... S.A. Howland; however, the woodcut on p. 55, found in at least one of the S. ...
0000 - Gale Group | Sabin backfiles 2011
Chang-Chieh Chen, Shiau-Ting Hu,
... sonnei (ATCC 9290) or E. coli O157 with primers FNdeI-55 and REcl136II-Term (Table 1). The PCR product ... the two motifs was amplified from pGEMT629 using primers FXbaI-55 and RRsrII-425 and cloned between XbaI and ... terminal repeats was then amplified from pGEMT629T5 with primers FNotI-55 and RT7 and then cloned into the corresponding ... A4T motif was amplified from pET629A-AB with primers FNotI-55 and RA5. This PCR product was ligated into ...
Tópico(s): RNA and protein synthesis mechanisms
2006 - Elsevier BV | Journal of Biological Chemistry
Ernest Newman, G. G. Burgess, Mr. Churchill, R. Woodfield, Henry Longhurst, W. J. B., Noel Thomas, A. N. S., John Morrison, Newton, G. W. B., Hanworth, Mr. John Bright, D. B. Somervell K. C., L. I. Harington, Ralph Straus, Dorothy L. Sayers, Winifred Gordon, Herbert Sidebotham, C. T. Stoneham, J. M. Bulloch, H. M. T., James Agate, Frank Rutter, E. L., A. F. Fremantle, C. F. Tufnell, B. J. de C. Andrade, Eric Gillett, R. Furber, George W Bishop, D. R. Gent, Desmond MacCarthy, Atticus, Stdeny W. Carroll, H. J. H, Maureen Watson, R. J. Hodgson, Mary Butts, Leopold Lewis, E. N. Frazer, W. W. Hadley, D. Brady, Philip Prescott, H. E. Symons, O. J. Eaglesfield, H. F., N. L. Jackson, Pandora, C. J. Valentine, Hamilton Price, Mary Abbott, Violet Hunt, E. M. Keate, Ernest S. Ebblewhite, Yarbrough, Philip Guedalla, Sir John Squire, Frederick Watson, R. J. Barrett Financial Editor, E. V Lucas, Gerald Heard, Lady Muriel Beckwith, Harold Cox,
... Mills & Boon Books & Writers The Popularity of the Primer For your Library List Thorton Butterworth Books The ... From a Special Correspondent: Architects Too Old at 55 Protests at Office of Works Decision A Hard ...
1933 - Gale Group | Sunday Times HA GDA
Hideshi Satoh, Masakazu Susaki, Chisa Shukunami, Ken‐ichi Iyama, Takaharu Negoro, Yuji Hiraki,
... Primers for amplification of rat DTDST cDNA fragment Primer 55′-TTGCCAACCAAAGAACTC-3′ Primer 65′-TGTGATCACACCAAGGAC-3′Primers for amplification of the ... Perkin-Elmer) and sense primer 11 and antisense primer 12 (Table I). Thermal cycling was carried out for 28 cycles (30 s at 94 °C, 30 s at 55 °C, and 30 s at 72 °C). Aliquots ...
Tópico(s): Cancer, Hypoxia, and Metabolism
1998 - Elsevier BV | Journal of Biological Chemistry
L. J. Corbett, Judith Hubback, Kathleen Gibberd Educational Correspondent of The Sunday Times, Richard Buckle, Clarence Elliott, Roald Dahl, Frank Fuller, Stephen Coulter Representative of The Sunday Times, Elizabeth Nicholas, Harold Hobson, Rev. Leslie D. Weatherhead Ph. D., Ian Peebles, Janice Elliott, James Margach Political Correspondent of The Sunday Times, Charles Lister, Henry Thody The Sunday Times Representative, J. W. Lambert, (Mrs.) Cicely Mayhew, Harry S. Truman, C. V. Hancock, Moira Keenan, Julian Symons, Richard Kellett, John Dryden, Joyce Emerson, Elizabeth Pakenham, John Pearson, Trevor Huddleston C. R., John Russell, Sir Arthur Bryant, Arthur Jenkins, Derek Prouse, Alexandre Metaxas, Vivian Jenkins, Derek Wren, Maurice Edelman M. P., E. C., Ian Nickols, Timothy, Barbara Wilcox, Hugh Somerville, Cyril Connolly, Sir Herbert Thompson, Maxwell Boyd The Sunday Times Motoring Correspondent, F. J. Kennedy, Raymond Mortimer, B. S. Shenstone Cheif Engineer, Bruce Hayden, A. L. Rowse, Nicholas Carroll Diplomatic Correspondent of The Sunday Times, Henry Brandon Representative of The Sunday Times, J. G. Smyth, Susan Noel, David Robinson, Roger Mortimer, Antony Terry Representative of The Sunday Times, Ernestine Carter, Peyton Short Secretary, Commonwealth Society for the Deaf, Desmond Shawe-Taylor, R. L. Hollands, R. C. Robertson-Glasgow, Anne Morland, Elizabeth Jane Howard, Colin Cowdrey, Merlin, Felix Aprahamian, Harold Abrahams, Norman Lewis, Margaret Costa, Robert Robinson, Henry Longhurst, Peter Collins, Letitia Cunningham, Iain Lang, Dr. F. D. Smith, C. H. O'd. Alexander, George Schwartz, Maurice Wiggin, Goronwy Rees, Robert Harling, Mr. J. B. Upton, Gordon Ross, Storm Jameson, Carlos F. Alfaro Panamanian Embassy, Trevor Philpott, (Mrs.) B. E. Cotter, Susan Cooper, Kenneth Konstam,
... By Lawrence Durrell. (Faber. 21s.) No Title A Primer for Typographers High Jinks & Fervour A Life in ...
