From Michael Binyon, , By Derek Harris Commercial Editor, By Henry Stanhope Diplomatic Correspondent, By Craig Seton, Donald Macintyre, By Our Labour Editor, By Anthony Bevins Political Correspondent, By Richard Evans Lobby Reporter, By Julian Haviland, Political Editor, By Rodney Cowton, Defence Correspondent, By David Felton, Labour Correspondent, By Our Political Editor, By John Lawless, From Tim Jones, , By Our Labour Correspondent, By Thomson Prentice, Science Correspondent, By John Young, Agriculture Correspondent, By Nicholas Timmins, Social Services Correspondent, By Michael Horsnell, By Tony Samstag, By Lucy Hodges Education Correspondent, By Nicholas Timmins Social Services Correspondent, From Peter Davenport, , From Paul Routledge, From Keith Dalton, , From John Earle, From Richard Wigg, , From David Watts, By Caroline Moorehead, From Mario Modiano, From Edward Mortimer, , From Richard Ford, , From Our Own Correspondent, , From Diana Geddes, From Richard Wigg, From Jan Raath, , From David Bernstein, , From Robert Fisk, From John Carlin, , Hermosillo, , Sonora, , From Vijitha Yapa, From Alan Tomlinson, From Michael Hornsby, , John Russell Taylor, Nicholas Shakespeare, Richard Morrison, John Percival, Martin Cropper, Anthony Clare, Alan Ponsford, David Hewson, Suzy Menkes, PHS, by Tom King, Frank Johnson, Patrick Cosgrave, Miles Kington, SHEILA McKECHNIE, , JOHN SOUTHGATE, , JENNIFER TANFIELD, , J. C. WINTHER, , LESLIE MAVOR, FRANK GRIMSHAW, , J.L BOWRON, , JON V. PEPPER, , G. F. WOOD, , SHEENA DAVID, , By Geraldine Norman Sale Room Correspondent, By Pearce Wright, Science Editor, Executive Editor Kenneth Fleet, From Maxwell Newton, By William Kay, City Editor, By Patience Wheatcroft, By David Smith Economics Correspondent, From David Young, , By Alison Eadie, From Bailey Morris, By Jeremy Warner, Peter Wilson-Smith, By Pam Spooner, Jeremy Warner, Bill Johnstone Technology Correspondent, BJ, DH, David Hewson Arts Correspondent, By Geof Wheelwright, By Paul Walton, By Danny Green, By Bill Johnstone Technology Correspondent, By Kevan Pearson, By Edward Fennell, By Geoffrey Ellis, By Tony Dennis, By John Woodcock, Cricket Correspondent, By Peter Ball, By Marcus Williams, By Ivo Tennant, By John Woodcock, By Alan Gibson, By Richard Streeton, By John Nicholls, From John Wilcockson, , By Our Shooting Correspondent, John Clemison, From Pat Butcher, , By Mandarin(Michael Phillips), Peter Dear, Peter Davalle, From Diana Geddes, , David Watts,
... IDB listing, London Filnancial Futures, High costs delaying PBX revolution, Wight Collins raises profits by 55%, Job ...
1985 - Gale Group | TDA
Masatomo Kaneko, Luis G. Medina, Maria Sarah L. Lenon, Sij Hemal, Aref S. Sayegh, Donya S. Jadvar, Lorenzo Storino Ramacciotti, Divyangi Paralkar, Giovanni Cacciamani, Amir H. Lebastchi, Bodour Salhia, Manju Aron, Michelle Hopstone, Vinay Duddalwar, Suzanne L. Palmer, Inderbir S. Gill, Andre Luis Abreu,
... MRI) and transrectal ultrasound (TRUS) fusion prostate biopsy (PBx). Consecutive men who underwent prostate MRI followed by ... PIRADS) 3-5 lesions. Men who underwent TP PBx were matched 1:2 with a synchronous cohort undergoing TR PBx by PSA, Prostate volume (PV) and PIRADS score. ... the inclusion criteria. A total of 168 TP PBx were pair-matched to 336 TR PBx patients. Baseline demographics and imaging characteristics were similar ... for PIRADS 3-5, on TP vs TR PBx, respectively. Per lesion, the CSPCa detection for PIRADS ...
