo Landesman, Nelly Sindayen, Zoe Brennan, Robbie Hudson, Diana Wright, Elizabeth Scott-Bawnann, Helen Hawkins, Dominic O'Connell, Barry Flatman, Nick Cain, Louise Armitstead, Edwina Currie, Michael Wright, Keith Cameron, Natalie Graham, D Wathen, Barry Now Combe, Andrew Baillie, Caroline Donald, Hugh McManners, Peter Hillary, Colin McDOWELL, Ian Critchley, David Walsh, Liat Joshi, G Doyle, Jack Grimston, Bryan Appleyard, Stephen Armstrong, John Elliott, Burlington Bertie, Michele Roberts, Victoria O'brien, Jonathan Leake Environment Editor, Geoff Carr, Richard Woods, Roland White, Roy Mather, Mohamed Farah, Shane Watson, Ali Allen, Andrew Frankel, Maurice Chittenden, Alex Fortune, Andrew Balding, Judith O'Reilly, Mark Franchetti, Richard Rae, David Doe, Jon Ungoed-Thomas, Dr Kevin Law, Ray Hutton, Sebastian Coe, John Crossland, Clare Francis, Ian Thomson, Dr David Green, Dipesh Gadher, Christina Lamb Kabul, John Waples, Hunter Davies, Levi Strauss, Jeremy Hart, A A Gill, John Exelby, Brian Glanville, Neville Burrows, Dr David Simcock, Bill Coltham, John Carey, David Horspool, Andrew Lycett, Nick Fielding, Stephen Pettitt, Jonathan Carr-Brown, Will Iredale, Jonathan Leake Science Editor, Willy Müller, Daisy Thomas, Justin Sparks, Sally Kinnes, Morris Marshall, Angus McCrone, Naomi Caine, Nigel Powell, David Wickers, Kevin Hackett, Daniel Emery, Graham Dunn, Brian Doogan, R B J T Allenby, John Aizlewood, Minette Marrin, Jeremy Lazell, Mark Hodson, Trevor McDonald, Joanne Robertson, Art Fry, Joe Lovejoy, Jonathan Futrell, Ian Caldwell, Graham Norwood, David Budworth, Rael Dornfest, Hugh Pearman, Andrew Davidson, Dan Cairns, Stewart Mitchell, David Smith Economics Editor, Rouzbeb Pirouz, Bob Dwyer, E Johnson, Matthew Goodman, David Robertson, India Knight, Katya Kabanova, Adrienna Connors, Simon Howard, Ed Hughes, Fiona Henderson, Barry Newcombe, Dominic Rushe, Richard Lewis, Percy Spencer, Karen Robinson,
Contents Vanunu: the truth about my kidnap Chancellor and Charles forge new alliance Contents The Sunday Times Contents Your Minicab Will Be Ten Minutes, ...
2004 - Gale Group | Sunday Times HA GDA
Lilian‐Lee B. Müller, Dirk C. Albach, Gerhard Zotz,
Epiphytic bromeliads represent a major component of Neotropical forests, but the potential effect of climate change on these plants is unclear. We investigated whether and how bromeliads are affected by the predicted 3°C temperature rise by the end of the century. We conducted growth experiments with 17 epiphytic bromeliad species at different temperatures to determine their fundamental thermal niches. By comparing those with niches for germination, we tested whether ontogenetic niche shift or niche ...