1960 - Gale Group | Sunday Times HA GDA
Carol S. Trempus, Sandra Ward, Georgia M. Farris, David E. Malarkey, Randall S. Faircloth, Ronald E. Cannon, Joel F. Mahler,
... 50°C for transgene and mouse β2-microglobulin primers, 55°C for GATA-1 primers, and 60°C for ζ-globin primers. Denaturing, ...
Tópico(s): Epigenetics and DNA Methylation
1998 - Elsevier BV | American Journal Of Pathology
Victoria McKee, Trevor J. Chenery, Phil Yates, Jon Ashworth, Frances Gibb, Legal Affairs Correspondent, Vivien M. Collins, Mary Dejevsky and Martin Fletcher, Diana Wildman, Bill Frost, Tim Judah, Waldemar Januszczak (Commissioning Editor), Miles Irving, Peter Wade, Geoffrey Johnson-Smith (Leader), B. Dymock, Ross Tieman, Industrial Correspondent, Robin Oakley, Laura Thompson, Ian Murray, Tony Loynes, Clive Davis, Sarah Jane Checkland, Art Market Correspondent, Lynne Truss, Yvonne Thomas, Stuart Jones Football Correspondent, Simon Wilde, Roddy Forsyth, David Watts, Diplomatic Correspondent, John Peek, V Mck, John O'Leary, Higher Education Correspondent, Joe Joseph, Martin Fletcher, Peter Davenport, Bruce Clark, Nicholas Wood Political Correspondent, Debra Craine, Michael Clark and Philip Robinson, Paul Jackson Director, Nigel West, Louise Taylor, Martin Barrow, David Phillips, Libby Purves, Edward Ullendorff, Peter Bills, John Taylor, Michael Evans, Defence Correspondent, Robin Young, Michael Clark, Philip Robinson, Anatole Kaletsky, Robin Clancy, Charles Bremner, Neil Bennett Banking Correspondent, Robin Wight Chairman, Edward Gorman, Conor Cruise O'Brien, Edward Gorman, Irish Affairs Correspondent, George Brock, Sydney Friskin, Nicholas Harling, Anatole Kaletsky, Economics Editor, David Miller, Lin Jenkins, Barry Millington, Philip Webster, Chief Political Correspondent, Gillian Bowditch, Mitchell Platts Golf Correspondent, Lindsay Cook, Money Editor, Michael Dynes and Frances Gibb, John Grigg, Raymond Keene, Chess Correspondent, Ali Jaber, Nick Sims, Ruth Gledhill and Richard Duce, Stephen Slater, Barry Pickthall, Simon Tait, Arts Correspondent, P. S. Knight, Christopher Walker, Srikumar Sen Boxing Correspondent, Clive White, Matthew Parris, Graham Searjeant Financial Editor, Philip Jacobson and Susan Bell, Dr A. W. F. Edwards, Gerard Hastings Director, Peter Victor, Michael Phillips, Barry Wood, Angela MacKay and Neil Bennett, Kerry Gill and Nicholas Wood, Andrew Lycett, Peter Mulligan, Martin Waller, Bill Holmes, Leolin Price, Nigel Hawkes Science Editor, Stephen Bayley Motoring correspondent, Alan Coren, Margaret Haskell, Christopher Warman, Benedict Nightingale, H. Brendan Devlin, James Pringle and David Watts, Sam Kiley, Alan Neale, Sir Hal Miller Chief executive, Colin Campbell, Janice Cave Editor, David Hands, Rugby Correspondent, Mary Dejevsky, Michael Binyon and Richard Beeston,
... In Brief Edberg to rest Weston leads Cooke primer Racing Home start opens the road back for ...
