Limpar
818 resultados

Acesso aberto

Tipo do recurso

Ano de criação

Produção nacional

Revisado por pares

Áreas

Idioma

Editores

Artigo Acesso aberto Revisado por pares

Brian R. Murphy, Nanette T. Hosier, Susan B. Spring, Steven R. Mostow, Robert M. Chanock,

... 1[E] virus was mated with the A/Vic/3/75 wild-type virus. The Vic/75- ts -[E] recombinants that had the two ... two ts -1[E] lesions will predictably attenuate wild-type influenza A virus. Each Vic/75- ts -1[E] recombinant virus that possessed ...

Tópico(s): Virus-based gene therapy research

1978 - American Society for Microbiology | Infection and Immunity

Jornais Acesso aberto

... Willie; or, Cheerful Chums till Chaos Comes, Old Vic's Story, "What Wild and Reckless Leaps Were Those of Sam Patch ...

1886 - Gale Group | NCCO British Theatre

Artigo Acesso aberto Revisado por pares

Yu Akahoshi, Hideki Nakasone, Koji Kawamura, Machiko Kusuda, Shunto Kawamura, Junko Takeshita, Nozomu Yoshino, Yukiko Misaki, Kazuki Yoshimura, Ayumi Gomyo, Aki Tanihara, Masaharu Tamaki, Shun‐ichi Kimura, Shinichi Kako, Yoshinobu Kanda,

... for T315I (5ʹ-FAM-CGGGAGCCCCCGTTCTATATCATCATTGAGTTCATGACCTACGGGAACCTC-MGB-3ʹ) and VIC-labeled probe for wild-type ABL1 (5ʹ-VIC-CGGGAGCCCCCGTTCTATATCATCACTGAGTTCATGACCTACGGGAACCTC-MGB-3ʹ). As the probe/primer sets ...

Tópico(s): Chronic Lymphocytic Leukemia Research

2020 - Elsevier BV | Experimental Hematology

Jornais Acesso aberto

John Willan, Srikumar Sen, Boxing Correspondent, Phil Yates, Julia Llewellyn Smith, Victoria McKee, C. Gillinson, Andrew Roth, Noel Long, Director, Sheila Gunn, Tim Judah and our Foreign Staff, Ralph Carr-Ellison, Chairman, Jill Sherman Political Correspondent, Mike Attenborough, Ronald Faux, John Bryant (Wildlife officer), Fr Paul Williamson, M. J. A. Mortimore, Jill Sherman and Arthur Leathley, Philip Howard, Annie Lear, George Sivell, Kitty Hampton, Wolfgang Münchau, European Business Correspondent, Srikumar Sen, Peter W. Sutcliffe, Chairman, Kevin Eason, Motoring Correspondent, Debra Isaac, Sean Hallahan, Kevin Eason, Adrian Morgan, Colin Narbrough Economics Correspondent, J. A. Bodlender, Chairman, Gerald Davies, Michael Tate, City Editor, Joe Joseph, Martin Fletcher, Stuart Jones, Mitchell Platts, Golf Correspondent, Robin Knox-Johnston, N. Kenyon, Robert Morgan and Arthur Leathley, Nicholas Wood Political Correspondent, Heather Mccauley Principal, Peter Morgan Director General, Michael Evans, Defence Correspondent, Richard Ford Home Correspondent, Robin Young, W. McLennan, Director, Michael Clark, G. A. Paxton-Brown, John Garfield, Charles Bremner, Norman Hammond Archaeology Correspondent, John Percival, Aileen Ballantyne, Bill Westwood, Kate Muir, Ackner, Enid Castle, Principal, Sally Jones, Bronte Flecker, Richard Cork, Adam Lebor, Philip Bassett, Jeremy Isaacs, Melinda Wittstock Media Correspondent, David Miller, Philip Webster, Chief Political Correspondent, Cherry Hamson, Anne Badenoch, David Toop, T. L. A. Daunt, Lindsay Cook, Money Editor, Adrian Rayson, Vaughan Freeman, Jonathan Prynn, Alan Lee, Cricket Correspondent, Robert Worcester, John Russell Taylor, Raymond Keene, Chess Correspondent, Barry Fox, Alix Ramsay, Liz Gill, Jill Sherman, David Powell, Athletics Correspondent, Barry Pickthall, Thierry Cayol, Nigel Hawkes, Science Editor, Clare Hampson, Ian Ross, Michael Hornsby, Agriculture Correspondent, Nicholas Snowman, Geof Wheelwright, John Goodbody, Christopher Walker, Colin Narbrough, Economics Correspondent, Christopher Browne, Mel Webb, Matthew Parris, Richard Evans Racing Correspondent, E. G. F. Johnson, Sue Dibb, Joyce Rose, Chairman, David Green, John Shaw, Michael Seely, Robert Morgan, Peter Riddell, Ben MacIntyre, Peter Victor, Richard Beeston, Michael Phillips, Stephen Pettitt, Russell Hawkes, Paul Davies, Martin Waller, Alan Coren, Benedict Nightingale, Derek Harris, Dr Thomas Stuttaford, Jill Sherman, Political Correspondent, Richard Morrison, Sheila Gunn and Nicholas Wood, Alan Yentob, Anne McElvoy, Harvey Elliott Air Correspondent, Matthew Bond, John O'leary, Education Correspondent, Anthony Howard, David Hands, Rugby Correspondent, Peter Jonas, Colin McQuillan, Andrew Longmore, Tennis Correspondent, Christopher Irvine, Roger Westwood, President,