Tópico(s): Plant and animal studies
2017 - Wiley | New Phytologist
Srikumar Sen, Boxing Correspondent, Victoria McKee, Julia Llewellyn Smith, Jon Ashworth, H. M. Don, Takako Akashi, Andrew Pierce, D. C. Watt, Patricia Davies, Alison Roberts Arts Reporter, Jonathan Harrison, David Rhys Jones, Harvey Elliott, Philip Howard, Ben Preston, Education Correspondent, A. W. Macara, Chairman, David Smith, Roger Bushby, Jeremy Kingston, Alexandra Frean Media Correspondent, J. E. Meadows, Lynne Truss, David Lowry (Director), Sir Peter Yarranton, Chairman, Steve Deeley, Stewart Tendler, Crime Correspondent, Colin Narbrough, Geoff Brown, Philip Bassett Industrial Editor, Dr. Thomas Stuttaford, Arthur Leathley Political Correspondent, Martin Fletcher, Michael Dynes Whitehall Correspondent, Martin Biddle, M. W. M. Langran, Sean MacCARTHRIGH, Ben Macintyre and our Foreign Staff, Kris Anderson, Stewart Tendler Crime Correspondent, Alan Lorimer, Norman Hammond, Archaeology Correspondent, Peter Ball, John O'leary, Education Editor, Graham Duffill, Raymond Keene Chess Correspondent, Rob Hughes Football Correspondent, Richard Evans, Racing Correspondent, Peter Waymark, Jeremy Laurance Health Services Correspondent, Alan Hamilton, Daniel Johnson, Janet Bush and Philip Bassett, Robert Bruce, Ken Taylor, Ramnik Shah, Philip Robinson, Kevin Eason Motoring Correspondent, Lesley Abdela, F. J. R. Smith, David Hands, John Thompson, Sarah Bagnall, Colin McQUILLAN, Philip Bassett, Industrial Editor, Edward Gorman, Brian Ormshaw (Secretary), Derwent May, Patricia Tehan and Carl Mortished, Kate Muir, Joel Brand, Simon Wood, Susan Gilchrist, Colin Murray, Dr. James Le Fanu, Martyn Halle, Janet Daley, Sydney Friskin, Andy Lavender, David Watts and Sean MacCarthaigh, John Hopkins, Lucy Berrington, Dugald Barr, Kevin Eason and Michael Hornsby, Christina Koning, Wolfgang Münchau, Tim Jones, Transport Correspondent, Raymond Keene, Fred R. Shapiro, John F. Spellar, David Robinson, Peter Davalle, Emma Wilkins, Lesley Chamberlain, Sue Kernaghan, Paul Wilkinson, Lawrence Freedman, Jeremy Laurance Health Service Correspondent, Michael Dynes, Whitehall Correspondent, Edwina Currie, Craig Seton, Oliver Holt, Barry Pickthall, Roger Boyes, Peter Hodder, Anatole Kaletsky and Janet Bush, Kate Alderson, Norman Stone, Nicholas Wood, Chief Political Correspondent, Adam Fresco, Richard Duce, Christopher Thomas, William Rees-Mogg, Dominic Kennedy, David Churchill, Agence France-Presse, Nick Nuttall, Technology Correspondent, Sarah Bagnall and Jonathan Prynn, Nicholas Watt Ireland Correspondent, Roy Hill, Kevin McCarra, Janet Bush and Anatole Kaletsky, Alan Lee, Peter Riddell, Ben MacIntyre, Ian Brodie, Nadine Meisner, Phil Ridgway, Philip Pangalos, Stephen Pettitt, Michael Horsnell, Benedict Nightingale, Marianne Curphey, Hugh Thompson, Michael Evans Defence Correspondent, Michael Henderson, Anne McElvoy, Terence Henderson, Alan Jackson, Colin Campbell, Roy Foster, Reginald Hibbert, Walter Ellis, David Hands, Rugby Correspondent, Kenneth Miles, Director-General, Simon Oliver, Christopher Irvine, David Altheer,
... Theatre Cool look at porridge E. D. R. Lilian Baylis More acorns, please Resloution The Place Dance ... of north London Bosnich keeps Tottenham at bay Lee's consortium close to City deal For the ...
1994 - Gale Group | TDA
Xiaoyang Lan, David J. Jörg, Florence M.G. Cavalli, Laura M. Richards, Long Nguyen, Robert J. Vanner, Paul Guilhamon, Lilian Lee, Michelle Kushida, Davide Pellacani, Nicole I. Park, Fiona J. Coutinho, Heather Whetstone, Hayden Selvadurai, Clare Che, Betty Luu, Annaïck Carles, Michelle Moksa, Naghmeh Rastegar, Renee Head, Sonam Dolma, Panagiotis Prinos, Michael D. Cusimano, Sunit Das, Mark Bernstein, C.H. Arrowsmith, Andrew J. Mungall, Richard A. Moore, Yussanne Ma, Marco Gallo, Mathieu Lupien, Trevor J. Pugh, Michael D. Taylor, Martin Hirst, Connie J. Eaves, Benjamin D. Simons, Peter B. Dirks,
Human glioblastomas harbour a subpopulation of glioblastoma stem cells that drive tumorigenesis. However, the origin of intratumoural functional heterogeneity between glioblastoma cells remains poorly understood. Here we study the clonal evolution of barcoded glioblastoma cells in an unbiased way following serial xenotransplantation to define their individual fate behaviours. Independent of an evolving mutational signature, we show that the growth of glioblastoma clones in vivo is consistent with ...