1991 - Gale Group | TDA
Jun-itsu Ito, Marcelo Jacobs‐Lorena,
... 231)Primer 45′-TTGCCGCCGATGGAAGCAGCATCATATTC-3′NgoMIftz (423–403)Primer 55′-TTGCGGCCGCAGGGCTCTCTGATTTTGCTA-3′NotIftz (1–20)Primer 65′-CTTGATGACCTTGGTCAGACG-3′rpA1 (221–201)Primer 75′- ...
Tópico(s): Genomics and Chromatin Dynamics
2001 - Elsevier BV | Journal of Biological Chemistry
A. Podmore, Ernest Newman, Frederick Grundy, Lloyd, Yareborough, E. N., Bernard North, Roland Atkinson ("Sunday Times" Paris Correspondent), G. G. Coulton, Mr. Gerrard Williams, Frank Rutter, Sir Lynden Macassey, Edmund Gosse, Sydney W. Carroll, D. R. Gent, H. M. W., Mark S. Poore, Albert E. Raynor, Roland Atkinson, T. P. O'Connor M. P., Frank H. Simonds, Tom B. Davis, L. Van Vliet, L. Blin Desbled, H. L. R., O. S., Hannen Swaffer, Sybilla Kirkland Vesey, J. M. B., George T. Bisset-Smith, H. F., Henry Williams, Gerald Biss, Decles Hon. Director, A. W. W., E. Hamilton Moore, Henry Murray, Arthur Lynch, John Murray (M. P. for W. Leeds), Russell Stannard, R. J. Barrett Financial Editor, Ralph G. Rolls, Harold Cox,
... 6d. net) "The History of Alfred Rudd" A Primer on our Premiers "The Prime Ministers of Britain ... Certificates Rush Abnormal Purchases to Avoid Higher Price 55 Applicants for One House Clara Butt's Tutor ...
1922 - Gale Group | Sunday Times HA GDA
Whei-meih Chang, Rudi A. Bohm, Jeffrey C. Strauss, Tao Kwan, Tarita O. Thomas, Roshani B. Cowmeadow, Nigel S. Atkinson,
... the 55 box was produced by PCR. The primers 55 upper (5′-GTCTGATCACTCTGCCTTTTAATT-3′) and 55 lower (5′- ... intoXhoI-NotI-digested P614 construct to produce plasmid 55/EX. The 4E/EX reporter gene was built by adding the 214-bp 4E region back into the EX deletion construct. The 4E region was PCR-amplified from P6 DNA using the 4E upper (5′-TTCAGATCTTAGCCAAATGCCCGTATA-3′) and 4E lower primers (5′-ACCGGATCCACCGCACAACTGGCG-3′). The product was blunt-end- ...
Tópico(s): Insect and Pesticide Research
2000 - Elsevier BV | Journal of Biological Chemistry
Birgit Simon‐Nobbe, Ursula Denk, Peter B. Schneider, Christian Radauer, Markus Teige, Reto Crameri, Thomas Hawranek, Roland Lang, Klaus Richter, Peter Schmid‐Grendelmeier, Stephan Nobbe, Arnulf Hartl, Michael Breitenbach,
... TTA TCT GGT GGT GTA ACC A-3′Primer 55′-GAA ATT CCA TAT GCC TGG CCA GCA ACG AAC-3′Primer 65′-AAT GAA TTC TTA TCT GGT GGT ...
Tópico(s): Respiratory and Cough-Related Research
2006 - Elsevier BV | Journal of Biological Chemistry
Yingling Wan, Min Zhang, Aiying Hong, Yixuan Zhang, Yan Liu,
... with 89.05% of 960 pairs of SSR primers, 55.83% of which were polymorphic, and most of the 46 tested primers had a high level of transferability to the ...
