John Huxley, Michael Prescott, Mark Skipworth Consumer Affairs Correspondent, Pete Bradley, Barbara Hall, Priscilla Appelbe, Richard Ellis, James Dairymple, Paul Nelson, Jon Swain, Helen Davidson, Peter Gillman, John Peter, Andrew Grice Political Correspondent, Mark Reason, John Harlow Transport Correspondent, Jonathan Miller, John Chittock, Eric Dymock, Barbara Ellis, Susan d'Arcy, Joanna Duckworth, Danby Bloch, John Diamond, Frank Whitford, Graham Rose, Steven Goldman, Richard Button, Norma Major, Francis Proudlock, Nicolette Jones, Diana Wright Personal Finance Editor, Kirstle Hamilton, Alistair Scott, Sally Payne, Simon Haskel (Chairman), David Smith, Lucy Hughes-Hallett, Nick Pitt, Frederic Raphael, Charles Hymas, Rebecca Mead, Marlin James, Gareth Boote, Neville Hodgkinson, Martin James, Robert Sandall, Iain Johnstone, Irwin Stelzer, Dr David Lowry Director, Cyril Dixon, Ivan Fallon, Deryk Brown, Robert Hewison, David Dougill, Edna Healey, H Davies Jp, John Gribbin, Alan Bold, Jill Morrell, Alfred Laurence, Tony O'Dwyer, Jane Preston, John McCarthy, Gareth Daniels, Harvey Porlock, Hugh Canning, Margarette Driscoll, Peter Kemp, Sean Ryan, Timothy Schofield, Geoff Whitten, Richard Shafer, Hans Eysenck Professor Emeritus of Psychology, Peter Kellner, George Perry, Sue Mott, E Stewart, Mark Skipworth, Carol Ann Duffy, Anatole Kaletsky, Nick Gardner, Shelley von Strunckel, Bernard Cafferty, Nigel Barley, Stuart Wavell, Roger Eglin, Martin Turner, Michael Prescott Political Correspondent, Paul Donovan, Alan Ruddock Deputy City Editor, Jeff Randall, Harry Lovelock, James Bethell, Grant McCrostie, James Adams, Lawrence Millman, Margaret Dibben, Liz Lightfoot, Nicholas Fraser, Tim Rayment, Mark Edwards, Kirstie Hamilton, Tom Shone, Rufus Olins, Stephen Amidon, Jill Insley, Martin Jacques, Ira Miller, Adam Smith, Christopher Lloyd, Lois Rogers, Sue Ellicott, John Karter, Julian Browne, Barbara Amiel, Malcolm Winton, Cosmo Landesman, Christopher Ruane, Craig Brown, Diana Wright, Kirstle Hamllton, Margaret Forster, Peter Bryan, Stephen Jones, Chris Campling, Richard Palmer, S Georgiou President, Andrew Grice, Martin Searby, Annie Murphy, Keith Martin, David Lodge, James Mackey, Karen Armstrong, Cheryl Younson, Andrew Lorenz Associate Business Editor, Andrew Hogg, Tim Willis, Brough Scott, Bruce Johnston, Richard Woods, Clive Everton, Robert Green, Peter Johnson, Toni Rodgers, Maurice Chittenden, Stan Howes, Will Self, Sally Reauman, Sir Sigmund Sternberg (Deputy Chairman), Rebecca Fowler, David Hunn, Paul Bethel, Michael Swan, Tessa Thomas, Michela Wrong, Mihir Bose, Suzanne Moore, Andrew Alderson, Alastair Burnet, Michael Jakeman, Roy Hattersley, Matthew Campbell, Stan Levenson, Norman Macrae, Chris Dighton, Tom Tickell, Gilbert Adair, Andrew Lorenz, Liam Clarke, David Wickers, John Bald, Alan Ruddock, Jonathan Margolls, Chris Lightbown, Vince Wright, Nigel Roebuck, Hugh Pearman, Richard Caseby, Paula Reed, David Smith Economics Editor, Tony Hetherington, Walter Ellis, James Dalrymple, Joanna Simon, Hard Acts, Janine di Giovanni, Matthew Crabbe, Irma Kurtz, Boris Schapiro, Karen Robinson,
... family are not incompatible with the priesthood. James MacKey explains Picture Gallery Death by a thousand cuts ... dead on television, asks Nicholas Fraser The Old Vic Love and lobsters In the movies, the path ...