Tópico(s): Single-cell and spatial transcriptomics
2017 - Nature Portfolio | Nature
James Landale, Phil Yates, Ben MacIntyre, Susan Bell and Michael Evans, Edward Gorman, Sailing Correspondent, Raymond Snoddy Media Editor, Helen Johnstone, Nick Nuttall, J. E. Humphrey, Robert Cole, Patricia Davies, Rob Hughes, Sarah Potter, Philip Webster and James Landale, Magnus Linklater, Mark Souster, David Rhys Jones, Clare Heath (Chairman), Ian A. Olson, Philip Howard, Janet Bush Economics Editor, Hilary Finch, Michael Binyon, Joanna Bale, Jeremy Kingston, Sheila McKechnie, Director, Alexandra Frean Social Affairs Correspondent, Oliver Holt Football Correspondent, Peter Foster, Carl Mortished, Michael Evans, Defence Editor, Tom Walker, Paul McGuinness, Christine Buckley Industrial Correspondent, Geoff Brown, Gerald Jacobs, Kevin Eason, Robert Sheehan, Bridge Correspondent, Roland Watson Political Correspondent, Joe Joseph, John O'Leary Education Editor, John Hopkins, Golf Correspondent, Dominic Walsh, Matthew Barbour, Raymond Keene Chess Correspondent, Jeanette Winterson, Peter Ackroyd, Peter Waymark, Richard Ford Home Correspondent, Amanda Loose, Robert Bruce, Michael Clark, Anatole Kaletsky, James Landale Political Correspondent, Janet Bush, Roland Watson, Anna Blundy, Ian McIntyre, Peter Barnard, Quentin R. V. Morris, Sharon Halford, Adam Jones and Ray Kennedy, Victoria Fletcher, Cyrus Mehta, Charles Bremner and Mark Henderson, Luke Clancy, Jasper Gerard, John Lawrence, James Niedel, Executive Director, Robert Cole City Correspondent, Wendy Jones, Director, Paul Durman, John Woodcock, Helen Wallace, Michael Theodoulou, Martin Fletcher, Chief Ireland Correspondent, Chris Smith, Marit Hargie, Barry Millington, Ilan Stavans, Celia Brayfield, Vaclav Havel, Stephen Wood, John Higgins, Alan McLoughlin, Adam Jones, Raymond Keene, Adam Sage, Lewis Smith, Matt Dickinson, Frances Gibb, Legal Correspondent, Alix Ramsay, Elaine Showalter, Reter Riddell, Elisabeth Luard, Richard Evans, Richard Owen, Sarah Cunningham, Nigel Hawkes, Science Editor, John Stern, Philip Webster, Political Editor, David Hands Rugby Correspondent, John Allison, Dominic Kennedy, Giles Whittell, James Pringle, Simon De Bruxelles, Saeed Shah, Alex O'Connell, Jason Nissé, Craig Lord, Mel Webb, Gerald Larner, Des Dearlove, Matthew Parris, Dominic Donald, Mike Rosewell, Geraldine Hamilton, Chris McGrath, George Caulkin, Michael Hornsby, Russell Jenkins, Alan Lee, Anthony Loyd, Ben MacIntyre, Ian Brodie, Neil Moore, Michael Dynes, John Avery Jones, Nadine Meisner, Philip Pangalos, Tim Jones, Michael Binyon, Diplomatic Editor, John McDonald, Martin Waller, Michael Horsnell, Chris Ayres, Carl Mortished International Business Editor, Benedict Nightingale, Alexandra Frean, Social Affairs Correspondent, D. M. B. Marquis, Sarah Cunningham Retail Correspondent, Dr Thomas Stuttaford, R. J. Fitzgerald, Stephen Dalton, Karl Johnston and Alasdair Reid, Jerem Kingston, Frances Gibb, James Christopher, Robert J. Waterhouse, Susie Steiner, James Wild, Jan Raath, Peter Hawker (Chairman), Peter Gilbert, Alasdair Murray, Economics Correspondent, Christopher Irvine, Christine Buckley, Industrial Correspondent,
... souls of the departed The River Midnight By Lilian Nattel Review, £12.99 ISBN 0 7472 2215 ... German failings Upbeat England turn to Croft Alan Lee detects a positive approach on eve of first ...