Tópico(s): Genomics and Phylogenetic Studies
2020 - Multidisciplinary Digital Publishing Institute | Genes
Produção Nacional
Revisado por pares
Ariovaldo Stefani, Rui Barbosa de Brito, Sidney Kina, Oswaldo Scopin de Andrade, Gláucia María Bovi Ambrosano, Andreia Assis Carvalho, Marcelo Giannini,
... 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1).Metal-Zirconia Primer increased ...
Tópico(s): Endodontics and Root Canal Treatments
2015 - Wiley | Journal of Prosthodontics
Qian Zhang, Hai Kee Chieu, Choon Pei Low, Shaochong Zhang, Chew‐Kiat Heng, Hongyuan Yang,
... the S. pombe his3+ gene. Two pairs of primers: PLH1–55 (GGGGTACCACACCCTATTTGCAACA) and PLH1–53 (CCGCTCGAGGAATTGCTTGAGCAGCAAC), and PLH1–35 ( ... the S. pombe ura4+ gene. Two pairs of primers: DGA1–55 (GGGGTACCGAATCCATGGGTAGTGAT) and DG11–53 (CCGCTCGAGCCCGTTCTATATAATCGT), and DGA1–35 ( ...
Tópico(s): Microbial Metabolic Engineering and Bioproduction
2003 - Elsevier BV | Journal of Biological Chemistry
J. Bakonyi, Annemarie Fejer Justesen,
... PTT isolates from distant geographical locations. Using seven primers, 55 (52.38%) polymorphic DNA bands were detected out ...
Tópico(s): Mycotoxins in Agriculture and Food
2007 - Wiley | Journal of Phytopathology
Indu Kohaar, Yongmei Chen, Sreedatta Banerjee, Talaibek Borbiev, Huai‐Ching Kuo, Amina Ali, Lakshmi Ravindranath, Jacob Kagan, Sudhir Srivastava, Albert Dobi, Isabell A. Sesterhenn, Inger L. Rosner, Jennifer Cullen, Shiv Srivastava, György Petrovics,
... Master Mix (Life Technologies) with forward and reverse primers (55 nM final concentration) for all target genes. The ...
Tópico(s): Prostate Cancer Treatment and Research
2020 - Lippincott Williams & Wilkins | The Journal of Urology
Rémi Le Guern, Caroline Loïez, Sylvie Armand, Laure Marceau, René Courcol, Florent Wallet,
... 13BS primers were more sensitive than 341F/785R primers: 38/55 (69.1%) samples were positive using 91E/13BS primers against 28/55 (50.9%) with 341F/785R (p = 0.013). When at least one of the two molecular methods was positive, the sensitivity and specificity of 16S rDNA amplification was 72.7% and 94.7%, respectively. Conclusion: Even if the new primer pair 341F/785R seemed promising in silico, it ...
Tópico(s): Bacterial Identification and Susceptibility Testing
2015 - Taylor & Francis | Infectious Diseases
Somvir Nimbal, Rahul Behl, A. K. Chhabra,
... from Wheat x Rye crosses) using 55 RAPD primers. Out of 55 primers used, only 36 amplified and generated 2(OPG08, ...
Tópico(s): Crop Yield and Soil Fertility
2009 - CSIRO Publishing | South Pacific journal of natural and applied sciences
Ana Patrícia Graça, Rita Calisto, Olga Maria Lage,
... secondary bioactive genes; 85 % amplified with PKS-I primers and 55 % with NRPS primers. Some of the amplified genes were confirmed to ...
Tópico(s): Fungal Biology and Applications
2016 - Frontiers Media | Frontiers in Microbiology
María Sofía Cuba-Fuentes, Arturo Jurado, Eva Citlali Martínez Estrella,
... Primaria, los atributos de continuidad (55%) y de primer contacto (55,8%) mostraron un cumplimiento medio y el de ...
Tópico(s): Healthcare Policy and Management
2011 - Cayetano Heredia University | Revista Médica Herediana
N. Anitha, K. Lakshmi Jayaraj, E. P. A. Kumar, Jiji George, M. K. Rajesh,
... was standardized using gradient PCR. Of the 86 primers, 55 primers gave clear bands of expected size range (100 ...
Tópico(s): Cassava research and cyanide
2008 - Indian Academy of Horticulture Sciences | Indian Journal of Horticulture
Nagendra Rai, Sanjeev Kumar, R. K. Singh, Krishna Kumar, Garima Tiwari, Sarvesh Pratap Kashyap, Major Singh, Awadhesh Bahadur,
... agroecological zones of India. Of the 134 SSR primers, 55 (41.0%) were found to be transferable since they showed reproducible polymorphic amplification products in Indian bean. The SSR primers derived from common bean fail to amplify any ...