1993 - Gale Group | Sunday Times HA GDA
Samuel W. Lukowski, Camden Lo, Alexei A. Sharov, Quan Nguyen, Lyujie Fang, Sandy Hung, Ling Zhu, Ting Zhang, Ulrike Grünert, Tu Nguyen, Anne Senabouth, Jafar S. Jabbari, Emily Welby, Jane C. Sowden, Hayley S. Waugh, Adrienne Mackey, Graeme S. Pollock, Trevor D. Lamb, Peng‐Yuan Wang, Alex W. Hewitt, Mark C. Gillies, Joseph E. Powell, Raymond C.B. Wong,
... Search for more papers by this author Adrienne Mackey Lions Eye Donation Services, Melbourne, Vic., Australia Search for more papers by this author ... Search for more papers by this author Adrienne Mackey Lions Eye Donation Services, Melbourne, Vic., Australia Search for more papers by this author ...
Tópico(s): Retinal Diseases and Treatments
2019 - Springer Nature | The EMBO Journal
F Reed, Rhoda Koenig, Barbara Hall, Paul Nelson, Richard Ellis, Rob Buchanan, Professor Alan Thompson, Helen Davidson, Grace Bradberry, Helen Mills, David Nicholson, Andrew Grice Political Correspondent, Yoseph Offer, Eric Dymock, Firdaus Kanga, Victor Price, Susan d'Arcy, Bernard Kaukas, Nick Rufford, Frank Whitford, Graham Rose, David Blunkett, Diana Wright Personal Finance Editor, Sally Payne, David Smith, Humphrey Carpenter, Norman Black, Nick Pitt, Alleen Ballantyne, Rebecca Mead, Paul Fisher, Carol Sarler, Geordie Greig, Tony Allen-Mills, Martin James, Robert Sandall, Jean Farrow, Iain Johnstone, Alan J Clark, Irwin Stelzer, Robert Hewison, Ivan Fallon, David Hellier, Edwin Morgan, David Dougill, Alan Bergson, Julie Alexander, Cliff Temple, Stanley Schofield, B Galpin, Auberon Waugh, Ropert Widdlcombe, Sarajevo, William Fotheringham, John Swain, Harvey Porlock, Hugh Canning, Peter Kemp, Peter Millar, Caroline Lees, Dr Mary Penrith, Brian Morton, Peter Hadfield, George Perry, Robin Marlar, Mark Skipworth, Shelley von Strunckel, P Clews Squadron Leader, Adrian Turner, Bernard Cafferty, David Irving, Stephanie Ferguson, Michael Nuth, Stuart Wavell, Paul Donovan, Frances Spalding, Peter Lewis, Jeff Randall, Jonathan Todd, Gerald Kaufman, Paul Driver, James Adams, John Ardagh, Fiona Clayton, Neil MacLEAN, David Hughes, W Nott, David Leppard, Tim Rayment, Richard Girling, Kirstie Hamilton, Valerie Kent Psychologist, Rufus Olins, Sir Hardy Amies, Melvyn Carlowe Chief Executive, Julian Loose, Daria Antonucci, Martin Jacques, Theodore Zeldin, Roger Williams, Christopher Lloyd, Charles Hymas Education Correspondent, Helen Fielding, Peter Gartland, John Karter, Kate Saunders, Barbara Amiel, Malcolm Winton, Marie Colvin, Greg Hadfield, Diana Wright, Craig Brown, Dr Philip Wiles Consultant Physician, Sir Peter Emery Tony MP, Richard Palmer, Andrew Wheatcroft, Andrew Grice, Martin Searby, Keith Wheatley, Ian Birrell, John Gummer, Rod Mackenzie, Keith Martin, Joe Sonnabend, Dilys Powell, Ian Burrell, Kenneth Hatley, Norman Stone, Robert Green, Peter