Limpar
22 resultados

Acesso aberto

Tipo do recurso

Ano de criação

Produção nacional

Revisado por pares

Áreas

Idioma

Editores

Jornais Acesso aberto

Giles Smith, Gráinne Gilmore, Andrew Robson, Kate Greenhalgh, Christina Hardyment, John McNamara, George Mitchell, Cath Urquhart, Professor Sir Brian Pippard, Robert Cole, Bel Mooney, Bill Corcoran, Caroline Stacey, Sarah Potter, Adelle Stripe, Stefan Zweig, Amanda Ursell, Simon Barnes, Jane MacQuitty, Alexandra Blair, Peter Lansley, James Harding, Simon Hills, Neil Barraclough, John Mulvey, Jane Knight, Jasmine Ryan, Ivo Tennant, Clare Lazaro, Terence Blacker, Tony Turnbull, David Cornwell, Philip Howard, Hannah Betts, Julia Brookes, Hilary Finch, Carol Midgley, David Lister Scotland Correspondent, Christine Seib, David Chater, Kate Wighton, Joanna Bale, James Bone, James Ducker, Melissa Katsoulis, Rachel Campbell-Johnston, Clive Davis, Richard Hobson One-Day Cricket Correspondent, Gabrielle Starkey, Bob Stanley, Graham Stewart, Will Pavia, Tom Wingate, Sam Marlowe, Wendy Ide, James Hider, John Bungey, Alex Green, Geoff Brown, Lucy Bannerman, Sam Banik, Joe Joseph, Ian McMillan, Robin Pagnamenta, Samuel Beckett, Anna Whelan, Vivienne Parry, Giles Coren, Nancy Durrant, Matt Sandy, John Clarke, Tim Golding, Siobhan Kennedy, Stewart Tendler Crime Correspondent, Dominic Walsh, Ruth Gledhill, Debra Craine, Ruth Corbett, Tom Bell, Gary Jacob, Matthew Barbour, Jon Savage, Victoria Segal, Mike Pattenden, Greg Watts, Allan Simmons, Daniel Finkelstein, Jeanette Winterson, Michael Harvey, Libby Purves, Rodney Legg, Jo Morris, Stephen Farrell, Elizabeth Colman, Ben Machell, Robert Chesshyre, Richard Lloyd Parry, Tina Gaudoin, David Hands, Diane Purkiss, Charles Bremner, Jonathan Richards, Ron Lewis, Martin Symington, Helen Rumbelow, Adam Sherwin Media Correspondent, Stefanie Marsh, Lucy Sweeney, Lewis Carroll, Tim Teeman, Edward Gorman, Derwent May, Simon Tait, Kevin Alderton, Aggie MacKenzie, Russell Kempson, Ed Potton, Oliver Kay, Carola Long, Patsy Palmer, The Right Rev Henry A. Richmond Honorary Assistant Bishop, Stephen Anderton, David Lister, Mark Atherton, Ed Smith, Mark Henderson Science Editor, John Westerby, James Harding Business Editor, Kate Allen Director, Lisa Armstrong, Tom Baldwin, Sarah Vine, Father Brian O'Higgins, Antonia Senior Personal Finance Editor, Chris Power, Pete Paphides, Sally Baker, David Robertson Business Correspondent, John Hopkins Golf Correspondent, Rob Wright, ZoË Strimpel, Christina Koning, Edward Gorman Motor Racing Correspondent, Gabriel Rozenberg, Neil Harman Tennis Correspondent, David Powell Athletics Correspondent, Matt McKay, Raymond Keene, Sue North, Adam Sage, Christine Buckley, Suzi Godson, Lewis Smith, Matthew Pryor, Des Browne, Kate Saunders, Richard Brass, Rebecca O'Connor, James Wilson, Gordon Ramsay, Christine Buckley Industrial Editor, Kaveh Solhekol, Vladimir Nabokov, Jeremy Page, Rick Jones, Andrew G. Marshall, Chris Campling, Sarah Birch, Richard Owen, Laura Deeley, Marcus Leroux, Philip Olterman, Mick Hume, Erica Wagner, Roger Boyes, Marcel Berlins, David Barnett, Ross Leckie, Anthony D. G. Roberts, Thomasina Miers, Will Hodgkinson, Graham Searjeant Personal Investor, Margaret Reynolds, David Hands Rugby Correspondent, Tom Dart, Owen Slot Chief Sports Reporter, James Collard, Paul Simons, Kevin Maher, Nicholas Clee, Jane Wheatley, Steve Jelbert, Nigel Kendall, Ian Rankin, Anne Ashworth, John Goodbody, Nick Szczepanik, Peter Kidner, James Doran, Joanna Pitman, Robert Crampton, Thomas Catán, Ian Johns, Dominic Maxwell, Alice Fordham, Prue White, Matthew Parris, Graham Searjeant Financial Editor, Mark Bridge, Mike Rosewell, Amanda Craig, George Caulkin, Sonia Verma, James Robertson, Michel Schmidt, Alan Franks, Caitlin Moran, Sheila Keating, Alan Lee, Celia Dodd, Iain Finlayson, Lisa Hill, Richard George, Neil Fisher, Ben MacIntyre, Andrew Ellson, Helen Pridham, David Diprose, David Hutcheon, John Naish, Geoffrey Rowell, Martin Waller, Mark Henderson, Michael Horsnell, Lewis Smith Environment Reporter, J. K. Waterlow, Chris Ayres, Nigel Hawkes Health Editor, Ashling O'Connor, Anna Shepard, Val Horsler, Louise Cohen, Tim Wapshott, Angus Batey, Frances Mallett, Sam Coates Political Correspondent, Dr Thomas Stuttaford, Jill Crawshaw, Stephen Dalton, Leo Lewis, Tom Stuart Smith, Bill Edgar, Richard Morrison, Tom Chesshyre, James Christopher, Alice Miles, Dr Norman Smalldridge, Jules Evans, Simon Crompton, Alan Lee Racing Correspondent, Alexandra Blair Education Correspondent, Heather Cotton, Lisa Tuttle, Alan Jackson, Mark Harrison, Cath Urquhart Travel Editor, Alicia Castro, Kim Newman, Anil Sinanan, Will Hide, Olav Bjortomt, Fiona Hamilton, Keith Newman, Jan Raath, Daphne Lockyer, David Robertson, Pete Wilcox, Ed Hughes, Joe Bolger, Christopher Irvine,

