Limpar
2.500 resultados

Acesso aberto

Tipo do recurso

Ano de criação

Produção nacional

Revisado por pares

Áreas

Idioma

Editores

Imagens Acesso aberto

... or halls. The Copper Hall of Dance called Tamra Sabhai is situated within the inner precincts of ...

0000 - Gale Group | NCCO Photography

Artigo Acesso aberto Revisado por pares

Katie M. Babin, Jordan A. Karim, Peyton H. Gordon, James Lennon, Alex Dickson, Augen A. Pioszak,

... AM2/IMD peptides labeled with the acceptor fluorophore TAMRA on a Lys residue substituted at equivalent positions ... with wildtype peptides (Fig. S2A) and for the TAMRA-labeled peptides at untagged CLR–RAMP3 (Fig. S2B) ... cAMP assay, which revealed wildtype behavior for AM–TAMRA (t1/2 ∼ 3 min) and a gain of function (slower decay) for AM2/IMD–TAMRA (t1/2 ∼ 43 min) (Fig. S2, C and ... Equilibrium binding experiments revealed saturable binding of AM–TAMRA and AM2/IMD–TAMRA with binding affinities of 26 and 7 nM, ... equilibrium (Fig. S2E). In association kinetics experiments AM–TAMRA reached equilibrium quicker than AM2/IMD–TAMRA (Fig. ...

Tópico(s): Cancer, Stress, Anesthesia, and Immune Response

2023 - Elsevier BV | Journal of Biological Chemistry

Imagens Acesso aberto

... or halls. The Copper Hall of Dance called Tamra Sabhai is situated within the inner precincts of ...

0000 - Gale Group | NCCO Photography

Artigo Revisado por pares

Wenjuan Song, Zhiling Song, Qian Li, Chengwen Shang, Qiqi Chao, Xingfu Liu, Rongmei Kong, Gao‐Chao Fan, Xiliang Luo,

... of the corresponding Cy5 fluorescence (FCy5) and tetramethylrhodamine (TAMRA) fluorescence (FTAMRA). After target-triggered responses, normalization of ... the fully recovered maximum fluorescence of Cy5 and TAMRA, namely FCy5-max and FTAMRA-max. Then, the ... spectrophotometer (Hitach, Japan). The independent fluorescence signals of TAMRA and Cy5 were detected under the excitation wavelengths ... 37 °C, the target-triggered fluorescence signals of TAMRA and Cy5 were detected under different laser powers ... system (Cho-HCRF) was labeled with Cy5 and TAMRA to light up the transfection trace along with ...

Tópico(s): Gold and Silver Nanoparticles Synthesis and Applications

2022 - Chinese Chemical Society | CCS Chemistry

Artigo Acesso aberto Revisado por pares

András Dávid Tóth, Dániel Garger, Susanne Prokop, Eszter Soltész‐Katona, Péter Várnai, András Balla, Gábor Turu, László Hunyady,

... treated them with red fluorophore–conjugated angiotensin II (TAMRA‒AngII) as BRET acceptor for 2 h at ... and C). In both cases, the binding of TAMRA‒AngII to the tagged receptors resulted in an ... the greater overlap between the excitation spectrum of TAMRA and the emission spectrum of GLuc than that ... of the signal originated from specific interaction between TAMRA‒AngII and AT1R. The remaining nonspecific signal reflects ... to the acceptor concentration. Accordingly, increasing concentrations of TAMRA‒AngII elevated the nonspecific signal linearly, whereas the ...

Tópico(s): Molecular Communication and Nanonetworks

2021 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Tao Li, Brian Chiou, Casey K. Gilman, Rong Luo, Tatsuhiro Koshi, Diankun Yu, Hayeon C Oak, Stefanie Giera, Erin Johnson‐Venkatesh, Allie K. Muthukumar, Beth Stevens, Hisashi Umemori, Xianhua Piao,

... a negative control experiment using 5-carboxytetramethylrhodamine (5-TAMRA), the fluorophore component of PSVue that does not ... in Fig EV2, we observed very sparse 5-TAMRA signals in microglia compared to PSVue, supporting the ... RGC inputs. C. An image shows the 5-TAMRA signal after injection. Dotted areas indicate the dLGN. D. A representative image of microglia from 5-TAMRA treated dLGN. Very few 5-TAMRA puncta were observed. The middle panel shows a ... rendered microglia with engulfed inputs (green) and 5-TAMRA (red). The right panel shows engulfed RGC inputs ...