1998 - Gale Group | TDA
Nicole I. Park, Paul Guilhamon, Kinjal Desai, Rochelle F. McAdam, Ellen Langille, Madlen O’Connor, Xiaoyang Lan, Heather Whetstone, Fiona J. Coutinho, Robert J. Vanner, Erick K. M. Ling, Panagiotis Prinos, Lilian Lee, Hayden Selvadurai, Gurnit Atwal, Michelle Kushida, Ian D. Clarke, Véronique Voisin, Michael D. Cusimano, Mark Bernstein, Sunit Das, Gary D. Bader, C.H. Arrowsmith, Stéphane Angers, Xi Huang, Mathieu Lupien, Peter B. Dirks,
(Cell Stem Cell 21, 209–224; August 3, 2017) In our original paper, we mistakenly incorporated incorrect catalog information for the TUBB3 antibody into the Key Resources Table. The correct information is as follows: Resource, Anti-TUBB3 antibody (clone TU-20); Source, Millipore; Identifier, Cat#MAB1637; RRID: AB_2210524. We also mistakenly listed incorrect gRNA targeting sequences for ASCL1 in Table S7. The correct information is as follows: gRNA targeting sequence ASCL1 #1, GGAGCACGTCCCCAACGGCGCGG ...
Tópico(s): Circular RNAs in diseases
2017 - Elsevier BV | Cell stem cell
Caroline Conran, J. G. R., Calman, Alex Finer, Terry Delaney, Richard Buckle, Harold Hobson, John Clements, John Lambert, Pat Taylor, John Ballantine Reports, (Mrs) G McWhirr, Kenneth Pearson, Graham Rose, James Poole, W Blackman, Sybll Greatbatch, John Whale, Linda Kitson, Derek J Cartwright, Philip Oakes, Colin Simpson, Henry Brandon, John Russell, Jane Morton, Richard Milner, Deryk Brown, Cliff Temple, Nora Hearne, Derek Jewell, John Gretton, Vivian Jenkins, Egon Ronay, Murray Sayle, Peter Watson, Norman Harris, Frank Giles, Anne Corbett, Bryan Silcock Science Correspondent, Dick Adler, Robin Marlar, Lesley Garner, Hugh Somerville, Brian Moynaham, Thomas Hickman, Cyril Connolly, Jack Palance, Peter Townsend, H J Eysenck, Norman St John-Stevas, William Shawcross, Peter Lennon, Michael Howard, Maxwell Boyd, Kenneth Browne, Nicholas Carroll, (Mrs) S Davies, Peter Wilsher, John Whitley, Aziz Khan-Panni, Bryan Silcock, Eric Jacobs, A V Greaves, David Blake, Desmond Shawe-Taylor, Michael Peacock, Meriel McCooey, Edward de Bono Department of Investigative Medicine, Alan Brien, Gwen Nuttall, Michael Bateman, (Mrs) Carolyn Fallows, Patrick Rowley, Lanning Roper, Jean Robertson, Dilys Powell, Elkan Allan, Laurence Gandar, Hugo Young, Tim Brown, Dudley Doust, Felix Aprahamian, Robert McBride, Arnold Field, Margaret Costa, (Mrs) A Strickland-Clark, Stephen Fay, Lewis Chester, Susan Raven, Max Morris, J C Byle (Councillor), Peter Pringle, Richard Burnell, James Margach Political Correspondent, Christopher Ricks, Diane Munday, C. H. Dobinson, Tony Dawe, Brian Glanville, C D Darlington, Keith Richardson, David White, Lucia van der Post, Graham Searjeant, Roger Mortimer Reports, Tom Davies, C. H. O'd. Alexander, Maurice Wiggin, Nicholas Faith, Paul Overy, David Ball, Nicholas Faith Industrial Editor, Margery Fisher, Anne Robinson Sunday Times reporter, Pamela Macgregor-Morris, Malcolm Crawford, Vincent Hanna, Boris Schapiro,
... baby. Colne, Lancs Lord Reith would disapprove Tuesday Lilian is put in the picture Friday Well worth ... Prosper Group General Appointments Hill Samuel Group Robert Lee & Partners GKN Britain's largest international engineering… The ...