Tópico(s): Urologic and reproductive health conditions
2023 - Nature Portfolio | Scientific Reports
Shixiong Chen, Hua Qian, Bingxin Liu, Feiyang Xu, Jiuhou Rui, Dabin Liu,
... on the safety and mechanical properties of pressed PBX, different RDX-based PBXs were prepared by a water suspension granulation method. ... properties of high-quality RDX (H-RDX) and PBX were characterized by SEM, optical microscope, DSC, impact ... RDX. The activation energy of H-RDX-based PBX is 26.0% higher than that of raw RDX-based PBX, and H50 increased by 2.8 cm, indicating that the application of H-RDX to PBX can effectively improve its thermal stability and reduce ... the compressive strength of pressed H-RDX-based PBX is 36% lower than that of pressed raw ...
Tópico(s): Polymer crystallization and properties
2022 - Multidisciplinary Digital Publishing Institute | Materials
Eric K. Anderson, Carlos Chiquete, Scott I. Jackson,
... explosive. This phenomena is observed for the explosive PBX 9502 (95 wt% TATB) both for planar and ... charge is comprised of a faster core of PBX 9501 (95 wt% HMX) inside a slower annulus of PBX 9502. The detonation in the faster PBX 9501 drives an oblique shock into the adjacent PBX 9502, and an annular transverse initiating layer (IL) ... beyond the IL, an annular region of detonating PBX 9502 is observed. Using standard CYLEX test diagnostics, ... energy release is comprised of contributions from detonating PBX 9501, detonating PBX 9502, and the IL in ...
Tópico(s): High-Velocity Impact and Material Behavior
2020 - Elsevier BV | Proceedings of the Combustion Institute
Jiahui Liu, Zhi‐Jian Yang, Shijun Liu, Jianhu Zhang, Yonggang Liu,
... properties of a TATB‐based polymer bonded explosive (PBX) were studied by using five different fluoropolymers as ... the three‐point bending creep property of the PBX. F‐ binder A, which was composed of vinylidene fluoride (VDF) and chlorotrifluoroethylene (CTFE), endowed the PBX−A with the best mechanical strength and creep resistance ability. The fracture surfaces of the PBXs after the Brazilian tests were investigated by a ... electron microscope (FE‐SEM). The rupture mode in PBX−A and PBX−B was transcrystalline fracture together ...
Tópico(s): High-pressure geophysics and materials
2018 - Wiley | Propellants Explosives Pyrotechnics
Wei Deng, Longhua Xu, Jia Tian, Yuehua Hu, Yuexin Han,
... the presence of pre-adsorbed potassium butyl xanthate (PBX) is investigated. The micro-flotation results show that ... talc and that conditioning the minerals initially with PBX before KG will increase the recovery difference between ... minerals show that compared with adding KG before PBX, when minerals are pre-adsorbed with PBX, the grade and the recovery of sulfur (S) ... contact angle results show that the addition of PBX before KG will increase the contact angles of pyrite, but the addition order of KG/PBX has little influence on the contact angles of ...
Tópico(s): Pickering emulsions and particle stabilization
2017 - Multidisciplinary Digital Publishing Institute | Minerals
Pingfang Yan, Gangquan Chen, Maoyou Ye, Shuiyu Sun, Hongtao Ma, Weixiong Lin,
... flotation wastewater containing residual potassium n-butyl xanthate (PBX) must be treated because of its biotoxicity, stench, ... with ozone is an effective approach to remove PBX from wastewater. Therefore, the pathways of this pollutant ... oxygen and air source ozone generators) on the PBX removal was studied. The conversion pathways of carbon and sulfur of PBX after complete oxidation are also discussed. The studies conducted using different ozone sources showed high PBX removal rate in both the cases. With increasing ...
Tópico(s): Analytical chemistry methods development
2016 - Elsevier BV | Journal of Cleaner Production
Angelika Borkowetz, Ivan Platzek, Marieta Toma, Theresa Renner, Roman Herout, Martin Baunacke, Michael Laniado, Gustavo Baretton, Michael Froehner, Stefan Zastrow, Manfred P. Wirth,
... of both targeted MRI/ultrasonography-fusion prostate biopsy (PBx) and systematic PBx with final histology of the radical prostatectomy (RP) ... PCa) histopathologically proven using a combination of fusion Pbx and systematic PBx, who underwent RP, were investigated. All patients had ... RP specimen were compared with those from the PBx. Whole-mount RP specimen and mpMRI results were ... with histopathologically proven PCa by combination of fusion PBx and systematic PBx, the detection rate of PCa was 90% (94/105) in fusion PBx alone and 68% (72/105) in systematic PBx ...