Tópico(s): Neuroscience and Neuropharmacology Research

2020 - Springer Nature | The EMBO Journal

Artigo Acesso aberto Revisado por pares

Akio Shiba, Emiko Kinoshita‐Kikuta, Eiji Kinoshita, Tohru Koike,

... alkaline phosphatases (APs) by using a carboxytetramethyl-rhodamine (TAMRA)-labeled phosphate-binding tag molecule (TAMRA-Phos-tag). In the first assay, TAMRA-labeled O-phosphorylethanolamine (TAMRA-PEA) was used as an artificial AP-substrate. TAMRA-Phos-tag specifically captured TAMRA-PEA to form a 1:1 complex at ... a result of the mutual approach of the TAMRA moieties. As TAMRA-PEA was dephosphorylated by AP, the resulting TAMRA- ...

Tópico(s): Folate and B Vitamins Research

2017 - Multidisciplinary Digital Publishing Institute | Sensors

Artigo Acesso aberto Revisado por pares

Jing He, W. Berkeley Kauffman, Taylor Fuselier, Somanna K. Naveen, Thomas G. Voss, Kalina Hristova, William C. Wimley,

... SMTPs) delivered the zwitterionic, membrane-impermeant dye tetramethylrhodamine (TAMRA) into cells even when the conditions were not ... translocation. This is in sharp contrast to Arg9-TAMRA, a representative highly cationic, cell-penetrating peptide, which entered cells only when endocytosis was permitted. Arg9-TAMRA triggered large scale endocytosis and did not appreciably ... timescales we studied. When injected into mice, SMTP-TAMRA conjugates were found in many tissues even after 2 h. Unconjugated TAMRA was rapidly cleared and did not become systemically ...

Tópico(s): Lipid Membrane Structure and Behavior

2013 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto

Chandrashekhar Jagtap, BK Ashok, B J Patgiri, PK Prajapati, B Ravishankar,

... Bhasma extensively used in routine Ayurvedic practice is Tamra (copper) bhasma. If it is not prepared properly ... to its Shodhana procedure. In the present study, Tamra bhasma prepared from Shodhita and Ashodhita Tamra was subjected to oral toxicity study to ascertain ... role of Shodhana process on safety profile of Tamra bhasma on subchronic administration to albino rats. Both ... of various organs were studied. Results showed that Tamra bhasma prepared from Ashodhita Tamra has pathological implications on different hematological, serum biochemical ...

Tópico(s): Plant-based Medicinal Research

2013 - Medknow | Indian Journal of Pharmaceutical Sciences

Revisão Acesso aberto Revisado por pares

SwapnilY Chaudhari, ChandrashekharY Jagtap, R Galib, P Bedarkar, Biswajyoti Patgiri, PK Prajapati,

The metal, Tamra though mentioned in Ayurveda with a wide range of therapeutic utilities; is attributed with Ashta Maha Dosha. Hence, one should be cautious while using Tamra Bhasma. Considering the significance of Tamra in therapeutics, many studies have been carried out ... to compile such available research works done on Tamra in the Department of Rasa Shastra and Bhaishajya ... analytical, and pharmacological studies. Total eleven studies on Tamra Bhasma, which revalidated the impact of classical guidelines, ...

Tópico(s): Medicinal Plants and Neuroprotection

2013 - Medknow | AYU (An International Quarterly Journal of Research in Ayurveda)

Artigo Acesso aberto Revisado por pares

Yanhong Tong, Kaitlin McCarthy, Huimin Kong, Bertrand Lemieux,

... instrument has only two detection channels (FAM and TAMRA), and its dynamic range is narrower than that ... S35/N35), and melting curve analysis from the TAMRA channel; where S represents end-point reading at ... subscript, F represents FAM channel, and T represents TAMRA channel.For assays in which the IC was ... subscript, F represents FAM channel, and T represents TAMRA channel.Statistical Data Analysis to Determine CutoffThe fluorescence ... C during the melting-curve profile with the TAMRA channel, the sample was reported as being HSV ...