Johnson, David Rose Director, Maurice Chittenden, Mitchell Symons, Iain Jenkins Economics Editor, Mel Webb, Michael Jones Political Editor, Andrew Yates, David Hunn, D J Taylor, Jack Barnes, Mihir Bose, John Harlow, Godfrey Smith, Michael Austin, Andrew Alderson, Roy Hattersley, Matthew Campbell, June Gahan, Stan Levenson, Jasper Gerrard, Norman Macrae, Chris Dighton, Rajeev Syal, Lauren St John, Andrew Lorenz, John Furbisher, Roy Isacowitz, David Wickers, Alan Ruddock, Oliver Rivers, Trevor McDonald, Sir Hardy Amies Courl dressmarker, Professor E Wragg, John Parker, Sara Thomson, Paul Pickering, Hugh Pearman, Jeff Randall City Editor, Paula Reed, Giles Trendle, Paul Judge, David Smith Economics Editor, Susan Ellicott, Tony Hetherington, Peter Roebuck, Joanna Simon, Alan, Boris Schapiro, Jock Howard,
... elite rallies round the red rose Ranfurly Johnston Mackey The new New Zealand Greene lover furious over ' ... an Electric debut Video Fast forward Bristol Old-Vic Grand Hotel Multiple Classified Advertising Items Classical Concerts ...
1992 - Gale Group | Sunday Times HA GDA
Fernando Canet, A.N. García-Martínez,
... que el relato se dilate decenas de horas.Vic Mackey (The Shield), Dexter Morgan (Dexter) o Nucky Thompson ( ...
Tópico(s): Media and Digital Communication
2018 - University of La Sabana | Palabra Clave
Deve, Jonathan Northcroft, John Dugdale, A. A. Gill, Jonathan Storey, Sacha Baron Cohen, Matthew Wall, Chris Lambie Halifax, Lucas Hollweg, J B, Jon Swain, Helen Davies, James Clark, Rob Hughes, John Peter, Emma Moore, Jonathan Miller, Adam Zamoyski, Mike Broad, Martin Jay, Ed Allingham, Emine Saner, Nick Rufford, M K, Kathryn Cooper, David Smith, Jasper Garard, Tim Richards, Donu Kogbara, David Cracknell Political Editor, DAvid Cracknell, Sally Roth, E P, Bill Shillibeer, Clive Davis, Patricia Hewitt, K R, Guy Dennis, Andy Brough, Simon Wilde, Cornwall, Safly Kinnes, Anthony Sattin, Robert Levering, G Dosanjh, Robert Winnett, Irwin Stelzer, Robert Hewison, Carl Evans, Nicholas Hellen Social Affairs Editor, Donald Rumsfeld, Liam Mackenzie, John Waples Deputy Business Editor, Geraldine Hackett, Robert Peston, David Hewson, Cally Law, Hugh Canning, Alasdair Reid, Margarette Driscoll, Jeremy Clarkson, Stewart Lee, Edward Porter, Victoria Segal, Louise Taylor, David Soul, Richard Caseby Managing Editor The Sunday Times, Eben Black, David Smith Economic Editor, John O'Donnell, Nick Caln, George Perry, Adam Nathan, Nick Gardner, Giles Milton, Margaret Williams, Karthryn Cooper, Paul Bailey, Brian Schofielsd, St Mawgan, Peter Parker, Paul Ham, Stuart Wavell, Paul Donovan, Liz Bailey, H L, Sadruddin Aga Khan, Lucinda Kemeny, Jasper Gerard, Paul Driver, Michael Woodhead, John Humphrys, Ann McFerran, Nicholas Hellen, Richard Brooks, Sally Jones, Richard Lewls, Ian Hawkey, Heron, Shelley Von Strunckel, Frances