Tópico(s): Plant pathogens and resistance mechanisms
2016 - Indian Council of Agricultural Research | The Indian Journal of Agricultural Sciences
Eric Sérée, P.H. Villard, Jean‐Marc Pascussi, Thierry Pineau, Patrick Maurel, Quoc-Binh N'Guyen, Frédérique Fallone, P.M. Martin, Serge Champion, Bruno Lacarelle, J.-F. Savouret, Y. Barra,
... of denaturation at 95°C, 8 seconds of primer annealing at 55°C, and 8 seconds of fragment elongation at ... of denaturation at 91°C, 30 seconds of primer annealing at 55°C, and 1 minute of elongation at 72°C. Primers used for proximal CYP1A1 PPREs containing promoter region ...
Tópico(s): Metabolism, Diabetes, and Cancer
2004 - Elsevier BV | Gastroenterology
Nouzha Ftouhi-Paquin, Christoph Hauer, Robert F. Stack, Anthony L. Tarentino, Thomas H. Plummer,
... 1 min at either 45 °C for degenerate primers or 55 °C for specific primers), and elongation (1 min at 70 °C). A ...
Tópico(s): Peptidase Inhibition and Analysis
1997 - Elsevier BV | Journal of Biological Chemistry
Stefania Spanfò, Maria Giuseppina Silletta, Antonino Colanzi, Saverio Alberti, Giusy Fiucci, Carmen Valente, Aurora Fusella, Mario Salmona, Alexander A. Mirоnоv, Alberto Luini, Daniela Corda,
... sense primer, GCHACHGTGGCHTTYTGYTGYGA), peptide 61 (probe 1 antisense primer, CRTAGAAVAGCACGTTRAABCC), peptide 55-1 (probe 2 sense primer, TGYGTGACHCTSCAYTGYGG), and peptide 55-2 (probe 2 antisense primer, CCYTCCACAGCDGCDGGDAT). A λZAPII rat brain cDNA library (Stratagene) ...
Tópico(s): Calcium signaling and nucleotide metabolism
1999 - Elsevier BV | Journal of Biological Chemistry
Brent Tan, Roger A. Warnke, Daniel A. Arber,
... clones, 66 (71%) were detected by Vγ1-8 primers and 55 (59%) were detected by Vγ10 primers. The majority of Vγ10 rearrangements were seen in ...
Tópico(s): Eosinophilic Disorders and Syndromes
2006 - Elsevier BV | Journal of Molecular Diagnostics
Tomohiro Maeda, Yukihiro Takahashi, Hikaru Suenaga, Akiko Suyama, Masatoshi Goto, Kensuke Furukawa,
... following conditions: denaturation, 94 °C for 1 min; primer annealing, 55 °C for 1.5 min; and primer extension, 72 °C for 1 min. ISP purification ...
Tópico(s): Microbial bioremediation and biosurfactants
2001 - Elsevier BV | Journal of Biological Chemistry
... bean, and one from adzuki bean. Five AFLP primers amplified 55 fragments, of which 20 bands were polymorphic. Thirteen ISSR primers amplified 66 fragments, of which 45 bands were ...
Tópico(s): Plant Disease Management Techniques
2001 - Cambridge University Press | Mycological Research
... bean, and one from adzuki bean. Five AFLP primers amplified 55 fragments, of which 20 bands were polymorphic. Thirteen ISSR primers amplified 66 fragments, of which 45 bands were ...
Tópico(s): Plant Pathogenic Bacteria Studies
2001 - Cambridge University Press | Mycological Research
Moustafa Moustafa‐Bayoumi, Mazin Alhaj, Osama El‐Sayed, Sheik Wisel, Maqsood A. Chotani, Zeinb A. Abouelnaga, Mohamed D.H. Hassona, Katya Rigatto, Mariana Morris, Gerard J. Nuovo, Jay L. Zweíer, Pascal J. Goldschmidt‐Clermont, Hamdy H. Hassanain,
... 35 cycles of denaturation (94 °C, 45 s), primer annealing (55 °C, 30 s), and extension (72 °C, 2 min). The profilin-specific primers (as shown above) were used for PCR. On ...
Tópico(s): Protease and Inhibitor Mechanisms
2007 - Elsevier BV | Journal of Biological Chemistry