Tópico(s): Virus-based gene therapy research

2012 - Elsevier BV | Journal of Molecular Diagnostics

Artigo Acesso aberto Revisado por pares

Olivier Delelis, Kévin Carayon, Elvire Guiot, Hervé Leh, Patrick Tauc, Jean‐Claude Brochon, Jean‐François Mouscadet, Eric Deprez,

... INs) 3The abbreviations used are: IN, integrase; INT; TAMRA-labeled integrase; FCS, fluorescence correlation spectroscopy; Fl, fluorescein; ... 3′-processing; Mo, monomeric; Di, dimeric; Te, tetrameric; TAMRA, carboxytetramethylrhodamine. 3The abbreviations used are: IN, integrase; INT; TAMRA-labeled integrase; FCS, fluorescence correlation spectroscopy; Fl, fluorescein; ... 3′-processing; Mo, monomeric; Di, dimeric; Te, tetrameric; TAMRA, carboxytetramethylrhodamine. catalyze the integration of viral DNA into ...

Tópico(s): Glycosylation and Glycoproteins Research

2008 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Kaori Sasaki, Toyoyuki Ose, Naoaki Okamoto, Katsumi Maenaka, Taku Tanaka, Hisao Masai, Mihoko Saito, Tsuyoshi Shirai, Daisuke Kohda,

... PriA[1–105] protein was added to 5′TAMRA-d(A8) (octadeoxyadenylate with a terminal 5′ fluorophore ... of about 25 μM. By contrast, neither 5′TAMRA-d(A8)p (terminal 3′ phosphate) nor d(A8)-3′TAMRA (terminal 3′ fluorophore) increased the diffusion time at ... length PriA[1–732] bound to the 5′TAMRA-d(A8) with higher affinities of 7 and ... terminal deoxyribose to a dideoxyribose and prepared 5′TAMRA-d(A7)ddC. This oligonucleotide ends with a ... Figure 1.FCS analyses of PriA binding to TAMRA-labeled oligonucleotides. (A) Plots of FCS diffusion time ...

Tópico(s): CRISPR and Genetic Engineering

2007 - Springer Nature | The EMBO Journal

Artigo Acesso aberto Revisado por pares

Arianna Rath, Roman A. Melnyk, Charles M. Deber,

... FRET, fluorescence resonance energy transfer; PFO, sodium perfluorooctanoate; TAMRA, 5- (and 6-) carboxytetramethylrhodamine; dansyl, 5-dimethyl-amino- ... chloride), or 5- (and 6-) carboxytetramethylrhodamine succinimidyl ester (TAMRA-SE) (Molecular Probes) was accomplished by incubating the ... unlabeled peptide was mixed with 1 μg of TAMRA-labeled peptide samples before loading gels in SDS- ... used in conjunction with UV transillumination to detect TAMRA-labeled peptides in heterooligomerization experiments. Densitometry measurements were ...

Tópico(s): RNA and protein synthesis mechanisms

2006 - Elsevier BV | Journal of Biological Chemistry

Artigo Revisado por pares

Jiali Li, P Pircher, Ira G. Schulman, Stefan Westin,

... ileal bile acid-binding protein; 6FAM, 6-carboxyfluorescein; TAMRA, carboxytetramethylrhodamine; FXRE, farnesoid X receptor element; LDLR, low ... ileal bile acid-binding protein; 6FAM, 6-carboxyfluorescein; TAMRA, carboxytetramethylrhodamine; FXRE, farnesoid X receptor element; LDLR, low ... follows: C3 (forward primer, AAGCCCAACACCAGCTACATC; probe, 6FAM-ACGTGGGTGGAGCACTGGCCT-TAMRA; and reverse primer; ACTTCTGATCCTGGCATTCTTCT); fgf15 (forward primer, GG-TCGCTCTGAAGACGATTG; probe, 6FAM-CATCAAGGACGTCAGCAG-CGTGC-TAMRA; and reverse primer, CGCGCTCATGCAGAGGTA); FGF19 (forward primer, GGAGGAAGACTGTGCTTTCGA; ...