Tópico(s): Prostate Cancer Treatment and Research
2016 - Wiley | BJU International
Eric K. Anderson, Tariq D. Aslam, Scott I. Jackson,
... insensitive high explosive. Tests were conducted with a PBX 9502 slab bonded on one side to a PBX 9501 slab. For each test, a detonation in the PBX 9501 was generated to drive an oblique shock intended to initiate the PBX 9502. Shocks of sufficient strength generated an initiating ... or region of delayed reaction (relative to typical PBX 9502 detonation reaction timescales) in the PBX 9502 immediately adjacent to the PBX 9501. These reactions result in a transition to ... dimensional (1D) explosive configurations. The thickness of the PBX 9501 layer was varied from 0.5–2. ...
Tópico(s): High-Velocity Impact and Material Behavior
2014 - Elsevier BV | Combustion and Flame
JaeSeung Song, Hyoungshick Kim, Athanasios Gkelias,
... softphone [9], controlling a telephone private branch exchange (PBX) [10]–[11], or using an online service (for ... SIP messages access the IP network through a PBX. An SIP/ISUP interworking gateway (GW) is then ... name of their own caller ID at the PBX. In the example in Fig. 1, the original ... caller ID spoofing is usually performed at the PBX, before the mapping between SIP and ISUP takes ... a call through the interworking GW to the PBX that manages the actual caller ID associated with ... c. It forwards the CIV message to the PBX (PBX2 in Fig. 2) that corresponds to the ...
Tópico(s): Spam and Phishing Detection
2014 - Electronics and Telecommunications Research Institute | ETRI Journal
Zizhen Yao, Gist H. Farr, Stephen J. Tapscott, Lisa Maves,
... those encoding muscle contractile proteins. We hypothesize that Pbx homeodomain proteins direct Myod to a subset of ... cells to differentiate. We have previously shown that Pbx proteins bind with Myod on the promoter of the zebrafish fast muscle gene mylpfa and that Pbx proteins are required for Myod to activate mylpfa ... embryos. Here we have investigated the interactions of Pbx with another muscle fiber-type regulator, Prdm1a, a ... fast muscle differentiation, is the opposite of the Pbx-null phenotype, delayed and reduced fast muscle differentiation. ...
Tópico(s): Zebrafish Biomedical Research Applications
2013 - The Company of Biologists | Biology Open
Bernard Malavaud, Olivier Cussenot, Nicolas Mottet, François Rozet, A. Ruffion, Louis Smets, Herman Stoevelaar,
... may be instrumental in taking appropriate prostate biopsy (PBx) decisions, mainly for repeat PBx. This study determined the cost/benefit balance of introducing PCA3 in the decision-making for PBx in France.Two RAM models, without and with ... a sample of 808 French men who had PBx in 2010 (78% first, 22% repeat). Outcome measures included the proportion of PBx that could have been avoided (i.e., judged ... of these models on the annual number of PBx and associated costs for France (based on most ... men. In the model without PCA3, 2% of PBx were deemed inappropriate. Knowledge of PCA3 would have ...
Tópico(s): Health Systems, Economic Evaluations, Quality of Life
2012 - Informa | Journal of Medical Economics
Katsumi Shigemura, Tomihiko Yasufuku, Minoru Matsumoto, Yoshihisa Kinoshita, Kunito Yamanaka, Masuo Yamashita, Yuzo Nakano, Kazushi Tanaka, Sochi Arakawa, Masato Fujisawa,
... CitationsPermissionsReprints ShareFacebookTwitterLinked InEmail INTRODUCTION AND OBJECTIVES Prostate biopsy (PBx) is a routine procedure for the detection of ... may happen a problem of febrile complications after PBx especially in transrectal approach. This is partly because ... been often used for this prophylactic purpose for PBx and has a good concentration in prostrate after ... is the comparison study regarding prophylactic medication of PBx with three categories: 1) penicillin including beta-lactamase ...
Tópico(s): Genital Health and Disease
2010 - Lippincott Williams & Wilkins | The Journal of Urology
Curtis R. French, Timothy Erickson, Davon C. Callander, K. Berry, Ron Koss, Daniel W. Hagey, Jennifer L. Stout, Katrin Wuennenberg-Stapleton, John Ngai, Cecilia B. Moens, Andrew J. Waskiewicz,
Abstract Background Pbx genes encode TALE class homeodomain transcription factors that pattern the developing neural tube, pancreas, and blood. Within the hindbrain, Pbx cooperates with Hox proteins to regulate rhombomere segment identity. Pbx cooperates with Eng to regulate midbrain-hindbrain boundary ... cell differentiation. Although previous results have demonstrated that Pbx is required for proper eye size, functions in ... 4 null embryos demonstrated a key role for pbx genes in regulating neural cell behavior. To identify ...