... Gave us a turn Case Study A Satisfied Browser Top Blog The Week in Brief A Word ... books Detective who gripped to the power of Zen Marcel Berlins salutes the creativity of Michael Dibdin, ...

2007 - Gale Group | TDA

Artigo Acesso aberto Revisado por pares

Derren Wilson, Saeed‐Ul Hassan, Naif Radi Aljohani, Anna Visvizi, Raheel Nawaz,

... use and required enormous sensitivity to the possibilities browser ecosystems could reliably provide. As the CSS Zen Garden was maintained for over ten years, it ... greater willingness to negotiate source code configurations between browser platforms. Following the history of the individuals responsible for creating and contributing to the CSS Zen Garden shows the continuing influence of layer-based ...

Tópico(s): Digital Games and Media

2022 - Routledge | Internet Histories

Editorial Revisado por pares

Gary C. Schoenwolf,

... view this informative site (and perhaps to achieve Zen), set your browser to www.xenbase.org. As Editor-in-Chief ...

Tópico(s): Gene expression and cancer classification

2004 - Wiley | Developmental Dynamics

Artigo Acesso aberto Revisado por pares

Martin Kuttge,

... ZEN Data Storage database is complemented with the ZEN Data Explorer, a web browser and app-based solution to view and annotate ...

Tópico(s): Big Data Technologies and Applications

2020 - Oxford University Press | Microscopy and Microanalysis

Artigo Revisado por pares

James J. O’Donnell,

... of mind and consciousness experienced by a modern Zen monk, an ancient Christian bishop, and a browser of the New Age shelves at City Lights ...

Tópico(s): Augustinian Studies and Theology

2008 - Johns Hopkins University Press | Journal of early Christian studies

Artigo Acesso aberto

Fajar Al Rasyid, Bita Parga Zen,

A browser is software used to access web pages to obtain clear and readable information. Information resources are identified by a Uniform Resource Identifier (URI) and can be web pages, images, videos, or other content. When a browser user engages in online activities, they usually leave traces on the device such as history, cookies, cache files, and even emails and passwords. Such traces can usually help users access a website or input something, such as emails and passwords. The purpose of this ...