1971 - Gale Group | Sunday Times HA GDA
Nicole I. Park, Paul Guilhamon, Kinjal Desai, Rochelle F. McAdam, Ellen Langille, Madlen O’Connor, Xiaoyang Lan, Heather Whetstone, Fiona J. Coutinho, Robert J. Vanner, Erick K. M. Ling, Panagiotis Prinos, Lilian Lee, Hayden Selvadurai, Gurnit Atwal, Michelle Kushida, Ian D. Clarke, Véronique Voisin, Michael D. Cusimano, Mark Bernstein, Sunit Das, Gary D. Bader, C.H. Arrowsmith, Stéphane Angers, Xi Huang, Mathieu Lupien, Peter B. Dirks,
Glioblastomas exhibit a hierarchical cellular organization, suggesting that they are driven by neoplastic stem cells that retain partial yet abnormal differentiation potential. Here, we show that a large subset of patient-derived glioblastoma stem cells (GSCs) express high levels of Achaete-scute homolog 1 (ASCL1), a proneural transcription factor involved in normal neurogenesis. ASCL1hi GSCs exhibit a latent capacity for terminal neuronal differentiation in response to inhibition of Notch signaling, ...
Tópico(s): Cancer Cells and Metastasis
2017 - Elsevier BV | Cell stem cell
Srikumar Sen, Boxing Correspondent, Jakobovits, Jon Ashworth, Edward Gorman, Sailing Correspondent, David Levy, Andrew Eames, Philip Webster and Christopher Thomas, Helen Johnstone, Stella Shamoon, Richard Whitehead, Peter Talbot Willcox, Robert Cole, Alasdair Riley, Joanna Hunter, Brian Greer, Julian Muscat, Tennis Correspondent, Baba Ganoush, Patricia Davies, Peter Cadbury, Rob Hughes, Simon De Bruxelles and Nick Nuttall, Jane MacQuitty, Simon Barnes, Aldhelm, Magnus Linklater, John Morgan, Andrew Morgan, Somnath Mukhopadhyay, Clive King, P. C-P., Paul Hoggart, Mark Souster, Helen Szamuely, Karen Woolfson, Ivo Tennant, Gavin Lumsden, Philip Howard, T. O'Donell, Carol Midgley, Stewart Tendler and Daniel McGrory, Selma Shrank, Paul Ferris, Patrick Collinson, Joanna Bale, James Bone, Jeremy Kingston, Sheila McKechnie, Director, Clive Davis, Edward Welsh, Lynne Truss, T. S. Hollingsbee, Anne Robinson, Mrs G. Bramwich, Simon Wilde, William Hague, Tony Patrick, john diamond, Tom Walker, James Eve, L. J. Harris, Geoff Brown, P. C. -P., Nilgin Yusuf, Clare Stewart, Louise Godfrey, Martin Fletcher, Carl Evans, Jason Niss? And Sarah Cunningham, Pat Gibson, Julian Desborough, Madeleine Kingsley, Ruth Gledhill, Religion Correspondent, sheila keaing, Rupert Cox, Robert Sheehan, D. R., Steve Keenan, Caroline Merrell and Anne Ashworth, Jean-Christophe Novelli, Dominic Walsh, Ruth Gledhill, Debra Craine, Patrick Humphries, Marguerite Clarke, P. C., Ian Blake, Stephen Anderton's, Audrey Magee Ireland Correspondent, Carol Price, Richard Ford Home Correspondent, Sarah Cunningham, Retail Correspondent, Candida Crewe, Stephen Farrell, Robin Young, Peter Millar, Paddy Ashdown, Amanda Loose, Jenny MacArthur, Barbara Abbs, T. P., Anthony G. Phillips, John Young, James Bone's, Tony Blair, Frances Bissell, Mike Bradley, V. Sumner, Audrey Magee, David Hands, P. B., Michael