Tópico(s): Zebrafish Biomedical Research Applications
2007 - BioMed Central | BMC Developmental Biology
Lisa Maves, Andrew J. Waskiewicz, Biswajit Paul, Yi Cao, Ashlee E. Tyler, Cecilia B. Moens, Stephen J. Tapscott,
... to achieve muscle fiber-type-specific gene expression. Pbx homeodomain proteins mark promoters of a subset of Myod target genes,including myogenin (Myog); thus, Pbx proteins might modulate the program of myogenesis driven by Myod. By inhibiting Pbx function in zebrafish embryos, we show that Pbx proteins are required in order for Myod to ... genes in the somites. In the absence of Pbx function, expression of myog and of fast-muscle ... muscle gene expression appears normal. By knocking down Pbx or Myod function in combination with another bHLH ...
Tópico(s): Genomics and Chromatin Dynamics
2007 - The Company of Biologists | Development
Gang Greg Wang, Martina P. Pasillas, Mark P. Kamps,
... transformation required the Meis1 function of binding to Pbx and DNA but not its C-terminal domain ( ... Meis1 CTD and Hoxa9 NTD suggests that Meis-Pbx and Hox-Pbx (or Hox-Pbx-Meis) complexes co-occupy cellular promoters that drive ... loop extension family of HD proteins that includes Pbx, which heterodimerizes with Meis1 (9).While Pbx genes are broadly expressed in hematopoiesis, Meis1 expression ... HSCs (29, 37, 47), binds both Meis1 and Pbx, suggesting that combinations of Meis-Pbx, Hox-Pbx, and Hox-Pbx-Meis complexes, such ...
Tópico(s): Invertebrate Immune Response Mechanisms
2006 - Taylor & Francis | Molecular and Cellular Biology
Pan Li, Sean T. Glenn, Craig A. Jones, Kenneth W. Gross,
... Full Text PDF PubMed Google Scholar). A HOX·PBX-binding site has been located within the Ren- ... PBX1b and binding to the Ren-1c HOX·PBX site with high affinity. Moreover, PREP1 has been ... PBX1b on the Ren-1c promoter. The HOX·PBX-binding site is also present in human and ... rat renin gene in addition to the HOX·PBX-binding site identified previously (6Pan L. Xie Y. ... generate mutations in the CBF1-, Ets-, and HOX·PBX-binding site are 5′-CTGGGTTCAGCCATGTTTaaagCACTCGATTCCTGCCACTC-3′, 5′-CCTGCCACTCTGCTTCGCTTaaGGCTCCTGCTTATCCCTC- ...
Tópico(s): RNA modifications and cancer
2005 - Elsevier BV | Journal of Biological Chemistry
Joon Whan Rhee, Akiko Arata, Licia Selleri, Yakop Jacobs, Satoru Arata, Hiroshi Onimaru, Michael L. Cleary,
Pbx proteins comprise a family of TALE (three amino acid loop extension) class homeodomain transcription factors that ... mutations may promote the pathogenesis of this disorder. Pbx proteins comprise a family of TALE (three amino ... mutations may promote the pathogenesis of this disorder. Pbx proteins comprise a set of four TALE (three ... B Lichter P Pöpperl H Pbx4, a new Pbx family member on mouse chromosome 8, is expressed ... 8: 423-429Crossref PubMed Scopus (327) Google Scholar Pbx proteins are orthologs of Drosophila extradenticle,6Rauskolb C ...
Tópico(s): Congenital Diaphragmatic Hernia Studies
2004 - Elsevier BV | American Journal Of Pathology
Naama Rave-Harel, Marjory L. Givens, Shelley B. Nelson, Hao A. Duong, Djurdjica Coss, Melody E. Clark, Sara B. Hall, Mark P. Kamps, Pamela L. Mellon,
... with Oct-1. We show that heterodimers containing Pbx/Prep1 or Pbx/Meis1 TALE homeodomain proteins bind to four functional ... with Oct-1. We show that heterodimers containing Pbx/Prep1 or Pbx/Meis1 TALE homeodomain proteins bind to four functional ... 6169-6177Crossref PubMed Scopus (122) Google Scholar), the PBX oligonucleotide (AGCGCGGGGCGCATCAATCAATTTCG, top strand), and the PBX-mut oligonucleotide (AGCGCGGGGCGCATCAATTAATTTCG, top strand) (20Lu Q. Knoepfler ... L. Cleary) and the antibody directed against all Pbx forms (21Schreiber E. Merchant R.E. Wiestler O. ...