... Freud muddies the millrace Theatre: London Rosmersholm Young Vic Working with the wild Concert: Birmincham CBSO/Rattle Symphony Hall This will ...

1992 - Gale Group | TDA

Artigo Revisado por pares

Rihab Bouchareb, Nancy Côté, Marie-Chloé-Boulanger, Khaï Le Quang, Diala El Husseini, Jérémie Asselin, Fayez Hadji, Dominic Lachance, Elnur Elyar Shayhidin, Ablajan Mahmut, Philippe Pîbarot, Yohan Bossé, Younès Messaddeq, Denis Boudreau, André Marette, Patrick Mathieu,

... mediated mineral resorption was corroborated by using mouse VICs isolated from wild type and P2Y2R−/− mice. Measurements of extracellular pH ( ...

Tópico(s): Renin-Angiotensin System Studies

2015 - Elsevier BV | Journal of Molecular and Cellular Cardiology

Jornais Acesso aberto

Michael Prescott, Victoria McKee, William Kay, J Hirschkorn, Carol Berger, Paul Nelson, Richard Ellis, James Dairymple, Thomas Hinde, William Chidgey, Jon Swain, Rob Hughes, John Peter, Mark Reason, Dalian Atkinson, John Harlow Transport Correspondent, Jonathan Miller, Bill Gates, Tony Francis, Susan d'Arcy, Nick Rufford, John Diamond, Frank Whitford, Graham Rose, John Stansell, Colln Dryden, Sheridan Morley, Brlan Reading, Christa D'souza, Euenne De Nil General Manager, Kirstle Hamilton, Alistair Scott, Sally Payne, David Smith, Simon Mackenzie, Nick Pitt, Gillian Hall, Charles Hymas, Karen Wright, Liz Hodgkinson, Gerald Ratner, Judith Massey, Geordie Greig, Martin James, Iain Johnstone, Keith Austin, Robert Hewison, Cyril Dixon, Ivan Fallon, Gerald Matthews, David Dougill, Tim Wright, Steve Broadhead, Edwards Welsh, Hugh Canning, Maurice Jay, Michel Montignac, Caroline Lees, George Perry, Sue Mott, Christine Toomey, Bernard Cafferty, Brian Moynahan, Simon Banner, Stuart Wavell, John David, Paul Donovan, Peter Hounam, T Gorsuch, Major Thoburn, Mandy Smith, Simon Mills, Jeff Randall, Paul Driver, James Adams, Paul Bray, Chris Long, Margaret Dibben, Steven Downes, Shelley Von Strunckel, Matthew Gwyther, Tyler Brule, David Leppard, Tim Rayment, Peter Plant, Andrew Gibbon Williams, Richard Girling, Mark Edwards, Tom Shone, Rufus Olins, Mary Anne, David Lawrenson, Martin Jacques, Nick Raynsford Mp, Nicola Davidson, Robert Lacey, Charles Hymas Education Correspondent, Christopher Lloyd, Philip Ross, J Bateman, John Karter, Kate Saunders, Barbara Amiel, Malcolm Winton, Wendy Wilson, Craig Brown, Kipper Williams, Loyd Grossman, Stephen Jones, Carnie, Harry Mullan, Nick Hornby, Tony Allen Mills, Andrew Grice, Tony Osborne, Dominic O'Brien, Martin Searby, Karl Dallas, Marmaduke Hussey, David Mellor, Gabriel Ronay, Dilys Powell, Andrew Lorenz Associate Business Editor, Bernard Fitzsimons, Richard Woods, Clive Everton, Garth Alexander, Norman Stone, Peter Johnson, Sir Christopher Hogg, David Churchill, Mitchell Symons, Michael Jones Political Editor, Andrew