Cable, Alan M. Calverd, Martin Symington, Jonathan Sacks, Peter Barnard, Mary Loudon, P. C-P, Ben Reed, Lizanne Rose, Clive Hollick, Nigel Williamson, Stephen Anderton, Paul Durman, Lisa Grainger, Helen Wallace, Lee Karen Stow, Judith Wilson, L. G., Lin Jenkins, Simon de Bruxelles, Peter Hillman, Magnus Grimond, David Watts, Adam Jones, Victoria O'Brien, Raymond Keene, Vaughan Freeman, Adam Sage, David Robinson, Alan Lee, Cricket Correspondent, John Russell Taylor, Matt Dickinson, P. W., Lucy Pinney, Anna Tims, Alix Ramsay, Paul Wilkinson, Martin Fletcher and Philip Webster, Kate Stronach, James Allcock, Angela Wilkes, Rajnikant J. Mehta, Jeannette Hyde, Richard Evans, Nigel Hawkes, Imogen Edwards-Jones, Caroline Merrell, Robin Neillands, Min Cooper, Susan Emmett and Gavin Lumsden, Oliver Holt, Richard Owen, Damian Whitworth, Sudi Pigott, Erica Wagner, David Driver, Clare Stewart and Mark Henderson, John Stern, Oliver August, Stewart Tendler, Stephanie Billen, Dalya Alberge, Oliver Holt, Football Correspondent, Peter van den Dungen, Christopher Thomas, Anne Ashworth, John Goodbody, Joanna Pitman, Jack Crossley, Giles Whittell, Simon De Bruxelles, Jane Shilling, Mel Webb, Kevin McCarra, Curtis Wilmot-Allistone, Mark Hodkinson, Amanda Craig, Chris McGrath, Tim Wapshott, Russell Jenkins, Michael Austin, Alan Lee, Sheila Keating, Jane Owen, Walter Gammie, Ben MacIntyre, Helen Pridham, Ved Mehta, Garry Lloyd, Jeannette Hyde Travel Editor, Michael Powell, Brian Glanville, Alan Lee Cricket Correspondent, Josa Young, Alan Jenkins, John Ransley, Philip Webster, David Bowker, Graham Searjeant, John Naish, Simon Jenkins, Anne Ashworth Personal Finance Editor, JRT, Mark Henderson, Martin Waller, Chris Ayres, Alasdair Murray and Michael Binyon, Peter Ingham, Danny Baker, Lottie Moggach, Lisa Verrico, Benedict Nightingale, Stephen McLarence, Stuart Birch, Tom Rhodes, Jill Crawshaw, Frances Gibb Legal Correspondent, Jack Bailey, John Parker, Tom Chesshyre, Arthur Leathley, Michael Henderson, Kathryn Mooney, Charlie Porter, Richard Miles Banking Correspondent, Cath Urquhart Travel Editor, Shona Crawford Poole, Hazel Spink, Conal Gregory, David Hands, Rugby Correspondent, Gill Hornby, Christopher Irvine, Terri Paddock, Susan Emmett,
... Monty… Breaking points Woman with Three Aeroplanes By Lilian Faschinger Review ?8.99 Aping her peers The ...
1998 - Gale Group | TDA
Lilian‐Lee B. Müller, Dirk C. Albach, Gerhard Zotz,
Summary By the end of this century, temperature is predicted to increase by about 6 °C at higher latitudes and about 3 °C in the tropics. Although values predicted for tropical latitudes are lower, rising temperatures in the tropics are likely to have more severe consequences for tropical species that are generally assumed to have narrower climatic niches due to a higher degree of climatic stability and higher niche specialization. Even though temperature affects all ontogenetic stages, the regeneration ...