Richardson, Paul Durman, Alicia Wyllie, Mark Edwards, Sarah Gracie, Ray6 Hutton, Susan Clark, Clive Godwin, Danny O'Brien, John Barry, David Beckham, Swansea, Karen Gold, Victoria O'Brien, Lois Rogers, Michael Wills, Alan Combes, Catherine Baudrand, Dr. John Snyder, David Cracknell, Senay Boztas, Dr Andrew Will, Jack Warden, Golden Brodsworth bed, T. P. York, Cosmo Landesman, Robbie Hudson, Dominic O'Connell, Barry Flatman, Richard Evans, Louise Armitstead, Max Glaxkin, Michael Wright, Phill Craigle, Tony Allen Mills, Melvyn Bragg, Amber Corvan, Caroline Donald, Keith Wheatley, Ressie Millard, David Walsh, Jack Grimston, Jean Allen, Colin McDowell, Shah Sahari, Stephen Armstrong, John Elliott, Ron Clarke, David Dougil, Christopher Goodwin, Lucas Hollwag, Bethan Cole, R W Johnson, Richard Woods, E. P., Natalla Marshall, Monica Littleboy, Maurice Chittenden, Charlotte Metcalfe, Richard Rae, Frank Fitzgibbon, Jon Follain, Jonathan Leake, John Harlow, Barry Collins, Victoria Greenhalgh, John Waples, Milton Moskowitz, Matthew Campbell, Brian Glanville, John Carey, Natalle Graham, Janet Russel, Stephen Pettitt, Claudia Croft, Robert Johnston, Jonathan Leake Science Editor, Jonathan Calvert, Sally Kinnes, Sam Thackray, Liam Clarke, Nigel Powell, Minette Marrin, John Cornwell, Graham Norwood, P W, Joe Lovejoy, Rupert Steiner, David Budworth, Halifax, Gordon Brown, Hugh Pearman, William Peak, Steve Henley, Dan Cairns, Joyce Gape, Kevin Maguire, David Smith Economics Editor, David Logan, Penny Perrick, Sam Millatt, Simon Crerar, Anthony Howard, Sarah Baxter, Helen Vandevelde, Joanna Simon, Matthew Goodman, Victoria Stanley, Steve Grant, Nichola Venning, Louise Tayler, Sophie Craven,
... too high? Kingfisher is big Diy job for Mackey Chairman Francis Mackay is calling the shots in ... hard place The Times Literary Supplement The Old Vic Rest of the week's theatre King Lear ...
2002 - Gale Group | Sunday Times HA GDA
... and Ear Hospital, 32 Gisborne Street, East Melbourne, VIC, 3002Search for more papers by this author David Mackey MD, FRACO, David Mackey MD, FRACO Senior Lecturer Department of Ophthalmology, University of Melbourne, Royal Victorian Eye and Ear Hospital, 32 Gisborne Street, East Melbourne, VIC, 3002Search for more papers by this author First published: 01 June 1994 https://doi.org/10.5694/j.1326-5377.1994.tb125944.xCitations: 2 Reprints: Dr D Mackey. AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare ...
Tópico(s): Ocular Diseases and Behçet’s Syndrome
1994 - Wiley | The Medical Journal of Australia
... nihilistic police drama The Shield, where murderous cop Vic Mackey (Michael Chiklis) and his estranged wife struggle to ...
2007 - Elsevier BV | The Lancet Neurology
Maximillian A. Rogers, Elena Aïkawa,
... Kittner SJ, Lackland DT, Lichtman JH, Lisabeth LD, Mackey RH, Magid DJ, Marcus GM, Marelli A, Matchar ...