Yates, David Hunn, Peter Bennett, Tim Carrigan, Mihir Bose, Philip Beresford, Godfrey Smith, Caitlin Moran, Andrew Alderson, Angus Shearer, Dean Saunders, Ed McHenry, R Keevil, Matthew Campbell, Stan Levenson, Norman Macrae, Chris Dighton, Chris Bidmead, Anthony Holden, Godfrey Golzen, Chrissy Iley, Gilbert Adair, Andrew Lorenz, Liam Clarke, Faci Stephen, Alan Ruddock, Elizabeth Thomas, David Richardson, Chris Lightbown, Vince Wright, Jeff Randall City Editor, Hugh Pearman, John Burns, Alan Sugar, David Smith Economics Editor, Tony Hetherington, Jon Stock, Julia Bright, Peter Roebuck, Bill Wyman, Joanna Simon, Meryl Streep, Philip Jacobson, Jeff Ferry, Iain Jenkins, Janine di Giovanni, Rebecca Mead's, Boris Schapiro, Mark Wallington,

... New Victoria Theatre Richmond Theatre Yuletide Buster Young VIC London City Ballet Lyric Wild Rose International Ltd London Hammersmith Apollo Multiple Classified ...

1992 - Gale Group | Sunday Times HA GDA

Artigo Acesso aberto Revisado por pares

R. Gordon Douglas, Lewis Markoff, Brian R. Murphy, Robert M. Chanock, Robert F. Betts, Frederick G. Hayden, Myron M. Levine, Gillian A. Van Blerk, Steven B. Sotman, David R. Nalin,

... vaccinees who received recombinant 67 were challenged with Vic/75 wild-type virus, and their responses were compared with those of Vic/75- ts -1[E] vaccinees who received recombinant 81 or 113. Each of the three groups of ts -1[E] vaccinees was significantly protected against illness induced by wild-type virus infection, although resistance was not complete. ...

Tópico(s): Immune Response and Inflammation

1979 - American Society for Microbiology | Infection and Immunity

Artigo Acesso aberto Revisado por pares

Susana Benlloch, Artemio Payá, Cristina Alenda, Xavier Bessa, Montserrat Andreu, Rodrigo Jover, Antoni Castells, Xavier Llor, Ignacio Aranda, Bartomeu Massutí,

... chosen reporter fluorophores for TaqMan MGB probes were VIC (Applied Biosystems) for detecting the wild-type allele and 6-carboxyfluorescein (FAM) for the ... 3′, mutant probe 5′-FAM-CTACAGaGAAATCTC-3′, and wild-type probe 5′-VIC-AGCTACAGtGAAATC-3′; and set 2, BRAF-16F (forward) ... ATCCAGACAACTGTTCAAACTGATG, mutant probe 5′-FAM-TAGCTACAGaGAAATC-3′, and wild-type probe 5′-VIC-CTAGCTACAGtGAAATC-3′. Every possible combination of primers and ...

Tópico(s): Cancer Genomics and Diagnostics

2006 - Elsevier BV | Journal of Molecular Diagnostics

Artigo Acesso aberto Revisado por pares

Guanshan Zhu, Xin Ye, Zhengwei Dong, Ya Lu, Yun Sun, Yi Liu, Rose McCormack, Yi Gu, Xiaoqing Liu,

... one nucleotide difference were labeled with FAM and VIC, to detect the mutant and wild-type EGFR allele, respectively. These customized primers and ... to the total copies of EGFR mutant and wild-type DNA templates (FAM and VIC signal). For E19-Del assay, I equals to ...