Tópico(s): Ecology and Vegetation Dynamics Studies
2016 - Wiley | Journal of Ecology
Victor Louis, Geoffrey Grigson, Charles Raw, Richard Buckle, Oliver Stanley, Alan McElwain, Richard Milner City Editor, Alan Lee Williams, Harold Hobson, Edmund Crispin, Ellsworth Jones, John Lambert, Magnus Linklater, Graham Rose, Antony Terry, (Mrs) S. C. (Alix) Pigott, Roger Lewis City Reporters, L. E. Winterbottom, Philip Oakes, Henry Brandon, Vivian Lewis, John Russell, Richard Milner, Thomas O'Toole, David Divine, (Mrs) Pansy Headley, Ted Willis, Andrew Robertson, Edwin Morgan, Joseph Smiley, (Mrs) A. J. Shaw, Max Marquis, Timothy Giles, Joan Bateman, Murphy Steinberg, Philip Clarke, Derek Jewell, Patrick Campbell, Vivian Jenkins, Norman Harris, A V Dwyer, Neville K. Upton, Frank Giles, Robin Marlar, E. J. Toft, Brian Moynahan, Malcolm Crawford Economics Editor, Norman St John-Stevas, Jilly Cooper, Raymond Mortimer, Boris Schapiro, Maxwell Boyd, David Burg, Judith Jackson, Arthur Palmer Williams, Andrew Hale, Robert Hughes, Nicholas Evans, Geoffrey Sumner, D Ashton, Arthur Grey, Denis Herbstein, Peter Cranmer, Arnold Gregory, John Whitley, Roger Mortimer, Eric Jacobs, Anthony Greayer, Malcolm Winton, Adrian Parker, Ernestine Carter, Barbara Northcliffe MacDonald, Richard Garrick, Desmond Shawe-Taylor, Ann Frazer-Lunn, Sandy Boler, Gwen Nuttall, Stephen Aris, Margaret Bradley, Alexander Mitchell, Jean Robertson, Lanning Roper, Ronald Butt, Dilys Powell, John Lovesey, John Braine, Richard Hughes, William Rees-Mogg, David Wiggins, Timothy Johnson Technology Correspondent, Robin Sanders, Roger Lewis, Michael Field, Felix Aprahamian, Ian Nairn, Norman Lewis, Arnold Field, Graham Searjeant City Reporters, C. H. O'd Alexander, Henry Longhurst, David A Thornton, Dr Alfred Byrne Medical Correspondent, Peter Pringle, Evelyn Forbes, James Margach Political Correspondent, Derek Humphry, Brian Glanville, Michael Moynihan, Tony Dawe, Peter Hazelhurst, Lucia van der Post, Graham Searjeant, Michael Green, Maurice Wiggin, Nicholas Faith, Bob Millard, Tony Clifton, James Henderson, Harlow Unger, Charles Raw Financial Editor, Neville Maxwell, Nicholas Tomalin,
... am, therefore I create Romanticism in Perspective by Lilian R Furst MacMillan 75s Short List Egypt & Cromer ...
1969 - Gale Group | Sunday Times HA GDA
Sonam Dolma, Hayden Selvadurai, Xiaoyang Lan, Lilian Lee, Michelle Kushida, Véronique Voisin, Heather Whetstone, Milly So, Tzvi Aviv, Nicole Park, Xueming Zhu, Changjiang Xu, Renee Head, Katherine Rowland, Mark Bernstein, Ian D. Clarke, Gary D. Bader, Lea Harrington, John H. Brumell, Mike Tyers, Peter B. Dirks,
Glioblastomas (GBM) grow in a rich neurochemical milieu, but the impact of neurochemicals on GBM growth is largely unexplored. We interrogated 680 neurochemical compounds in patient-derived GBM neural stem cells (GNS) to determine the effects on proliferation and survival. Compounds that modulate dopaminergic, serotonergic, and cholinergic signaling pathways selectively affected GNS growth. In particular, dopamine receptor D4 (DRD4) antagonists selectively inhibited GNS growth and promoted differentiation ...
Tópico(s): Glioma Diagnosis and Treatment
2016 - Cell Press | Cancer Cell