Tópico(s): RNA Interference and Gene Delivery

2004 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Lynn M. Knowles, Fumiko Axelrod, Cecille D. Browne, Jeffrey W. Smith,

... laser desorption ionization time-of-flight; FP-PEG-TAMRA, fluorophosphonate-poly-ethyleneglycol-tetramethyl rhodamine.1The abbreviations used ... laser desorption ionization time-of-flight; FP-PEG-TAMRA, fluorophosphonate-poly-ethyleneglycol-tetramethyl rhodamine. has attracted considerable ... final protein concentration. The fluorophosphonate probes FP-PEG-TAMRA (fluorophosphonate-poly-ethyleneglycol-tetramethyl rhodamine), FP-PEG-BODIPY, ... soluble cell fractions (40 μl) with FP-PEG-TAMRA (2 μm) for 1 h at room temperature. ...

Tópico(s): Cancer, Hypoxia, and Metabolism

2004 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

F. Gregory Buchanan, Dingzhi Wang, Francesca Bargiacchi, Raymond N. DuBois,

... R 59-TGCTACTGTCATTCGCACCTG-39, P 59-FAM-AGCTCTGGCCACAACAGGGCATTTT-TAMRA-p-39; HER-2/neu: F 59-TCTGGACGTGCCAGTGTGAA-39, R 59-TGCTCCCTGAGGACACATCA-39, P 59-FAMCAGAAGGCCAAGTCCGCAGAAGCC-TAMRA-p-39; HER-3: F 59-TTCTCTACTCTACCATTGCCCAAC-39, R 59-CACCACTATCTCAGCATCTCGGTC-39, P 59-FAM-ACACCAACTCCAGCCACGCTCTGC-TAMRA-p-39; HER-4: F 59-GAGATAACCAGCATTGAGCACAAC-39, R 59-AGAGGCAGGTAACGAAACTGATTA-39, P 59-FAMCCTCTCCTTCCTGCGGTCTGTTCGA-TAMRA-p-39; EGF: F 59-AGCTAACCCATTATGGCAACA-39, R 59-AGTTTTCACTGAGTCAGCTCCAT-39, P 59-FAM-AGGGCCCTGGACCCACCAC-TAMRA-p-39; TGF-α: F 59-GGACAGCACTGCCAGAGA-39, ...

Tópico(s): Estrogen and related hormone effects

2003 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Dongyun Liu, Taku Kobayashi, Steven M. Russo, Fengling Li, Scott E. Plevy, Todd M. Gambling, Johnny L. Carson, Russell J. Mumper,

... and-6)-carboxytetramethylrhodamine labeled HIV transactivator protein TAT (TAMRA-TAT), was used as a model peptide. Water- ... appearance, viscosity, conductivity, morphology, and particle size analysis. TAMRA-TAT was loaded and its enzymatic stability was ... fluid (MSIF) in vitro. In in vivo studies, TAMRA-TAT intestinal distribution was evaluated using fluorescence microscopy after TAMRA-TAT microemulsion, TAMRA-TAT solution, and placebo microemulsion were orally gavaged to mice. The half-life of TAMRA-TAT in microemulsion was enhanced nearly three-fold ...

Tópico(s): Surfactants and Colloidal Systems

2012 - Springer Science+Business Media | The AAPS Journal

Artigo Acesso aberto Revisado por pares

Dina Navia‐Paldanius, Juha R. Savinainen, Jarmo T. Laitinen,

... with the active site serine-directed fluorophosphonate probe TAMRA-FP. However, the role of D278 and H306 ... with the active site serine-directed fluorophosphonate probe TAMRA-FP. However, the role of D278 and H306 ... profiling (ABPP) was conducted using the fluorophosphonate probe TAMRA-FP (ActivX Fluorophosphonate Probes, Thermo Fisher Scientific Inc., ... labeled with 0.5 µl of 100 µM TAMRA-FP for 1 h at RT. The reaction ... residues). ABPP with the active site serine-targeting TAMRA-FP probe indicated that the three hydrolases were ...