Tópico(s): Chronic Lymphocytic Leukemia Research

2015 - Elsevier BV | Journal of Molecular Diagnostics

Jornais Acesso aberto

Stephanie Cooper, Phil Yates, Edward Gorman, Sailing Correspondent, Nick Nuttall, Robert Cole, Mark Inglefield Political Reporter, Julian Muscat, Tennis Correspondent, Alexandra Frean, Rob Hughes, Bill Frost, Paul Hoggart, Martin Walker, David Rhys Jones, Robert Lea, Raymond Snoddy, Media Editor, Philip Howard, Susan Bell, Hilary Finch, Carol Midgley, Jeremy Kingston, Mark Henderson and Ruth Gledhill, Brendan Donnelly, Elizabeth Judge, Richard Eaton, Michael Evans, Defence Editor, James Landale, Political Correspondent, George Gill, Tony Patrick, Jennifer Veale, Kevin Eason, Richard Miles and Caroline Merrell, Colin Heape, Christine Buckley Industrial Correspondent, Raymond Snoddy, Gerald Davies, Robert Sheehan, Bridge Correspondent, Joe Joseph, Roland Watson Political Correspondent, Nicholas Crean, Abby Tan, Jill Sherman, Chief Political Correspondent, Graham Lyons, Thrasy Petropoulos, John Hopkins, Golf Correspondent, Stewart Tendler and Stephen Farrell, Dominic Walsh, Shirley English, Alasdair Reid, Carol Midgley, Media Correspondent, Ian Blake, Raymond Keene Chess Correspondent, Rachael Crofts, Michael Harvey, David Coleman, Martin Barrow, Richard Ford Home Correspondent, Robin Young, Mark Inglefield, Rodney Milnes, Michael Clark, Elizabeth Blunt, Jason Allardyce Scottish Political Reporter, Arthur Leathley, Transport Correspondent, and Fraser Nelson, Anna Blundy, Michael Fallon, Martin Fletcher Chief Ireland Correspondent, Charles Bremner, M. D. Jarvis, Michael Leapman, Caroline Merrell Banking Correspondent, Jasper Gerard, Valerie Elliott Whitehall Editor, Russell Kempson, Robert Cole City Correspondent, Nigel Williamson, Paul Armstrong, Paul Durman, Lisa Armstrong, Douglas Ellison, Sydney Friskin, Brian Attewell High Commissioner, Maggie Brown, David Watts, Adam Jones, Stephen Solley, Claudia Joseph and Michael Horsnell, Raymond Keene, C. R. Bullen, Christine Buckley, Frances Gibb, Legal Correspondent, Nigel Cliff, Carl Mortished, International Business Editor, Cathy Harris, Damian Whitworth, Roger Boyes, Sarah Cunningham, Oliver August, Ian Murray Medical Correspondent, Richard Bassett, Adam Fresco, John Allison, John Goodbody, Mary Ann Sieghart, Christopher Walker, Chris Parker, Jane Shilling, Michael Faraday, Simon De Bruxelles, Saeed Shah, Michael A. Hall Managing Director, Brian MacArthur, Paul Nathanson, Gerald Larner, Susan Elkin, Matthew Parris, Kevin McCarra, Chris McGrath, Caitlin Moran, Walter Gammie, Peter Riddell, Jeremy Hart, Ian Brodie, Edward Karam, Adrian Lee and Claudia Joseph, Henry Bonsu, Philip Webster, Richard Miles, David Sinclair, Simon Jenkins, Fraser Nelson, Tim Jones, Norris McWhirter Chairman, Chris Ayres, A. W. Carpenter, Christopher Irvine, Marianne Curphey Insurance Correspondent, Benedict Nightingale, Claire Margetts, Richard Morrison, Frances Gibb, Sam Kiley, John Stevens, Adam Sherwin, John Phillips, Alasdair Murray, Lyn MacDonald, Jan Raath, David Hands, Rugby Correspondent, Alasdair Murray, Economics Correspondent, Hilary White,

... of his sum LSO/Maazel Barbican Walkers Pop Wild, grotesque-fair enough Theatre Bartholomew Fair Young Vic Child's play New York Theatre Witness 'Scars' ...