Tópico(s): Genetic and Clinical Aspects of Sex Determination and Chromosomal Abnormalities
2004 - Elsevier BV | Journal of Biological Chemistry
Klaus Haller, Isabel Rambaldi, Eugene Daniels, Mark Featherstone,
The PREP, MEIS, and PBX families are mammalian members of the TALE (three amino acid loop extension) class of homeodomain-containing transcription factors. These factors ... of homeoproteins, but PREP and MEIS interact with PBX in apparently non-HOX-dependent cooperative DNA binding as well. PREP, MEIS, and PBX have all been reported to reside in the ... the developing vertebrate embryo. In the case of PBX, cytoplasmic localization is due to the modulation of ... two distinct cytoskeletal systems. The PREP, MEIS, and PBX families are mammalian members of the TALE (three ...
Tópico(s): Cancer-related gene regulation
2004 - Elsevier BV | Journal of Biological Chemistry
Pu Qin, Juliet M. Haberbusch, Zhenping Zhang, Kenneth J. Soprano, Dianne Robert Soprano,
Pre-B cell leukemia transcription factors (PBXs) act as cofactors in the transcriptional regulation mediated by Homeobox proteins during embryonic development and cellular differentition. PBX1 protein is expressed throughout ... development, and its deletion in mice disrupts chondrogenesis. PBX protein levels are also increased in mouse embryonal ... RA)-induced differentiation. To elucidate the role of PBX proteins in this process, we stably overexpressed PBX1b ... or endodermal cells following treatment with RA suggesting PBX proteins are required for both processes. Furthermore we ...
Tópico(s): Cancer-related Molecular Pathways
2004 - Elsevier BV | Journal of Biological Chemistry
Tara Sprules, Nancy Green, Mark Featherstone, Kalle Gehring,
... by the formation of cooperative complexes with the PBX homeodomain protein. A conserved YPWM motif in the HOX protein is necessary for cooperative binding with PBX. We have determined the structure of a PBX homeodomain bound to a 14-mer DNA duplex. ... in the 20-kDa binary complex. When the PBX homeodomain binds to DNA, a fourth α-helix ... This helix rigidifies the DNA recognition helix of PBX and forms a hydrophobic binding site for the ... in solution and suggests that the interaction between PBX and HOX is an example of “lock and ...
Tópico(s): Epigenetics and DNA Methylation
2003 - Elsevier BV | Journal of Biological Chemistry
Elena Longobardi, Francesco Blasi,
... DNA and to be retained in the nucleus, PBX proteins must form heterodimeric complexes with members of the MEINOX family. Therefore the balance between PBX and MEINOX must be an important regulatory feature. ... overexpression of PREP-1 influences the level of PBX-2 protein maintaining the PREP-1-PBX balance. This effect has important functional consequences. F9 ... an increased DNA binding activity to a PREP-PBX-responsive element. Because PREP-1 binds DNA efficiently only when dimerized to PBX, the increased DNA binding activity suggests that the ...
Tópico(s): Genomics and Chromatin Dynamics
2003 - Elsevier BV | Journal of Biological Chemistry
He Huang, Miltiadis Paliouras, Isabel Rambaldi, Paul Lasko, Mark Featherstone,
... proteins, two mechanisms are known to restrict the PBX family of homeodomain (HD) transcription factors to the cytoplasm. First, PBX is actively exported from the nucleus via a ... pathway. Second, nuclear localization signals (NLSs) within the PBX HD are masked by intramolecular contacts. In a screen to identify additional proteins directing PBX subcellular localization, we identified a fragment of murine ... chain B (NMHCB). The interaction of NMHCB with PBX was verified by coimmunoprecipitation, and immunofluorescence staining revealed ...