Tópico(s): Diet, Metabolism, and Disease

2012 - Elsevier BV | Journal of Lipid Research

Artigo Acesso aberto Revisado por pares

R. James Christie, Constantino J. Tadiello, Lisa M. Chamberlain, David W. Grainger,

Thiolated dimeric tetramethylrhodamine (TAMRA) was synthesized in a straightforward procedure utilizing commercially available 5(6)-succinimidyl TAMRA and cystamine hydrochloride. The thiol-containing TAMRA dimer displayed distinct spectral properties in reduced and ... the spectral properties than previously reported for noncovalent TAMRA dimers or dimers formed with shorter carbon spacers. The resulting TAMRA disulfide dimer exhibited a hypsochromic shift of 34 ... the monomer and dimer relative to moles of TAMRA were similar (6.61 x 10(4) M(- ...

Tópico(s): Photodynamic Therapy Research Studies

2009 - American Chemical Society | Bioconjugate Chemistry

Artigo Acesso aberto Revisado por pares

Steven D. Creacy, Eric D. Routh, Fumiko Iwamoto, Yoshikuni Nagamine, Steven A. Akman, James P. Vaughn,

... and N = A, C, G, or T/U; TAMRA, 5,6-carboxytetramethylrhodamine; shRNA, short hairpin RNA; BisTris, ... from Dharmacon Research and oligodeoxyribonucleotides (unlabeled or 5′-TAMRA-labeled) were purchased from either Oligos Etc. or ... not shown). G4 nucleic acids formed from 5′-TAMRA-labeled oligonucleotides were further purified by electrophoresis on ... The Elutrap was run with buffer recirculation. 5′-TAMRA-labeled G4 nucleic acids were aliquoted and stored ... pmol of 5′-end-labeled quadruplex (32P or TAMRA) were included per 50-μl reaction. Reactions were ...

Tópico(s): RNA Interference and Gene Delivery

2008 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Shuji Muramatsu, M. Wakabayashi, Takeshi Ohno, Katsuhiko Amano, Rika Ooishi, Toshinori Sugahara, Satoshi Shiojiri, Kosuke Tashiro, Yutaka Suzuki, Riko Nishimura, Satoru Kuhara, Sumio Sugano, Toshiyuki Yoneda, Akio Matsuda,

... shRNA against the TRPV4 gene; FAM, 6-carboxyfluorescein; TAMRA, 6-carboxy tetramethyl rhodamine. and MAPK signaling pathways, ... sequence for mouse TRPV4 was 5′-FAM-TCAGCCACTGGAGGGCACGC-TAMRA-3′, and the PCR primers were 5′-TCTTCACCCTCACCGCCTACT- ... dual fluorophore-labeled primer was 5′-FAM-ACTGAGGGCTCCCAGAACATCACCTA-TAMRA-3′, and the PCR primers were 5′-TCCAGATGACTTTCCTCCGTCTA- ... dual fluorophore-labeled primer was 5′-FAM-CGTGTAAAAAGGGCACCGTGGCC-TAMRA-3′, and the PCR primers were 5′-GCATGAGAGAGGCGAATGGA- ...

Tópico(s): Silk-based biomaterials and applications

2007 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Christian Plank, Iris Östreicher, Andrea Hartner, Ines Marek, Friedrich G. Struwe, Kerstin Amann, Karl F. Hilgers, Wolfgang Rascher, Jörg Dötsch,

... Reverse: 5′-GCACGTGGATGCTACAGGC-3′Probe: 5′(FAM)-TCACGCTTCTGGGCCTGTTGTTCA-(TAMRA)3′OPNForward: 5′-AAAGTGGCTGAGTTTGGCAG-3′Reverse: 5′-AAGTGGCTACAGCATCTGAGTGT-3′Probe: 5′(FAM)-TCAGAGGAGAAGGCGCATTACAGCA- (TAMRA)3′PAI-1Forward: 5′-TCCGCCATCACCAACATTTT-3′Reverse: 5′-GTCAGTCATGCCCAGCTTCTC-3′Probe: 5′(FAM)-CCGCCTCCTCATCCTGCCTAAGTTCTCT- (TAMRA)3′IL-6Forward: 5′-TCCAAACTGGATATAACCAGGAAAT-3′Reverse: 5′-TTGTCTTTCTTGTTATCTTGTAAGTTGTTCTT-3′Probe: 5′(FAM)-AATCTGCTCTGGTCTTCTGGAGTTCGGTTTCTA- (TAMRA)3′TNFForward: 5′-GACCCTCACACTCAGATCATCTTCT-3′Reverse: 5′-TTGTCTTTGAGATCCATGCCATT- ...

Tópico(s): Neonatal Respiratory Health Research

2006 - Elsevier BV | Kidney International

Artigo Acesso aberto Revisado por pares

Stephan Ryser, Toshitsugu Fujita, Silvia Tórtola, Isabelle Piuz, Werner Schlegel,

... s F10 serum-free medium; RT, reverse transcription; TAMRA, 6-carboxytetramethylrhodamine; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PIC, ... nm TaqMan probe 5′-FAM (6-carboxyfluorescein)-CGCAGACTTCTCGTCTTCAAGTTGATCTGTCT-TAMRA (6-carboxytetramethyrhodamine)-3′. GAPDH and H1 mRNA level ... TGTGTAAAGGAGGGAGGGATTG-3′; and RCFRD-970TR, 5′-FAM-AGCCGGCGAGCTGTTCCCG-TAMRA-3′. For c-fos PP: RCFRD-1239F, 5′- ... 5′-GCCTCGTAGTCCGCGTTGA-3′; RCFRD-1441T, 5′-FAM-CAAACCACGACCATGATGTTCTCGGGT-TAMRA-3′. For c-fos intron 1: RCFRD-1802F, ...

Tópico(s): Retinoids in leukemia and cellular processes

2006 - Elsevier BV | Journal of Biological Chemistry

Artigo Revisado por pares

Matthew H. Lyttle, Timothy G. Carter, Daren J. Dick, Ronald M. Cook,

5-Carboxy Tamra 1 was conjugated to 4-hydroxypiperidine with BOP and N-methylmorpholine, and the resulting 5-(N-pipyridyl-4-hydroxy)-Tamra carboxamide 2 was treated with 2-cyanoethyl tetraisopropylphosphorodiamidite ... 5-[N-pipyridyl-4-O-(2-cyanoethyl diisopropylphosphoramidite)]-Tamra carboxamide 3. Solutions of 3 were coupled onto ... deprotection with aqueous tert-butylamine cocktail gave 5-Tamra-functionalized DNA as well as an additional compound without the Tamra chromophore. A mass spectrum of this product showed ...

Tópico(s): HIV/AIDS drug development and treatment

2000 - American Chemical Society | The Journal of Organic Chemistry

Artigo Acesso aberto Revisado por pares

Andrew J. Witten, Karin F.K. Ejendal, Lindsey Gengelbach O'Brien, Meghan A. Traore, Xu Wang, David M. Umulis, Sarah Calve, Tamara L. Kinzer‐Ursem,

... cell protein lysates were selectively labeled with tetramethylrhodamine (TAMRA) alkyne (Click Chemistry Tools, Scottsdale, AZ) (Fig. 1D) ... lysate was added to each click reaction. Free TAMRA-alkyne dye was removed by methanol-chloroform precipitation. ... 565 emission) to detect proteins labeled with the TAMRA-alkyne. To quantify the rate of 12-ADA ... Cytosolic proteins containing 12-ADA were labeled with TAMRA-alkyne or AlexaFluor 647-alkyne following (14.Calve ... fluorophore stability, 800 nM AlexaFluor 647-alkyne or TAMRA-alkyne were mixed with 0.01–2 M ...

Tópico(s): Cellular transport and secretion

2017 - Elsevier BV | Journal of Lipid Research

Artigo Acesso aberto

Ekaterina A. Potter, Е. В. Долгова, Anastasia S. Proskurina, Yaroslav R. Efremov, Alexandra M. Minkevich, А. С. Розанов, S. E. Peltek, В. П. Николин, Н. А. Попова, Igor Seledtsov, В. В. Молодцов, Evgeniy L. Zavyalov, О. С. Таранов, Sergey I. Baiborodin, А. А. Останин, Е. Р. Черных, Н. А. Колчанов, С. С. Богачев,

... stem cells, DNA internalization, RNAseq, Real Time PCR, TAMRA Received: August 29, 2016 Accepted: December 15, 2016 ... of tumor-inducing cancer stem cells. Having combined TAMRA-labeled DNA probe and the power of RNA- ... a set of 168 genes specifically expressed in TAMRA-positive cells (tumor-initiating stem cells), these genes remaining silent in TAMRA-negative cancer cells. TAMRA+ cells displayed gene expression signatures characteristic of both ... and cancer cells. The observed expression differences between TAMRA+ and TAMRA− cells were validated by Real Time ...