Tópico(s): Edcuational Technology Systems

2023 - | Jurnal Teknik Informatika (Jutif)

Artigo Acesso aberto Revisado por pares

Manny D. Bacolod, Aashiq H. Mirza, Jianmin Huang, Sarah F. Giardina, Philip B. Feinberg, Steven A. Soper, Francis Barany,

... TTGTGGGTGGGTATAGGTCAGA-3′m_SEPT9P (qPCR)5′-FAM-TTAAAATGC-ZEN-GAACGCGACGCCC-IABkFQ-3′m_SEPT9F (qPCR)5′-TAGGAACACGGAGGACATCAA- ... GCGCGCACTCACCAAACCCGGTTCCATCACCGTTAGGCCA-3′m_GSG1LP (qPCR)5′-FAM-TTCCGTCCG-ZEN-CGCGCA-IABkFQ-3′m_GSG1LF (qPCR)5′-TTCGTCCCTGCACGCTAAC- ... GATTTCAACTTCCTACAACTCAAAAAAAAAATCCCCACCGTGGAGCGCTAAGGTTGCA-3′m_PP1R16BP (qPCR)5′-FAM-TTCGTCCCA-ZEN-GCCGATTTCAACTTCCTACAA-IABkFQ-3′m_PP1R16BF (qPCR)5′-TTCAGCAGCCTGGCATCAC- ... GCCACAACCGCCTTAAAACGAAACCCGTGTGTAGCTTAGACATGGCCA-3′m_KCNA3P (qPCR)5′-FAM-TTCGCCACC-ZEN-GCCACAACC-IABkFQ-3′m_KCNA3F (qPCR)5′-TCACAGAGACTTGCCGATCAC- ...

Tópico(s): RNA modifications and cancer

2020 - Elsevier BV | Journal of Molecular Diagnostics

Artigo Acesso aberto Revisado por pares

Philippe M. Campeau, Jaeseung Kim, James T. Lu, Jeremy Schwartzentruber, Omar Abdul‐Rahman, Silke Schlaubitz, David M. Murdock, Ming-Ming Jiang, Edward J. Lammer, Gregory M. Enns, William J. Rhead, Jon Rowland, Stephen P. Robertson, Valérie Cormier‐Daire, Matthew N. Bainbridge, Xiang‐Jiao Yang, Marie‐Claude Gingras, Richard A. Gibbs, David S. Rosenblatt, Jacek Majewski, Brendan Lee,

... fluorophore, a 3′ IBFQ quencher, and an internal ZEN quencher (see Table S1). Quantitative real-time PCR ... guideline.htmlSIFT, http://sift.jcvi.org/UCSC Genome Browser (hg18 and hg19), http://genome.ucsc.edu/ De ...

Tópico(s): Protein Degradation and Inhibitors

2012 - Elsevier BV | The American Journal of Human Genetics

Artigo Acesso aberto Revisado por pares

Sébastien Bourdon, Pauline Herviou, Leïla Dumas, Eliana Destefanis, Andrea Zen, Anne Cammas, Stefania Millevoi, Erik Dassi,

... gene set, and de novo RG4 prediction. Genome-browser and table views allow exploring, filtering, and downloading ...

Tópico(s): RNA modifications and cancer

2022 - Oxford University Press | Nucleic Acids Research

Artigo Acesso aberto Revisado por pares

Zen Faulkes,

... Scholar Sakshi Puri Zen Faulkes PubMed Sakshi Puri Zen Faulkes Related Article in Frontiers Google Scholar PubMed Abstract Close Back to top Javascript is disabled. Please enable Javascript in your browser settings in order to see all the content ...

Tópico(s): Cephalopods and Marine Biology

2012 - Frontiers Media | Frontiers in Behavioral Neuroscience

Artigo Acesso aberto

Qin Wei, Yang Li, Shou‐Zen Fan, Quan Liu, Maysam Abbod, Cheng-Wei Lü, Tzu‐Yu Lin, Kuo‐Kuang Jen, Shang‐Ju Wu, Jiann-Shing Shieh,

... data and clinical information was constructed through a browser and server model so as to provide a ...

Tópico(s): EEG and Brain-Computer Interfaces

2014 - Springer Science+Business Media | Australasian Physical & Engineering Sciences in Medicine

Artigo Acesso aberto Revisado por pares

Dinse Hubert,

Event Abstract Back to Event Zen and Neural Plasticity without Training or Stimulation: ''Be Aware!'' Sebastian Thomas Philipp1, 2, 3*, Thomas Wachtler1, 4 and Hubert R. Dinse3 ... psychophysically the effect of a three day meditative Zen [6] retreat on tactily abilities of the finger tips. The Zen retreat was held in total silence with long ... 6) Kapleau, P. (2000). The three pillars of Zen. Anchor, Rev Exp edition New York: Anchor Books ... Philipp S, Wachtler T and Dinse HR (2011). Zen and Neural Plasticity without Training or Stimulation: ''Be ...