Tópico(s): Genomics and Chromatin Dynamics
2003 - Taylor & Francis | Molecular and Cellular Biology
Ying Liu, Raymond J. MacDonald, Galvin H. Swift,
... binds to overlapping half-sites for PDX1 and PBX. The trimeric complex activates transcription in cells to ... The conserved N-terminal PBC-B domain of PBX, as well as its homeodomain, is required for ... binds to overlapping half-sites for PDX1 and PBX. The trimeric complex activates transcription in cells to ... The conserved N-terminal PBC-B domain of PBX, as well as its homeodomain, is required for ... Scholar) and include both the PBC class (mammalian PBX proteins, Drosophila Extradenticle, andCaenorhabditis elegans Ceh-20 (6Burglin ...
Tópico(s): Congenital heart defects research
2001 - Elsevier BV | Journal of Biological Chemistry
Tara Sprules, Nancy Green, Mark Featherstone, Kalle Gehring,
PBX is a member of the three amino acid loop extension (TALE) class of homeodomains. PBX binds DNA cooperatively with HOX homeodomain proteins that ... The amino acids immediately C-terminal to the PBX homeodomain increase the affinity of the homeodomain for ... We have determined the structure of the free PBX homeodomain using NMR spectroscopy. Both the PBX homeodomain and the extended PBX homeodomain make identical contacts with a 5'-TGAT- ... forms upon binding to DNA, stabilizes the extended PBX structure. Variations in DNA sequence selectivity of heterodimeric ...
Tópico(s): Plant Reproductive Biology
2000 - American Chemical Society | Biochemistry
Carolina Abramovich, Weifeng Shen, Nicolas Pineault, Suzan Imren, Ben Montpetit, Corey Largman, R. Keith Humphries,
... proteins. This protein that we have termed hematopoietic PBX-interacting protein (HPIP) is mainly localized in the ... small amounts in the nucleus. The region of PBX that interacts with HPIP includes both the homeodomain ... assays revealed that HPIP inhibits the ability of PBX-HOX heterodimers to bind to target sequences. Moreover, HPIP strongly inhibits the transactivation activity of E2A-PBX. Together these findings suggest that HPIP is a new regulator of PBX function. PBX1 is a homeodomain protein that functions ...
Tópico(s): Genomics and Chromatin Dynamics
2000 - Elsevier BV | Journal of Biological Chemistry
Maya Saleh, Isabel Rambaldi, Xiang-Jiao Yang, Mark Featherstone,
The Hoxb1 autoregulatory element comprises three HOX-PBX binding sites. Despite the presence of HOXB1 and PBX1, this enhancer fails to activate reporter gene expression in retinoic acid-treated P19 cell ... in addition to RA. This suggests that HOX-PBX complexes may repress transcription under some conditions. Consistent with this, multimerized HOX-PBX binding sites repress reporter gene expression in HEK293 ... the PBX1 N terminus and show that the PBX partner is required for repression by the HOX-PBX complex. Treatment with the deacetylase inhibitor trichostatin A ...
Tópico(s): Developmental Biology and Gene Regulation
2000 - Taylor & Francis | Molecular and Cellular Biology
Elizabeth A. Eklund, Annika Jalava, Renu Kakar,
... affinity of HoxA10 is increased by partnering with Pbx proteins. A consensus sequence for Pbx1-HoxA10 DNA ... not been identified. We noted that the derived Pbx-HoxA10 DNA-binding consensus is similar to a ... differentiation of myeloid cell lines abolishes in vitro Pbx-HoxA10 binding to either the derived consensus or ... reporter gene expression from artificial promoter constructs with Pbx-HoxA10 binding sites. We determine that HoxA10 has ... tyrosine phosphorylation, which decreasesin vitro DNA binding to Pbx-HoxA10 binding sites. Therefore, these investigations identify the ...
Tópico(s): Cancer-related gene regulation
2000 - Elsevier BV | Journal of Biological Chemistry
Wei-Fang Shen, Sophia Rozenfeld, Angela Kwong, László G. Kömüves, H. Jeffrey Lawrence, Corey Largman,
Aberrant activation of the HOX, MEIS, and PBX homeodomain protein families is associated with leukemias, and retrovirally driven coexpression of HOXA9 and MEIS1 is sufficient to induce myeloid leukemia in mice. ... vitro cooperative DNA binding complexes with either the PBX or MEIS protein. Furthermore, PBX and MEIS proteins have been shown to form ... for MEIS1 in the presence of HOXA9 and PBX yields a consensus PBX-HOXA9 site. MEIS1 enhances in vitro HOXA9-PBX protein complex formation in the absence of DNA ...
Tópico(s): Epigenetics and DNA Methylation
1999 - Taylor & Francis | Molecular and Cellular Biology