1999 - Gale Group | TDA

Carta Acesso aberto Revisado por pares

Lutécia H. Mateus Pereira, Alice J. Sigurdson, Michele M. Doody, Marbin Pineda, Bruce H. Alexander, Mark H. Greene, Jeffery P. Struewing,

... against the complementary strand (5′-CCCAAAATCAGT AATCTAAA-3′ wild-type, VIC; 5′-TGCCCAAAATCATAA TCTA-3′ deletion, 6FAM) and primers ...

Tópico(s): Breast Cancer Treatment Studies

2004 - Wiley | International Journal of Cancer

Artigo Acesso aberto Revisado por pares

Mindy Leelawong, Nicholas M. Adams, W. Gabella, David W. Wright, Frederick R. Haselton,

... PubMed Scopus (32) Google ScholarMutant probe with MGB5′-VIC-TGTGTAATGAATACAATTTTTGCTAA-MGB-3′LNA_W (ML045)Wild-type probe with LNAs5′-Cy5-AT+G+AA+ ...

Tópico(s): Mosquito-borne diseases and control

2019 - Elsevier BV | Journal of Molecular Diagnostics

Jornais Acesso aberto

From Robert Fisk, By Christopher Warman Local Government Correspondent, By Arthur Reed, By Peter Evans Home Affairs Correspondent, By Paul Routledge Labour Editor, By Peter Hill Industrial Editor, By George Clark Political Correspondent, By Arthur Reed Air Correspondent, By a Staff Reporter, By Hugh Clayton Agriculture Correspondent, By Donald Macintyre Labour Reporter, By Our Agriculture Correspondent, From Ronald Faux, From Our Correspondent, By Philip Robinson Financial Staff, From Christopher Thomas, By John Witherow, By Robin Young Consumer Affairs Correspondent, By Peter Waymark Motoring Correspondent, By Our Labour Staff, By Annabel Ferriman Health Services Correspondent, By Donald McIntyre, From Diana Geddes Education Correspondent, By Lucy Hodges, By Marcel Berlins Legal Correspondent, From Patricia Clough, From Roger Berthoud, From Michael Hornsby, From Henry Stanhope Defence Correspondent, By Nicholas Hirst, By a Special Correspondent, By Dan van der Vat, By Our Foreign Staff, By Richard Allan, From Tewfik Mishlawi, From Ian Murray, From Christopher Walker, From Nicholas Ashford, From Desse Trevisan, From David Cross, From Our Own Correspondent, From Patrick Brogan, From Michael Binyon, From Jacqueline Reditt, From David Watts, From Peter Hazelhurst, By Norman Fox Football Correspondent, By Keith Macklin, Michael Coleman, By John Hennessy, By David Hands, From Richard Low, From John Nicholls, By Pamela Macgregor-Morris, By Michael Seely, By Rex Bellamy, By Richard Streeton, Geoffrey Weston, Charles Harrison, Guy Arnold, C.H., A Special Correspondent, From a Special Correspondent, Hugh Clayton, Michael Hornsby, Geoffrey Smith, A.L. Rowse, Michael Binyon, Dan van der Vat, JELLICOE., P. C. H. H., PETER VIGGERS, , MIGUEL SCHWEITZER., JEAN MEDAWAR., LEO MENAGE., H. LEHMANN., PAUL WILKINSON., MILTON SHULMAN., BEN STONEHAM., ANDREW STARK., JOAN ABSE., GEOFFREY THOMAS., RANDLE H. COOKE., EDWARD THORPE., NIKOLAI TOLSTOY., DEREK BATTEN., D. W. IRONS., By Charles McKean, From Clive Cookson., By Roy Hay Horticulture Correspondent, By Kenneth Gosling, By Geraldine Norman Sale Room Correspondent, G.E., David Robinson, Hilary Finch, Richard Williams, Max Harrison, William Mann, Ned Chaillet, Philip Howard, Peter Waymark, From David Blake Economics Editor., By Kenneth Owen Technology Editor, Patricia Tisdall, By Peter Hill, Industrial Editor, By Our Financial Staff, By R. W. Shakespeare Northern Industrial Correspondent, By John Huxley, Derek Harris, From David Blake, A. G. GITSHAM, A. SUPER., J. F. HANSON., H. W. BOSWELL., MICHAEL G. AGOSTINI., D. A. ALEXANDER., I C. G. HUXLEY., ANTHONY PARKIN., A. O. H. QUICK., BY THE FINANCIAL EDITOR, Ross Davies, Rodney Hobson, Kenneth Owen, By Roman Eisenstein, By Peter Wainwright, By Rosemary Unsworth, By Richard Alan Insurance Correspondent, From San Francisco, Michael Prest Mining Correspondent, By Peter Wilson-Smith, Peter Davalle,

