Portal de Periódicos da CAPES

K-ras Gene Mutation Enhances Motility of Immortalized Airway Cells and Lung Adenocarcinoma Cells via Akt Activation

2004; Elsevier BV; Volume: 164; Issue: 1 Linguagem: Inglês

10.1016/s0002-9440(10)63100-8

1525-2191

Koji Okudela, Hiroyuki Hayashi, Takaaki Ito, Takuya Yazawa, Takehisa Suzuki, Yuko Nakane, Hanako Sato, Haruhiko Ishi, Xin KeQin, Akira Masuda, Takashi Takahashi, Hitoshi Kitamura,

Protein Kinase Regulation and GTPase Signaling

Point mutations of the K-ras gene, which are found in 10 to 30% of lung adenocarcinomas, are regarded as being an early event during the carcinogenesis. Autonomous vigorous motility of neoplastic cells, as well as growth and survival advantages, are considered to be necessary for cancer development and progression. The present study describes the contributions of the K-ras gene mutation and its downstream pathway via phosphatidylinositol 3-OH kinase (PI3K)-Akt to the cell motility in an immortalized human peripheral airway epithelial cell (HPL1D) and lung adenocarcinoma cells (A549, H820, TKB6, and TKB14). We have also evaluated the relationship between pathological events and the K-ras-Akt pathway using surgically resected lung tumors. The HPL1D cells transfected with the mutated K-ras gene (HPL-V12) showed a significant increase in cell motility compared to those transfected with empty vector (HPL-E) or wild-type K-ras gene (HPL-K). The enhanced motility in the HPL-V12 cells was markedly reduced by either treatment with inhibitors of ras, PI3K, and/or MEK, or by transfection with the dominant-negative mutant Akt (dnAkt). The lung adenocarcinoma cells bearing the K-ras gene mutation (A549 and H820) showed consistently higher levels of cell motilities than those without the mutation (TKB6 and TKB14), and the motility of A549 and H820 cells were significantly inhibited by dnAkt transfection. These results suggest that the K-ras gene mutation could enhance the motility of neoplastic cells through a pathway involving PI3K-Akt. Actually, among the surgically resected lung tumors, the adenocarcinomas with the K-ras gene mutation tended to show a higher frequency and intensity of immunoreactivity for phosphorylated Akt (p-ser473Akt) than those without the mutation, supporting the in vitro observation that the mutated K-ras can activate the PI3K-Akt pathway. Immunoreactivity for p-ser473Akt was also seen in the pre-malignant and early lesions at a frequency similar to that in the advanced lung adenocarcinomas,. No correlation was seen between p-ser473Akt immunoreactivity and lymphatic/organ metastasis or prognosis. These results taken together suggest that the K-ras-Akt pathway might facilitate the motility of neoplastic cells during the early period of carcinogenesis in lung adenocarcinomas, and may contribute to their non-invasive expansion along the alveolar septa, rather than invasion or metastasis. Point mutations of the K-ras gene, which are found in 10 to 30% of lung adenocarcinomas, are regarded as being an early event during the carcinogenesis. Autonomous vigorous motility of neoplastic cells, as well as growth and survival advantages, are considered to be necessary for cancer development and progression. The present study describes the contributions of the K-ras gene mutation and its downstream pathway via phosphatidylinositol 3-OH kinase (PI3K)-Akt to the cell motility in an immortalized human peripheral airway epithelial cell (HPL1D) and lung adenocarcinoma cells (A549, H820, TKB6, and TKB14). We have also evaluated the relationship between pathological events and the K-ras-Akt pathway using surgically resected lung tumors. The HPL1D cells transfected with the mutated K-ras gene (HPL-V12) showed a significant increase in cell motility compared to those transfected with empty vector (HPL-E) or wild-type K-ras gene (HPL-K). The enhanced motility in the HPL-V12 cells was markedly reduced by either treatment with inhibitors of ras, PI3K, and/or MEK, or by transfection with the dominant-negative mutant Akt (dnAkt). The lung adenocarcinoma cells bearing the K-ras gene mutation (A549 and H820) showed consistently higher levels of cell motilities than those without the mutation (TKB6 and TKB14), and the motility of A549 and H820 cells were significantly inhibited by dnAkt transfection. These results suggest that the K-ras gene mutation could enhance the motility of neoplastic cells through a pathway involving PI3K-Akt. Actually, among the surgically resected lung tumors, the adenocarcinomas with the K-ras gene mutation tended to show a higher frequency and intensity of immunoreactivity for phosphorylated Akt (p-ser473Akt) than those without the mutation, supporting the in vitro observation that the mutated K-ras can activate the PI3K-Akt pathway. Immunoreactivity for p-ser473Akt was also seen in the pre-malignant and early lesions at a frequency similar to that in the advanced lung adenocarcinomas,. No correlation was seen between p-ser473Akt immunoreactivity and lymphatic/organ metastasis or prognosis. These results taken together suggest that the K-ras-Akt pathway might facilitate the motility of neoplastic cells during the early period of carcinogenesis in lung adenocarcinomas, and may contribute to their non-invasive expansion along the alveolar septa, rather than invasion or metastasis. Malignant neoplasms are generally considered to develop through the accumulation of multiple genetic abnormalities. Point mutations of ras genes are among the most frequent events in human malignancies. The ras family is composed of three subtypes encoded by different genes, H-, N-, and K-ras. Point mutation of these genes is rather specific with regard to the organ or histological type of tumors. For example, mutations of H- or N-ras genes are seen in thyroid, breast, skin cancers, leukemia, etc.1Bos JL Fearon ER Hamilton SR Verlaan-de Vries M van Boom JH van der Eb AJ Vogelstein B Prevalence of ras gene mutations in human colorectal cancers.Nature. 1987; 327: 293-297Crossref PubMed Scopus (1622) Google Scholar, 2Bos JL Verlaan-de Vries M van der Eb AJ Janssen JW Delwel R Lowenberg B Colly LP Mutations in N-ras predominate in acute myeloid leukemia.Blood. 1987; 69: 1237-1241Crossref PubMed Google Scholar, 3Segrelle C Ruiz S Perez P Murga C Santos M Budunova IV Martinez J Larcher F Slaga TJ Gutkind JS Jorcan JL Paramio JM Functional roles of Akt signaling in mouse skin tumorigenesis.Oncogene. 2002; 21: 53-64Crossref PubMed Scopus (159) Google Scholar On the other hand, mutations of the K-ras gene are seen in colorectal, pancreatic, endometrial, and lung cancers.2Bos JL Verlaan-de Vries M van der Eb AJ Janssen JW Delwel R Lowenberg B Colly LP Mutations in N-ras predominate in acute myeloid leukemia.Blood. 1987; 69: 1237-1241Crossref PubMed Google Scholar, 4Rodenhuis S van de Wetering ML Mooi WJ Evers SG van Zandwijk N Bos JL Mutational activation of the K-ras oncogene: a possible pathogenetic factor in adenocarcinoma of the lung.N Engl J Med. 1987; 317: 929-935Crossref PubMed Scopus (470) Google Scholar In lung cancer, K-ras gene point mutations, which most frequently occur at codon 12, are restricted exclusively to adenocarcinoma, with a frequency of 10 to 30%. Since the K-ras gene mutation is observed not only in advanced adenocarcinomas, but also in pre-malignant and early lesions such as atypical adenomatous hyperplasia (AAH) and bronchioalveolar carcinoma (BAC) at a similar frequency,5Cooper CA Carby FA Bubb VJ Lamb D Kerr KM Wyllie AH The pattern of K-ras mutation in pulmonary adenocarcinoma defines a new pathway of tumor development in the human lung.J Pathol. 1997; 181: 401-404Crossref PubMed Scopus (77) Google Scholar, 6Sugio K Kishimoto Y Virmani AK Hung JY Gazdar AF K-ras mutations are relatively late event in pathogenesis of lung carcinoma.Cancer Res. 1994; 54: 5811-5815PubMed Google Scholar, 7Ohshima S Shimizu Y Takahama M Detection of c-Ki-ras gene mutation in paraffin sections of adenocarcinoma and atypical bronchioalveolar hyperplasia of humen lung.Virchows Arch. 1994; 424: 129-134PubMed Google Scholar K-ras gene mutation has been considered to be an early event during tumoriogenesis.5Cooper CA Carby FA Bubb VJ Lamb D Kerr KM Wyllie AH The pattern of K-ras mutation in pulmonary adenocarcinoma defines a new pathway of tumor development in the human lung.J Pathol. 1997; 181: 401-404Crossref PubMed Scopus (77) Google Scholar, 6Sugio K Kishimoto Y Virmani AK Hung JY Gazdar AF K-ras mutations are relatively late event in pathogenesis of lung carcinoma.Cancer Res. 1994; 54: 5811-5815PubMed Google Scholar, 7Ohshima S Shimizu Y Takahama M Detection of c-Ki-ras gene mutation in paraffin sections of adenocarcinoma and atypical bronchioalveolar hyperplasia of humen lung.Virchows Arch. 1994; 424: 129-134PubMed Google Scholar, 8Kitamura H Kemeda Y Ito T Hayashi H Atypical adenomatous hyperplasia of the lung: implications for the pathogenesis of peripheral lung adenocarcinoma.Am J Clin Pathol. 1999; 111: 610-622Crossref PubMed Scopus (167) Google Scholar, 9Jackson EJ Willis N Mercer K Bronson RT Crowley D Montoya R Jacks T Tuveson AD Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras.