Limpar
9.934 resultados

Acesso aberto

Tipo do recurso

Ano de criação

Produção nacional

Revisado por pares

Áreas

Idioma

Editores

Jornais Acesso aberto

Andrew Robson, James Doran and Laura Peek, Phil Yates, Jenne Mannion, Raymond Snoddy Media Editor, Edwina Curry, Gillian Mawrey, Helen Studd, Angus Porter, Robert Cole, Andrew Pierce, Bashir Khanbhai, Natasha Mann, James Moore, Peter Rowlett, Adam Sherwin Media Reporter, Frances Gibb Legal Editor, Leslie Iversen, Peter Lansley, Robert Thicknesse, Claire McDonald, Milton Keynes, Catherine Phlip, David Cleland, Nick Buswell, Simon Talt, Caroline Brannigan, Haversham Grange, Philip Howard, Hilary Finch, Jennal Cox Fitness Editor, David Chater, Michael Binyon, Rachel Campbell-Johnston, Nic Hopkins, Alexandra Frean Social Affairs Correspondent, Elizabeth Judge, Gabrielle Starkey, Rosalind Renshaw, Gillian Harris Scotland Correspondent, Louis Le Bailly, John Bungey, Kevin Eason, Sam Lister, Joe Joseph, Peter Brown, Antonia Senior, Valerie Elliott Countryside Editor, Andrew Duff, David McVay, Stewart Tendler Crime Correspondent, Ian Lamont, Dominic Walsh, Dramatis Personae, Susan Crosland, Roger Coombs, Gabrlella Gamini, Ruth Gledhill Religion Correspondent, Dalya Alberge Arts Correspondent, Nicholas Blanford, Alan Hamilton, Oliver Wright, John Burscough, Amanda Loose, Roland Watson, Charles Bremner, Chris Johnston, Matt Dickinson Chief Football Correspondent, Ian McIntyre, Mark Court, Patience Wheatcroft Business Editor, Derwent May, Angela Jameson, Richard Beeston, Roland Watson, James Bone and Michael Evans, Russell Kempson, Tony Halpin Education Editor, Jerome Burne, Oliver Kay, Jane Gordon, Lisa Armstrong, Tom Baldwin, Mark Henderson Science Correspondent, Karen Homer, Simon de Bruxelles, Geoffrey Dean, Rob Wright, Alison Roberts, James Parry, Martin Samuel, Raymond Keene, Peter Hawkins, Adam Sage, John Russell Taylor, Cheryl Taylor, Katie Owen, Rosemary Bennett Deputy Political Editor, Ann Hughes, Edwina Currie, Christoph Harwood, Chris Campling, Melissa Kite, Russell Hotten, Cathy Harris, Jain Finlayson, Richard Owen, Erica Wagner, Roger Boyes, Fenton Bresler, Nick Hasell, Andrew Norfolk and Laura Peek, David Hands Rugby Correspondent, Paul Simons, Michelle Henery, Nick Szczepanik, Mary Ann Sieghart, Melissa Kite Political Correspondent, Philip Webster Political Editor, Kevin McCarra, Russell Jenkins, John Shaw, Tim Parkinson, Peter Riddell, Lea Paterson Economics Editor, Lisa Armstrong's, Tony Dawe, David Charter Chief Political Correspondent, Brian Cruver, Simon Jenkins, Lea Paterson, Anne Ashworth Personal Finance Editor, Chris Ayres, Alan Coren, Nigel Hawkes Health Editor, Benedict Nightingale, David Wilkinson, Stephen Dalton, Hugh Thompson, Bill Edgar, Alice Miles, Ben MacIntyre Political Sketch, Benedict Birnberg, Alan Lee Racing Correspondent, Sally Patten, Edward Gorman Sailing Correspondent, Tim Johnston, Patience Wheatcroft, Trevor Trotman, David Lister Ireland Correspondent,

... Pink Richard Rogers Partnership PA to Managing Director Mitani UK Ltd. PA/Project Manager Proficient PA Administrative ...

2002 - Gale Group | TDA

Carta Acesso aberto Revisado por pares

Kuniaki Seyama, Keiko Mitani, Toshio Kumasaka, Shiv K. Gupta, Saji Oommen, Gang Liu, Jay H. Ryu, Nicholas E. Vlahakis,

... an association with lymphangiogenesis.4Kumasaka T Seyama K Mitani K Sato T Souma S Kondo T Hayashi ... Scopus (122) Google Scholar, 5Kumasaka T Seyama K Mitani K Souma S Kashiwagi S Hebisawa A Sato ... are VEGFR-3 positive.4Kumasaka T Seyama K Mitani K Sato T Souma S Kondo T Hayashi ... Scopus (122) Google Scholar, 5Kumasaka T Seyama K Mitani K Souma S Kashiwagi S Hebisawa A Sato ... anti-VEGFR-3 numerous times4Kumasaka T Seyama K Mitani K Sato T Souma S Kondo T Hayashi ... Scopus (122) Google Scholar, 5Kumasaka T Seyama K Mitani K Souma S Kashiwagi S Hebisawa A Sato ...

Tópico(s): Corporate Governance and Law

2010 - Elsevier BV | American Journal Of Pathology

Artigo Acesso aberto Revisado por pares

Kuniaki Mukai, Fumiko Mitani, Hideko Nagasawa, Reiko Suzuki, Tsuneharu Suzuki, Makoto Suematsu, Yuzuru Ishimura,

... the synthesis of corticosterone/cortisol, respectively (11Ogishima T. Mitani F. Ishimura Y. J. Biol. Chem. 1989; 264: ... 3353Crossref PubMed Scopus (78) Google Scholar, 18Miyamoto H. Mitani F. Mukai K. Suematsu M. Ishimura Y. Endocr. ... expression of Cyp11b-1 in zFR (23Mukai K. Mitani F. Shimada H. Ishimura Y. Mol. Cell. Biol. ... 6012Crossref PubMed Scopus (32) Google Scholar, 24Mukai K. Mitani F. Agake R. Ishimura Y. Eur. J. Biochem. ... recently (25Mukai K. Nagasawa H. Agake-Suzuki R. Mitani F. Totani K. Yanai N. Obinata M. Suematsu ...

Tópico(s): Steroid Chemistry and Biochemistry

2003 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Yoshinobu Kanda, Kinuko Mitani, Mineo Kurokawa, Tetsuya Yamagata, Yoshio Yazaki, Hisamaru Hirai,

... A. 1997; 94: 1408-1413Google Scholar, 5Kanda Y. Mitani K. Tanaka T. Tanaka K. Ogawa S. Yazaki ... A. 1994; 91: 12110-12114Google Scholar,5Kanda Y. Mitani K. Tanaka T. Tanaka K. Ogawa S. Yazaki ... epitope (TACCCATACGACGTCCCAGACTACGCT) in the EcoRI site (5Kanda Y. Mitani K. Tanaka T. Tanaka K. Ogawa S. Yazaki ... by firefly luciferase cDNA (16Tanaka T. Nishida J. Mitani K. Ogawa S. Yazaki Y. Hirai H. J. ... mutation in each TRE (16Tanaka T. Nishida J. Mitani K. Ogawa S. Yazaki Y. Hirai H. J. ... separated by the method described previously (5Kanda Y. Mitani K. Tanaka T. Tanaka K. Ogawa S. Yazaki ...

Tópico(s): Protein Degradation and Inhibitors

1998 - Elsevier BV | Journal of Biological Chemistry

Revisão Revisado por pares

John C. Mitani, David P. Watts, Martin N. Muller,

... the study of wild chimpanzee behavior John C. Mitani, John C. Mitani John C. Mitani is in the Department of Anthropology at the ... National Park, Uganda, in collaboration with Dr. John Mitani and Dr. Jeremiah Lwanga.Search for more papers ... for more papers by this author John C. Mitani, John C. Mitani John C. Mitani is in the Department of Anthropology at the ... National Park, Uganda, in collaboration with Dr. John Mitani and Dr. Jeremiah Lwanga.Search for more papers ...

Tópico(s): Animal Behavior and Reproduction

2002 - Wiley | Evolutionary Anthropology Issues News and Reviews

Artigo Acesso aberto Revisado por pares

Takehiro Kamiya, M. Tanaka, Namiki Mitani, Jian Feng, Masayoshi Maeshima, Toru Fujiwara,

... have been described (Ma, J. F., Yamaji, N., Mitani, N., Xu, X. Y., Su, Y. H., McGrath, ... have been described (Ma, J. F., Yamaji, N., Mitani, N., Xu, X. Y., Su, Y. H., McGrath, ... reported in rice (17Ma J.F. Yamaji N. Mitani N. Xu X.Y. Su Y.H. McGrath ... as described previously (17Ma J.F. Yamaji N. Mitani N. Xu X.Y. Su Y.H. McGrath ... 1006-1017Google Scholar, 17Ma J.F. Yamaji N. Mitani N. Xu X.Y. Su Y.H. McGrath ... Scholar, 27Ma J.F. Tamai K. Yamaji N. Mitani N. Konishi S. Katsuhara M. Ishiguro M. Murata ... Ma et al. (17Ma J.F. Yamaji N. Mitani N. Xu X.Y. Su Y.H. McGrath ...

Tópico(s): Aluminum toxicity and tolerance in plants and animals

2008 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Katsufumi Dejima, Akira Seko, Katsuko Yamashita, Keiko Gengyo‐Ando, Shohei Mitani, Tomomi Izumikawa, Hiroshi Kitagawa, Kazuyuki Sugahara, Souhei Mizuguchi, Kazuya Nomura,

... Nomura K.H. Dejima K. Gengyo-Ando K. Mitani S. Sugahara K. Nomura K. Nature. 2003; 423: ... by the UV/TMP method (33Gengyo-Ando K. Mitani S. Biochem. Biophys. Res. Commun. 2000; 269: 64- ... Nomura K.H. Dejima K. Gengyo-Ando K. Mitani S. Sugahara K. Nomura K. Nature. 2003; 423: ... Nomura K.H. Dejima K. Gengyo-Ando K. Mitani S. Sugahara K. Nomura K. Nature. 2003; 423: ... H. Nomura K. Tamura J. Gengyo-Ando K. Mitani S. Sugahara K. J. Biol. Chem. 2004; 279: ... H. Nomura K. Tamura J. Gengyo-Ando K. Mitani S. Sugahara K. J. Biol. Chem. 2004; 279: ...

Tópico(s): Parasites and Host Interactions

2006 - Elsevier BV | Journal of Biological Chemistry

Artigo Revisado por pares

Yong‐Tae Kim, Kazuyoshi Ohshima, Koichi Higashimine, Tomoya Uruga, Masaki Takata, Hiroyoshi Suematsu, Tadaoki Mitani,

... 5198, JapanSearch for more papers by this authorTadaoki Mitani Prof., Tadaoki Mitani Prof. mitani@jaist.ac.jp Department of Physical Materials Science, ... 5198, JapanSearch for more papers by this authorTadaoki Mitani Prof., Tadaoki Mitani Prof. mitani@jaist.ac.jp Department of Physical Materials Science, ...

Tópico(s): Graphene research and applications

2005 - Wiley | Angewandte Chemie

Artigo Acesso aberto Revisado por pares

Akihiro Shima, Heinz Himmelbauer, Hiroshi Mitani, Makoto Furutani‐Seiki, Joachim Wittbrodt, Manfred Schartl,

... Search for more papers by this author Hiroshi Mitani Hiroshi Mitani University of Tokyo, School of Science, 5-1- ... Search for more papers by this author Hiroshi Mitani Hiroshi Mitani University of Tokyo, School of Science, 5-1- ... the detection of radiation-induced DNA mutations. H. Mitani (Kashiwa City, Japan) reported that, in an effort ... Medaka EST database, Mbase (A. Shima and H. Mitani), to allow direct access to an expression pattern ...

Tópico(s): Genomics and Chromatin Dynamics

2003 - Springer Nature | EMBO Reports

Capítulo de livro Revisado por pares

Yoshizumi Miyoshi, Takayuki Ono, Takeshi Takashima, K. Asamura, Masafumi Hirahara, Yasumasa Kasaba, Ayako Matsuoka, Hirotsugu Kojima, K. Shiokawa, K. Seki, M. Fujimoto, Tsutomu Nagatsuma, C. Z. Cheng, Y. Kazama, Satoshi Kasahara, Takefumi Mitani, Haruhisa Matsumoto, Nana Higashio, Atsushi Kumamoto, Satoshi Yagitani, Yoshiya Kasahara, Keigo Ishisaka, L. G. Blomberg, Akiko Fujimoto, Yuto Katoh, Yusuke Ebihara, Yoshiharu Omura, M. Nosé, Tomoaki Hori, Yukinaga Miyashita, Yoshimasa Tanaka, Takehiko Segawa,

... Sagamihara, JapanSearch for more papers by this authorT. Mitani, T. Mitani Institute of Space and Astronautical Science, Japan Aerospace ... Sagamihara, JapanSearch for more papers by this authorT. Mitani, T. Mitani Institute of Space and Astronautical Science, Japan Aerospace ... Space Res., 43, 792–801. Kasahara, S., T. Mitani, K. Ogasawara, T. Takashima, M. Hirahara, and K. ...

Tópico(s): Astro and Planetary Science

2013 - American Geophysical Union | Geophysical monograph

Artigo Acesso aberto Revisado por pares

Kenji Tatsumi, Yasumasa Mitani, Jun Watanabe, Hideki Takakura, Kanako Hoshi, Yuki Kawai, Takeshi Kikuchi, Yasushi Kogo, Atsuko Oguchi-Katayama, Yasuhiro Tomaru, Hajime Kanamori, Masaru Baba, Takefumi Ishidao, Kengo Usui, Masayoshi Itoh, Paul E. Cizdziel, Alexander Lezhava, Michio Ueda, Yasushi Ichikawa, Itaru Endo, Shinji Togo, Hiroshi Shimada, Yoshihide Hayashizaki,

... of specific somatic mutations.2Hoshi K Takakura H Mitani Y Tatsumi K Momiyama N Ichikawa Y Togo ... CP for suppression of background amplification.15Watanabe J Mitani Y Kawai Y Kikuchi T Kogo Y Oguchi- ... 151) Google Scholar EGFR,2Hoshi K Takakura H Mitani Y Tatsumi K Momiyama N Ichikawa Y Togo ... Scopus (81) Google Scholar and UGT1A1.15Watanabe J Mitani Y Kawai Y Kikuchi T Kogo Y Oguchi- ... variations on SMAP-2 including CP usage15Watanabe J Mitani Y Kawai Y Kikuchi T Kogo Y Oguchi- ...

Tópico(s): Cancer Genomics and Diagnostics

2008 - Elsevier BV | Journal of Molecular Diagnostics

Artigo Revisado por pares

Curt D. Busse,

... 10.1016/j.anbehav.2009.06.030John C. Mitani Cooperation and competition in chimpanzees: Current understanding and ... 10.1016/j.anbehav.2006.01.013John C. Mitani Demographic influences on the behavior of chimpanzees, Primates ... s10329-005-0139-7Martin N. Muller, John C. Mitani Conflict and Cooperation in Wild Chimpanzees, (Jan 2005): ... 10.1007/0-306-47461-1_11John C. Mitani, David P. Watts, Martin N. Muller Recent developments ... https://doi.org/10.1002/evan.10008John C. Mitani, David P. Watts Why do chimpanzees hunt and ...

Tópico(s): Animal Behavior and Reproduction

1978 - University of Chicago Press | The American Naturalist

Artigo Acesso aberto Revisado por pares

Yohsuke Ohba, Takeshi Sakuragi, Eriko Kage‐Nakadai, Naoko H. Tomioka, Nozomu Kono, Rieko Imae, Asuka Inoue, Junken Aoki, Naotada Ishihara, Takao Inoué, Shohei Mitani, Hiroyuki Arai,

... Search for more papers by this author Shohei Mitani Shohei Mitani Department of Physiology, Tokyo Women's Medical University ... Search for more papers by this author Shohei Mitani Shohei Mitani Department of Physiology, Tokyo Women's Medical University ...

Tópico(s): Metabolism and Genetic Disorders

2013 - Springer Nature | The EMBO Journal

Artigo Revisado por pares

Hiroshi Danjo, N. Mitani, Y. Muraki, Masatoshi Kawahata, Isao Azumaya, Kentaro Yamaguchi, Toshifumi Miyazawa,

... Japan)Search for more papers by this authorNatsuyo Mitani, Natsuyo Mitani Department of Chemistry, Faculty of Science and Engineering, ... Japan)Search for more papers by this authorNatsuyo Mitani, Natsuyo Mitani Department of Chemistry, Faculty of Science and Engineering, ...

Tópico(s): Supramolecular Chemistry and Complexes

2012 - Wiley | Chemistry - An Asian Journal

Artigo Acesso aberto Revisado por pares

Mario Halić, Danesh Moazed,

... Wolfswinkel J.C. Chaves D.A. Shirayama M. Mitani S. Ketting R.F. et al.Cell. 2009; ... Wolfswinkel J.C. Chaves D.A. Shirayama M. Mitani S. Ketting R.F. et al.Cell. 2009; ... Wolfswinkel J.C. Chaves D.A. Shirayama M. Mitani S. Ketting R.F. et al.Cell. 2009; ... Wolfswinkel J.C. Chaves D.A. Shirayama M. Mitani S. Ketting R.F. et al.Cell. 2009; ... Wolfswinkel J.C. Chaves D.A. Shirayama M. Mitani S. Ketting R.F. et al.Cell. 2009; ...

Tópico(s): RNA Interference and Gene Delivery

2009 - Elsevier BV | Molecular Cell

Artigo Acesso aberto Revisado por pares

Takuya Araki, Kimihiro Shimizu, Katsunori Nakamura, Tomonori Nakamura, Yasumasa Mitani, Kyoko Obayashi, Yukiyoshi Fujita, Seiichi Kakegawa, Yohei Miyamae, Kyoichi Kaira, Takefumi Ishidao, Alexander Lezhava, Yoshihide Hayashizaki, Izumi Takeyoshi, Koujirou Yamamoto,

... in pancreatic cancer samples.15Hoshi K Takakura H Mitani Y Tatsumi K Momiyama N Ichikawa Y Togo ... 4983Crossref PubMed Scopus (81) Google Scholar, 16Tatsumi K Mitani Y Watanabe J Takakura H Hoshi K Kawai ... L PNA clamp probe (Table 1),16Tatsumi K Mitani Y Watanabe J Takakura H Hoshi K Kawai ... samples from patients with pancreatic cancer.16Tatsumi K Mitani Y Watanabe J Takakura H Hoshi K Kawai ...

Tópico(s): Cancer Genomics and Diagnostics

2009 - Elsevier BV | Journal of Molecular Diagnostics

Artigo Acesso aberto Revisado por pares

Takahiro Kanamori, Takao Inoue, Taro Sakamoto, Keiko Gengyo‐Ando, Masafumi Tsujimoto, Shohei Mitani, Hitoshi Sawa, Junken Aoki, Hiroyuki Arai,

... Search for more papers by this author Shohei Mitani Shohei Mitani CREST, Japan Science and Technology Agency, Saitama, Japan ... Search for more papers by this author Shohei Mitani Shohei Mitani CREST, Japan Science and Technology Agency, Saitama, Japan ...

Tópico(s): Plant Molecular Biology Research

2008 - Springer Nature | The EMBO Journal

Artigo Revisado por pares

Miya Ishihara, Masato Sato, Nagatoshi Kaneshiro, Genya Mitani, Shunichi Sato, Joji Mochida, Makoto Kikuchi,

... 1193, JapanSearch for more papers by this authorGenya Mitani MD, Genya Mitani MD Department of Orthopaedic Surgery, Tokai University School ... 1193, JapanSearch for more papers by this authorGenya Mitani MD, Genya Mitani MD Department of Orthopaedic Surgery, Tokai University School ...

Tópico(s): Photoacoustic and Ultrasonic Imaging

2006 - Wiley | Lasers in Surgery and Medicine

Artigo Revisado por pares

Shinya Hayami, Yuji Shigeyoshi, Motoko Akita, Katsuya Inoue, Kenichi Kato, Keiichi Osaka, Masaki Takata, Ryo Kawajiri, Tadaoki Mitani, Yonezo Maeda,

... 1292, JapanSearch for more papers by this authorTadaoki Mitani Prof. Dr., Tadaoki Mitani Prof. Dr. Japan Advanced Institute of Science and ... 1292, JapanSearch for more papers by this authorTadaoki Mitani Prof. Dr., Tadaoki Mitani Prof. Dr. Japan Advanced Institute of Science and ...

Tópico(s): Electron Spin Resonance Studies

2005 - Wiley | Angewandte Chemie International Edition

Carta Acesso aberto Revisado por pares

Yukihiro Arai, Jiro Tadokoro, Kinuko Mitani,

... Tochigi, JapanSearch for more papers by this authorKinuko Mitani, Kinuko Mitani Department of Hematology, Dokkyo University School of Medicine, ... Tochigi, JapanSearch for more papers by this authorKinuko Mitani, Kinuko Mitani Department of Hematology, Dokkyo University School of Medicine, ...

Tópico(s): CNS Lymphoma Diagnosis and Treatment

2005 - Wiley | American Journal of Hematology

Artigo Revisado por pares

Katsufumi Sato, Yoko Mitani, Yasuhiko Naito, H Kusagaya,

... protected]Search for more papers by this authorY. Mitani, Y. Mitani The Graduate University for Advanced Studies, 1–9– ... protected]Search for more papers by this authorY. Mitani, Y. Mitani The Graduate University for Advanced Studies, 1–9– ...

Tópico(s): Cephalopods and Marine Biology

2003 - Wiley | Marine Mammal Science

Artigo Revisado por pares

Junji Saito, Makoto Mitani, Mitsuhiko Onda, Jun‐ichi Mohri, Seiichi Ishii, Yasunori Yoshida, Takashi Nakano, Hidetsugu Tanaka, Tomoaki Matsugi, Shin‐ichi Kojoh, Norio Kashiwa, Terunori Fujita,

... 64-2375Search for more papers by this authorMakoto Mitani, Makoto Mitani Mitsui Chemicals, Inc., 580-32 Nagaura, Sodegaura, Chiba ... 64-2375Search for more papers by this authorMakoto Mitani, Makoto Mitani Mitsui Chemicals, Inc., 580-32 Nagaura, Sodegaura, Chiba ...

Tópico(s): Synthetic Organic Chemistry Methods

2001 - Wiley | Macromolecular Rapid Communications

Artigo Acesso aberto Revisado por pares

Mineo Kurokawa,

... Search for more papers by this author Kinuko Mitani Kinuko Mitani Department of Hematology and Oncology, Graduate School of ... Search for more papers by this author Kinuko Mitani Kinuko Mitani Department of Hematology and Oncology, Graduate School of ... transcriptionally activated as the AML1–Evi-1 chimera (Mitani et al., 1994). Many lines of evidence suggest ...

Tópico(s): Ubiquitin and proteasome pathways

2000 - Springer Nature | The EMBO Journal

Artigo Revisado por pares

Hiroshi Sunose, Masaru Toshima, Shinji Mitani, Masaaki Suzuki, Fumiaki Yoshida, Tomonori Takasaka,

... Fukushima, JapanSearch for more papers by this authorShinji Mitani MD, Shinji Mitani MD Department of Neurosurgery, Iwaki Kyoritsu General Hospital, ... Fukushima, JapanSearch for more papers by this authorShinji Mitani MD, Shinji Mitani MD Department of Neurosurgery, Iwaki Kyoritsu General Hospital, ...