Tópico(s): Neural dynamics and brain function

2011 - Frontiers Media | Frontiers in Computational Neuroscience

Artigo Acesso aberto Revisado por pares

Eric I. Benchimol, Richard Keijzer,

... Physician@ProductivePhyshttps://productivephysician.com/ UncluttererUnclutter@uncluttererhttp://unclutterer.com/ Zen HabitsLeo Babautahttp://zenhabits.net/ LifehackLifehack@lifehackorghttp://www.lifehack. ... foldersPersonal email address for forwarding emailsPowerful web clipper browser extension, one click access to original source pagePowerful ...

Tópico(s): Personal Information Management and User Behavior

2017 - Elsevier BV | Gastroenterology

Artigo Acesso aberto Revisado por pares

Milverton Wallace,

... of the Internethttp://www.isoc.org/internet-history/Zen and the art of the Internethttp://ftp.intemic.net/pub/internet-doc/zen.txtWeb origins and beyondhttp://homepage.seas.upenn.edu/∼ ... of the Internethttp://www.isoc.org/internet-history/Zen and the art of the Internethttp://ftp.intemic.net/pub/internet-doc/zen.txtWeb origins and beyondhttp://homepage.seas.upenn.edu/∼ ... 1Net jargonactive map/imagemapAn image in a Web browser in which different areas act as hyperlinksActiveXA programming ... onsPrograms that provide extra facilities for a WWW browser (eg, sound, video) (see helper application, plug in, ...

1998 - Elsevier BV | The Lancet

Artigo Acesso aberto Revisado por pares

xtine burrough, Sabrina Starnaman,

... takes up as inspiration the Instructions for the Zen Cook by thirteenth century Zen Master Eihei Dōgen Zenji. Epic Hand Washing for ... ETTOruBpI-NCOChjuPtprlZue/view>. ———. An Archive of Unnamed Women. Browser-based project. Oct. 2019. <http://visiblewomen.net/unnamed- ...

Tópico(s): Participatory Visual Research Methods

2021 - Queensland University of Technology | M/C Journal

Artigo Revisado por pares

Venetta Masson,

... from now to then till suddenly I seewhat Zen and physics say is true—we live in ... Hood, MD, reads "Counterclockwise," by V. Masson. Your browser does not support the audio element. Audio player ...

Tópico(s): Nursing Diagnosis and Documentation

2017 - American College of Physicians | Annals of Internal Medicine

Artigo Revisado por pares

Veneta Masson,

... in the libraryhours before the examwhen, in a Zen-like flashthe Krebs cycle manifested itselfin stunning clarity. ... Editor, reads "Krebs Cycle," by V. Masson. Your browser does not support the audio element. Audio player ...

Tópico(s): Health, Environment, Cognitive Aging

2017 - American College of Physicians | Annals of Internal Medicine

Artigo Acesso aberto Revisado por pares

Christian Beescho, Sch�pfer Teresa, Lucas Schirmer, Atallah Passant, Uwe Freudenberg, Werner Carsten, Simon Jan Christoph, Stefan Langer, Sandra Franz,

... in the wound area. Angiogenesis was analyzed with ZEN software (Zeiss), measuring the functional vessel density (defined ... Javascript is disabled. Please enable Javascript in your browser settings in order to see all the content ...

Tópico(s): Dermatologic Treatments and Research

2016 - Frontiers Media | Frontiers in Bioengineering and Biotechnology

Artigo Acesso aberto Revisado por pares

Ramírez-García René, Rojas Mauricio, Peña-Arboleda Beatriz, Maldonado-Estrada Juan,

... herds. Rev. Colomb. Cienc. Pecu. 23:17-27. Zen, M., Canova, M., Campana, C., Bettio, S., Nalotto, ... Javascript is disabled. Please enable Javascript in your browser settings in order to see all the content ...

Tópico(s): Ginseng Biological Effects and Applications

2015 - Frontiers Media | Frontiers in Immunology

Artigo Acesso aberto Revisado por pares

Marcos Rubal, Paulo Fontoura, Puri Veiga, Francisco Asís de Vera, F.J. García-García, José M. Guerra‐García,

... Contrast Microscope (DIC) equipped with digital camera and Zen Imaging Software. Two species of tardigrades were found ... Javascript is disabled. Please enable Javascript in your browser settings in order to see all the content ...

Tópico(s): Planetary Science and Exploration

2019 - Frontiers Media | Frontiers in Marine Science