... in philology, Air Cdre James Wallace. Reviews: Earl Wild Queen Elizabeth Hall, The Merchant of Venice Old Vic, Evangelists of fiction, Holmes/Burnett Wigmore Hall, James ...

1980 - Gale Group | TDA

Artigo Acesso aberto Revisado por pares

Brian R. Murphy, Lewis Markoff, Nanette T. Hosier, Harold M. Rusten, Robert M. Chanock, Alan P. Kendal, R. Gordon Douglas, Robert F. Betts, Thomas R. Cate, Robert B. Couch, Myron M. Levine, Daniel Waterman, H. Preston Holley,

... illness. However, the recombinants were attenuated compared with wild-type virus. The Vic/75- ts -1[E] virus vaccinees shed a larger amount of virus for a longer time than the previous ts -1[E] vaccinees, but they shed less virus than volunteers infected with wild-type virus. The ts -1[E] virus shed ...

Tópico(s): Virology and Viral Diseases

1978 - American Society for Microbiology | Infection and Immunity

Artigo Acesso aberto Revisado por pares

Charles Barrett,

Tópico(s): Travel Writing and Literature

1920 - Taylor & Francis | Emu - Austral Ornithology

Carta Revisado por pares

Paul Holmes, Paul B. Duff,

... in wild finchesTom Pennycott, Becki Lawson, Andrew Cunningham, Vic Simpson, Julian Chantrey, Veterinary RecordIsolation of different serovars of Salmonella enterica from wild birds in Great Britain between 1995 and 2003T. ...

Tópico(s): Escherichia coli research studies

2005 - Wiley | Veterinary Record

Jornais Acesso aberto

From Our Cricket Correspondent, From Our Special Correspondent, From Our Correspondent, From Our Own Correspondent, Parmoor., H. D. A. Major., Astor., C. J. Stranks., Strabolgi., Sven Ahman, From A Correspondent, Robert Morley., N. H. Minter., A. H. Quiggin., Our Estate Market Correspondent, From Our Parliamentary Correspondent,

... In Exile Dr. Giral Appointed Prime Minister, Old Vic And Sadler's Wells, The L.M.S. Railway announces that Mr., Ecclesiastical News Protests At Confirmation Of Dr. Wand. Obituaries: Obituary. Index. Editorials/Leaders: A Link with the Wild West, Ending Lend-Lease, The Charter Of Peace, ...

1945 - Gale Group | TDA

Artigo Revisado por pares

Claire Larramendy-Gozalo, Jue Quin Yang, Céline Verstuyft, Laurent Bodin, Liliane Dubert, Yong Zhang, Chundi Xu, Lian Fan, Patrice Jaillon, Laurent Becquemont,

... TGGAACCAGGTTAGGACTGTCAA3′) and two MGB probes, one recognizing the wild type genotype (5′VIC-AGATCATCGACCCTTG-MGB3′) and the other recognizing the mutated ...

Tópico(s): Hormonal Regulation and Hypertension

2006 - Wiley | Basic & Clinical Pharmacology & Toxicology

Jornais Acesso aberto

Phil Yates, Giles Tremlett, Anthony Harris, Jon Ashworth, Malcolm Oliver, David Adams, Martin Bowley (President), Ben Dunn, Chris Ward, Grace Bradberry, Simon Barnes, Magnus Linklater, Bill Frost, Richard Hobson, James Landale, Political Reporter, Philip Howard, Susan Bell, Alexandra Frean Media Correspondent, Carl Mortished, Nick Nuttall, Environment Correspondent, Morag Preston, Gillian Maxey, Simon Wilde, Anthony Alment, Stewart Tendler, Crime Correspondent, Christine Buckley Industrial Correspondent, Robert Sheehan, Bridge Correspondent, Robert Miller, Jill Sherman, Chief Political Correspondent, Polly Newton, Political Reporter, Stewart Tendler Crime Correspondent, David Charter Education Correspondent, Peter Ball, Shirley English, Raymond Keene Chess Correspondent, Nicholas Booth, Ross Dunn, Peter Waymark, Richard Ford Home Correspondent, Stephen Farrell, Alan Hamilton, Nicholas Watt, Michael Clark, Jeremy Laurance, Health Correspondent, Sir Roy Strong, Quentin Letts, Mary Russell, David Hands, John Kavanagh, Deborah Collcutt, Brian Whittingham, William Shawcross, Nigella Lawson, Russell Kempson, Alasdair Murray and Gavin Lumsden, Brenda Maddox, Michael Theodoulou, Andy Lavender, Lin Jenkins, John Hopkins Golf Correspondent, Michael Prestage, Janet Bush and Richard Thomson, Clive Linssen, Raymond Keene, Adam Sage, Philip A. C. Campbell, Peter Stothard, Paul Wilkinson, G. A. Khoury Project Director, P. H. S, Chris Partridge, M. C. Fitzpatrick, Richard Evans, Peter Orr, Bronwen Maddox, Clive Aslet, Eric Reguly, Richard Owen, Damian Whitworth, Sarah Cunningham, Brian Simpson, Nick Kelly, Philip Webster, Political Editor, Carol Allen, Ian Lang (President), David Hands Rugby Correspondent, Julian Muscat, Kathryn Bailey, Adam Fresco, Philip Webster Political Editor, Christopher Walker, Kevin McCarra, Matthew Parris, E. M. Melody, Anne Fuller, Russell Jenkins, Peter Riddell, Ben MacIntyre, Ray Hatley, John O'leary and David Charter, Ian Brodie, Michael Gove, Michael Dynes, John Murphy, Tim Jones, Chris Ayres, Hyam Maccoby, Nigel Hawkes Science Editor, Alan Coren, J. F. K. Hinde, Zahid Hussain and Christopher Thomas, South Asia Correspondent, Daniel Rosenthal, Nigel Powell, Dr Thomas Stuttaford, David Barker, Stephen Dalton, Lindsay Nicolle, James Christopher, David Maddock, Alasdair Murray, Robert Whymant, Harvey Elliott Air Correspondent, Matthew Bond, Dr Keyboard, David Hands, Rugby Correspondent, Colin McQuillan, Christopher Irvine, Christine Buckley, Industrial Correspondent,

... Old Red Lion, Ec1 Body building Honestly Young Vic Studio Rising Star Rising stars in the arts firmament David Eldridge Great British Hopes Tomorrow It's all in the eye of the beholder Pop: While the fans go wild in Dublin, in Glasgow they stay pretty unmoved ...

1997 - Gale Group | TDA

Artigo Acesso aberto Revisado por pares

José A. Quinteros, Sang‐Won Lee, Philip F. Markham, Amir H. Noormohammadi, Carol A. Hartley, Alistair R. Legione, Mauricio J. C. Coppo, Paola K. Vaz, Glenn F. Browning,

... them to the genome of the vaccine strain VicS. We detected multiple recombination events throughout the genome between wild type viruses and the vaccine strains in all three emergent isolates. Moreover, we found that strain N1/88 was not entirely exogenous, as was previously hypothesised. Rather, it originated from a recombination event involving the VicS vaccine strain. The S glycoprotein genes of N1/ ...