Tópico(s): Lipoproteins and Cardiovascular Health
2015 - Lippincott Williams & Wilkins | Circulation
Yongmei Zhang, Hédia Marrakchi, Charles O. Rock,
... washing were performed using standard procedures (28Brown T. Mackey K. Ausubel F.M. Brent R. Kingston R. ... 5′-ends with the reporter dyes, 3FAM or VIC, and at the 3′-ends with the quencher ... primers and probes (5′ → 3′)GeneForward primerProbe, 5′-VIC or FAM and 3′-TAMRAReverse primeracpPAGCTGGTAATGGCTCTGGAAGAVIC-AGTTTGATACTGAGATTCCGGACGAAGACTGAACGGTGGTGATTTTCTCAfabACTCTGGTCGCGGTGAACTGTFAM-TGGCGCTAAAGGCCCGCAATTGGGTCCATCATCAGCATGTTCGfabBCTGGCGCGTGGTGCTCFAM- ...
Tópico(s): RNA and protein synthesis mechanisms
2002 - Elsevier BV | Journal of Biological Chemistry
... 6560–6572 (2013).Crossref, Medline, CAS, Google Scholar14 Mackey MD, Melville JL. Better than random? The chemotype ...
Tópico(s): Bioinformatics and Genomic Networks
2013 - Future Science Ltd | Future Medicinal Chemistry
Andrew Bivard, Henry Zhao, Leonid Churilov, Bruce Campbell, Skye Coote, Nawaf Yassi, Bernard Yan, Michael Valente, Angelos Sharobeam, Anna Balabanski, Angela Dos Santos, Jo Lyn Ng, Vignan Yogendrakumar, Felix Ng, Francesca Langenberg, Damien Easton, Alex Warwick, Elizabeth A. Mackey, Amy MacDonald, Gagan Sharma, Michael Stephenson, Karen Smith, David Anderson, Philip Choi, Vincent Thijs, Henry Ma, Geoffrey Cloud, Tissa Wijeratne, Liudmyla Olenko, Dominic Italiano, Stephen M. Davis, Geoffrey A. Donnan, Mark Parsons,
... Melbourne MSU and five tertiary hospitals in Melbourne, VIC, Australia. Patients (aged ≥18 years) with ischaemic stroke ...
Tópico(s): Stroke Rehabilitation and Recovery
2022 - Elsevier BV | The Lancet Neurology
... Lackland DT, Lichtman JH, Lisabeth LD, Liu S, Mackey RH, Matchar DB, McGuire DK, Mohler ER, Moy ...
Tópico(s): Infective Endocarditis Diagnosis and Management
2018 - Lippincott Williams & Wilkins | Circulation
Joshua Foreman, Myra B. McGuinness, David A. Mackey, Peter van Wijngaarden,
... AustraliaSearch for more papers by this authorDavid A. Mackey MD FRANZCO, David A. Mackey MD FRANZCO orcid.org/0000-0001-7914-4709 ... AustraliaSearch for more papers by this authorDavid A. Mackey MD FRANZCO, David A. Mackey MD FRANZCO orcid.org/0000-0001-7914-4709 ...
Tópico(s): COVID-19 and healthcare impacts
2020 - Wiley | Clinical and Experimental Ophthalmology
Song T. Yao, Michael J. McKinley, Clive N. May,
... Kissela BM, Lichtman JH, Lisabeth LD, Liu S, Mackey RH, Magid DJ, McGuire DK, Mohler ER III, ... Florey Laboratories, Royal Parade, University of Melbourne, Melbourne, VIC 3010, Australia (e-mail: [email protected]edu.au). ...
Tópico(s): Cardiovascular and exercise physiology
2017 - American Physical Society | AJP Heart and Circulatory Physiology
Paul G. Sanfilippo, Colleen H. Wilkinson, Jonathan B. Ruddle, Gu Zhu, Nicholas G. Martin, Alex W. Hewitt, David A. Mackey,
... of individuals living in the southern states (TAS/VIC) of Australia having lighter-coloured irides compared to ...