Tópico(s): Hearing, Cochlea, Tinnitus, Genetics

2000 - Wiley | Otolaryngology

Artigo Revisado por pares

Tsutomu Douchi, Mitsuhiro Yoshinaga, Mari Katanozaka, Minoru Mitani, Yukihiro Nagata,

... Kagoshima, JapanSearch for more papers by this authorMinoru Mitani, Minoru Mitani From the Department of Obstetrics and Gynecology, Faculty ... Kagoshima, JapanSearch for more papers by this authorMinoru Mitani, Minoru Mitani From the Department of Obstetrics and Gynecology, Faculty ...

Tópico(s): Endometrial and Cervical Cancer Treatments

1998 - Informa | Acta Obstetricia Et Gynecologica Scandinavica

Artigo Revisado por pares

Arata Horii, Kazuo Shimamura, Yuichiro Honjo, Kenji Mitani, Tomohiro Miki, Shodayu Takashima, Junichi Yoshida,

... 543, JapanSearch for more papers by this authorKenji Mitani MD, Kenji Mitani MD Department of Otolaryngology, Head and Neck Surgery, ... 543, JapanSearch for more papers by this authorKenji Mitani MD, Kenji Mitani MD Department of Otolaryngology, Head and Neck Surgery, ...

Tópico(s): Acute Myeloid Leukemia Research

1997 - Wiley | Head & Neck

Artigo Acesso aberto Revisado por pares

Tomoyuki Tanaka, Kozo Tanaka, Seishi Ogawa, Mineo Kurokawa, Kinuko Mitani, Junji Nishida, Yoshihiro Shibata, Y Yazaki, Hisamaru Hirai,

... Search for more papers by this author K. Mitani K. Mitani Third Department of Internal Medicine, Faculty of Medicine, ... Search for more papers by this author K. Mitani K. Mitani Third Department of Internal Medicine, Faculty of Medicine, ...

Tópico(s): Epigenetics and DNA Methylation

1995 - Springer Nature | The EMBO Journal

Artigo Acesso aberto Revisado por pares

Kinuko Mitani, Seishi Ogawa, Tetsuhiro Tanaka, Hiroyuki Miyoshi, Mineo Kurokawa, Hiroyuki Mano, Y Yazaki, Masafumi Ohki, Hisamaru Hirai,

... causes blastic crisis in chronic myelocytic leukemia. K. Mitani K. Mitani Third Department of Internal Medicine, Faculty of Medicine, ... Search for more papers by this author K. Mitani K. Mitani Third Department of Internal Medicine, Faculty of Medicine, ...

Tópico(s): Chronic Myeloid Leukemia Treatments

1994 - Springer Nature | The EMBO Journal

Artigo Revisado por pares

Kiyotsugu Higashi, Mayumi Seike, Yoko Mitani, Katsuhiko Morisaki, Shinichi Hayashi, Masahiro Kitamura, Naoki Fujimoto, Shigenobu Kimura, Shigeyuki Ebisu, Hiroshi Okada,

... Co., OsakaSearch for more papers by this authorYoko Mitani, Yoko Mitani Research and Development Divn., Rohto Pharmaceutical Co., OsakaSearch ... Co., OsakaSearch for more papers by this authorYoko Mitani, Yoko Mitani Research and Development Divn., Rohto Pharmaceutical Co., OsakaSearch ...

Tópico(s): Drug-Induced Adverse Reactions

1989 - Wiley | Journal of Periodontal Research

Artigo Revisado por pares

Erik McIntosh, Fumiko Mitani, V. I. Užgiris, Hilton A. Salhanick, Carmen Castilho Alonso,

... Massachusetts 02115Search for more papers by this authorF. Mitani, F. Mitani Department of Population Sciences and Center for Population ... Massachusetts 02115Search for more papers by this authorF. Mitani, F. Mitani Department of Population Sciences and Center for Population ...

Tópico(s): Vector-borne infectious diseases

1973 - Wiley | Annals of the New York Academy of Sciences