Tópico(s): Plant Virus Research Studies

2016 - Elsevier BV | Veterinary Microbiology

Jornais Acesso aberto

Joan Haslip, S. T. Gillbard, Sir Charles Petrie, Sir T. Beecham's, D. F. Walker, Dorothy L. Sayers, Sydney Carroll, Richard Newton Chance, Doreen Wallace, Thomas Moult, James Agate, Eiluned Lewis, B. J. de C. Andrade, Alfred Wareing (Hon. Organising Secretary), E. H. Carr, W. H. Kerridge, Desmond MacCarthy, John Beevers, M. E., B. M., H. St. John Rumsey, W. W. Hadley, Lloyds, Hamilton Price, G. B., Sir Samuel Hoare, E. R. S. Skeels, Maureen Watson, Eric Partridge, Arthur W. Wade-Evans, Newton M. Dutt, A. T. Johnson, Cecil V. Bagot, G. W. B., J. B. Firth, A. F., Ernest Barker, Frank Rutter, A. N. E., D. R. Gent, Philip Morrell, C. L., Ernest A. Ebblewhite, Sidney Preston, Richard Sickert, H. F., Henry S. Salt, V. Stewart, Gerald Heard, Ernest Newman, H. Barkley, Ralph Straus, E. V. Lucas, H. G. Rawlinson, J. Armour MacMillan, Sydney W. Carroll, G. W. Parker, Herbert Southam, Dora, Arthur Bryant, Edward Shanks, A. H. Crosfield, J. B., Elton Ede, H. E. Symons, R. J. Barrett Financial Editor, Henry Longhurst, Hubert Winterbotham, E. N., Yarborough, D. S. MacColl, J. M. Bulloch, P. G. Tillard, R. L. Ricketts, Atticus, Stephen Spender, H. Saunderson, George W. Bishop, Frederic Cowen, S. F. D. Howarth, R. A. Workman, Lady Muriel Beckwith,

... Large-Fitting Hats A Wanderer's Note Book Wild Beasts Napoleon The Hallmark Continuity of Christian Name Cyder Cellars, Covent Garden The Old Vic King Arthur The "Isle of Wight Parson" Joseph ...

1935 - Gale Group | Sunday Times HA GDA

Artigo Acesso aberto Revisado por pares

Christopher K. Raymond, John C. Castle, Philip W. Garrett-Engele, Christopher D. Armour, Zhengyan Kan, Nicholas F. Tsinoremas, Jason M. Johnson,

... SCN9A exon 5NCAAAGCCCCTACAATTGTCTTCAGFAM–TTTCAGCTCTTCGAACTT–NFQCTGGATTTTGTCGTCATTGTTTTTGHuman SCN9A exon 5ACAAAGCCCCTACAATTGTCTTCAGVICcVIC, VIC fluorophore–AGCATTGAGAACATTCAG–NFQTCCCCAATGGACAGCTTCTGHuman SCN9A exon 11wtGGAGATAGGAACTACAACGCCTTTTFAM–CCAGAGGGCACGACCAA–NFQAGCTTCTGCCAGAGGTGATAATAGAHuman SCN9A exon 11extGGAGATAGGAACTACAACGCCTTTTFAM–ACAGCGGCACGACCAA–NFQTCACACAACCTGAGCCTGAACHuman SCN11A wild-typeGTGGGCTTCTTGTTCTCCTGATFAM–AACAGGCCTATGAGCTCC–NFQACAGCGCATCACACAACCTHuman SCN11A exon 16 skipCTGAAGATCAATGGTGCTACATTCTGFAM–CCTGAACAACAGAAGTCT– ...

Tópico(s): Signaling Pathways in Disease

2004 - Elsevier BV | Journal of Biological Chemistry

Artigo Acesso aberto Revisado por pares

Ming Shen, Eri Yoshida, Weiqun Yan, Takeshi Kawamoto, Ketut Suardita, Yasuhiko Koyano, Katsumi Fujimoto, Mitsuhide Noshiro, Yukio Kato,

... CAACGAGCGGTTCCGATGCCC-TAMRA-3′ for β-actin, and 5′-VIC-TGCCGCCTGGAGAAAGCTGCTAAGTA-TAMRA-3′ for GAPDH. DEC1-overexpressing, empty vector integrated and wild-type ATDC5 cells were maintained in 36-mm ...

Tópico(s): Ubiquitin and proteasome pathways

2002 - Elsevier BV | Journal of Biological Chemistry