Tópico(s): Climate Change and Health Impacts
2014 - Taylor & Francis | Clinical and Experimental Optometry
Mark Edwards, Gordon Forbes, Neil Walker, Dion Morton, Monty Mythen, Dave Murray, I D Anderson, Borislava Mihaylova, Ann Thomson, Matt Taylor, Marianne Hollyman, Rachel Phillips, Keith A. Young, Brennan C Kahan, Rupert M. Pearse, Michael P. W. Grocott, Alexandra Skubala, Patrick Tapley, Suzanne Kellett, Clare Bolger, Rachel Burnish, Nikki Collings, Andrew F. Cumpstey, Hannah J. Wong, Vic Rehnberg, Jessica Lees, Karen Salmon, Naomi Wee, Sarah Harrison, Li Ping Gan, C Halloran, Georgios Tsiopanis, Said Seifalian, Richard Webster, Martin Knight, Hannah Theobald, Anna Clark, Thomas Nicholls, James C. Willey, Sophia Beeby, Luke Bracegirdle, Kate S. Stoddard, Belinda Roberts, Alice Baker, Norma Diaper, Jonathan Biss, Michael J. Carter, F Riccio, James Green, Lucy Johnstone, Jade Rand, Kasia Wisniewska, Grant Gibson, Hannah Bateson, Michelle Beveridge, Martyna Marani, Isabel Monger, Agnieszka Burtt, Gary Minto, I. Christie, Anna Fergusson, Abigail Patrick, Stuart Cleland, Charlotte Eglinton, Natasha Wilmshurst, Fiona Reed, Joanne Smith, Anna Ratcliffe, Elizabeth Freeman, Jennie Kingdon, J. Humphreys, Sarah J. Nelson, Adrian Jennings, Angela Watts, Andrew Moores, Lucy Smith, Jenny Wright, Julian Sonksen, Caroline Moody, Philip Harrington, Jack Lee, Nadim Kozman, Zoe Riddell, Catherine A. Brennan, Shakira Nathoo, Vikram Anumakonda, Andrea Gait, Richard N. Pierson, Raj Patel, Lee Plant, Nipun Agarwal, Hadassah Ihlenfeldt, J.F. Heggie, Rachel Rowan Olive, Joseph Pick, Sally Hinsley, N. Calthorpe, Julie Matthews, Wendy Gardner, C Topham, Edward Jones, Elliot Yates, Sachin Sekhsaria, Mohamed Amer, P. Pemberton, Nicholas Coffin, Halden Hutchinson-Bazely, Karen Pearson, Tracy Edwards, Beth Fitzmaurice, Anna Pierson, Katie E. Archer, Omar Ahmed, Sajid Khan Mohammed, Alex Hollis, Stephanie Weedon, David Hillier, Joanna Lau, Vishal Amin, Laura Dixon, Joseph Seager, Joe Tyler, Stacey Forsey, N. Parry, Aamer Mughal, Jialuen Goh, Rose Tiller, Daniel Taylor, Hasini Rallage, Alexandra Leech, John Harris, Claire Gabriel, Sheron Clarke, Katherine Pagett, Thomas Rudnick, Nicholas M. Brown, Sarah Hare, Eimhear Lusby, Edward Bayliss, Chris Ward, Rahul Bandopadhyay, Kerrie Wilson, Theodore Floyd, Iram Ahmed, Tom Hatton, Malgorzata Szeszo, Thyra Kyere-Diabour, Daniel A. Sumner, Tessa Lawrence, Emma Sutton, Winston Ng, Ioannis Kapsokalyuas, Anthony Carter, A.R. Kansal, L. Bernard, Siew-Ling Harrison, Andrew Feneley, Owen Cooke, Jennifer Hawley, Sophie Berry, Laura Adams, Thomas Hansen, Pieter Bothma, Julie North, María Teresa Ferreira, Karan Verma, Karthik Surendran, Aruthy Arumugam, Sunil Jamadarkhana, Carina Cruz, Pearl Baker, Naomi Brice, Antony Ashton, McDonald Mupudzi, Juliette Kemp, Ajay Rahl, Denise Griffin, Aaron Stokes, Keith Ritchie, A Venkatasubramaniam, Robert Cheek, Madonna Brown, Dawn Trodd, Caroline Wrey Brown, Jane Martin, Samantha J. Hammond, Louisa Mason, Nycola Muchenje, Hamish Breach, Amanda Colston, Malcolm Watters, Edwards Miles, E. J. Marshall, Madeleine Storey, Victoria Hawley, Edward Gomm, Claire Potter, Melanie Knowles, Edward Beech, Peter van Breda, Helen Langton, Nicholas Bruno Suarez, Matthew L. Rowe, Andrei Tănase, J. R. Barnes, David J. Earl, Lorraine Stephenson, Tracy Burdett, Martin Huntley, Emma Cottrell, Hao Tan, Joyce Yeung, Jasraj Kailey, Teresa Melody, Jo Gresty, Julia Sampson, Katie Atterbury, Peter Sutton, Natalie Carling, Eleanor Reeves, Carl Groves, Daniel Crossmann, Sarah Ballinger, Rachel Smith, Marie Thomas, Will Rook, Mohamed Mooradun, Qasim Khan, Arif Qureshi, Llewellyn Fenton-May, Adam Boulton, Daniel G. Whitney, Shilpa Sannakki, Manekar Avinash, Nikiesha Lee, Neha Sharma, S. Magham, Gareth Moncaster, Rebecca L. Boulton, Terri-Ann Sewell, Wayne Lovegrove, John Tansley, Nicholas Watson, Sarah Shelton, Cheryl Heeley, Philip Buckley, Katie Slack, Rebecca Holmes, Andrea Palfreman, Christopher Smith, Mandy Gill, Susan M. Smith, Tracy Brear, Jill Kirk, Megan R. Holmes, C W Goodwin, Margaret Flynn, Inez Wynter, Kaytie Bennett, Stephen Harris, Corrine Pawley, Patricia Doble, Moira Tait, Richard Gibbs, T. Bradley Edwards, P Mackey, Miss Louise Hunt, J. Hutter, E.G. Smyth, Hamish Noble, Thomas Judd, Rose Arkell, Owen Thomas, Karen Watura, Marius Vaida, Suehana Rahman, Saaidullah Sufi, Helder Filipe, Christine Eastgate, Margaret McNeil, S. Howey, Glykeria Pakou, Sara Mingo, Amitaa Maharajh, Irina Grecu, Samantha Hammond, Susan Hanson, Julia Ottaway, Victoria Burgess, James Fry, Geoff Watson, François Wessels, Hugh C. Cutler, Arthur Goldsmith, Mark Howes, S. Sivasubramaniam,
Postoperative morbidity and mortality in patients undergoing major emergency gastrointestinal surgery are a major burden on healthcare systems. Optimal management of perioperative intravenous fluids may reduce mortality rates and improve outcomes from surgery. Previous small trials of cardiac-output guided haemodynamic therapy algorithms in patients undergoing gastrointestinal surgery have suggested this intervention results in reduced complications and a modest reduction in mortality. However, ...
Springer Science+Business Media
... 1st ed., 1966), pp. 32, 45c, from Mrs. Mackey, Box 1692(P), G.P.O., Melbourne, 3001. ... G. Whitlam: Beyond Vietnam: Australia's Regional Responsibility, Vic. Fabian Society, Melbourne, 1968, pp. 50, 60c (+ 5c ...
1969 - Taylor & Francis | Politics
Samantha Sze‐Yee Lee, David A. Mackey,
... Royal Victorian Eye and Ear Hospital, East Melbourne, Vic., Australia Disclosure: The authors declare no conflict of ...
Tópico(s): Acute Ischemic Stroke Management
2021 - Lippincott Williams & Wilkins | Journal of Glaucoma