Tópico(s): Epigenetics and DNA Methylation

2016 - Impact Journals LLC | Oncotarget

Artigo Acesso aberto Revisado por pares

SwapnilY Chaudhari, Dhirajsingh Rajput, R Galib, PK Prajapati,

Tamra Bhasma, one among the herbo-metallic preparations is extensively used in Ayurveda for different conditions. To make it safe to use, Tamra has to pass through a set of classical ... corm of Amorphophallus campanulatus Linn. FTIR profiles of Tamra Bhasma at different levels is not available.To evaluate the chemical changes in Tamra Bhasma at different steps by following Fourier transform infrared (FTIR) spectroscopy.In current study, raw Tamra, intermediate samples obtained during purification, incineration and Amritikarana ...

Tópico(s): Polysaccharides Composition and Applications

2015 - Medknow | AYU (An International Quarterly Journal of Research in Ayurveda)

Artigo Acesso aberto Revisado por pares

Paul A. Wilson, Scott D. Gardner, Natalie M. Lambie, Stéphane Commans, Daniel Crowther,

... phospholipase 3 (PNPLA3)/ADPN/AAATGCCAGTGAGCAGCCAA/TCTCTGCTGGACAGCCCTTG/FAM-CTCCCCATGCACACCTGAGCAGGACT-TAMRA; PNPLA7/FLJ43070/GCCTCTGTACCTGCCCTGCT/CTGTATGCAGGGCTGCTGGT/FAM-CCCAGAGAACCCTAACACAGCCTGGGG-TAMRA; PNPLA6/NTE/AGCCACAGATGCCTGAGGAC/GGGCAGGTCAGTCCAGTGTG/FAM-CTCACTCCCCCTCCTGCTGCTATGCCT-TAMRA; PNPLA9/PLA2G6/ACCGCGAGGAGTTCCAGAAG/AATGGACGAGGTCAGCTGGG/FAM-TCATCCACCTGCTGCTCTCACCCTGAG-TAMRA; PNPLA8/iPLA2γ/GCTAGACCCTGTTGCCCAGA/GGTTCTTGCAGCAAAGGCAG/FAM-TTGAACCACATCTCACAGCCTCTGTGA-TAMRA; PNPLA1/GCAGTGGGAGATTGGGCTTT/TGTCCCAACCATGATCCCTG/FAM-AAAATTCCTGCTCTGCCACAGCTCCAC-TAMRA; PNPLA4/GS2/ ...

Tópico(s): Ubiquitin and proteasome pathways

2006 - Elsevier BV | Journal of Lipid Research

Artigo Acesso aberto Revisado por pares

Christine Esau, Xiaolin Kang, Eigen Peralta, Elaine Hanson, Eric G. Marcusson, Lingamanaidu V. Ravichandran, Yingqing Sun, Seongjoon Koo, Ranjan J. Perera, Ravi Jain, Nicholas M. Dean, Susan M. Freier, C. Frank Bennett, Bridget Lollo, Richard H. Griffey,

... receptor-γ; RT, reverse transcription; FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine; ERK, extracellular signal-regulated kinase; G3PDH, ... receptor-γ; RT, reverse transcription; FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine; ERK, extracellular signal-regulated kinase; G3PDH, ... 5′-CAACGTCCCTTGGCTTATGC-3′ (reverse); probe, 5′-FAM-AAGGCGTCACTTCCACGAGAGTTTATGAGA-TAMRA-3′; glucose transporter 4 (GLUT4), 5′-GGCCTCCGCAGGTTCTG-3′ ( ... 5′-TTCGGAGCCTATCTGTTGGAA-3′ (reverse); probe, 5′-FAM-TCCAGGCCGGAGTCAGAGACTCCA-TAMRA-3′; hormone-sensitive lipase (HSL), 5′-ACCTGCGCACAATGACACA-3′ ( ...

Tópico(s): Cancer-related molecular mechanisms research

2004 - Elsevier BV | Journal of Biological Chemistry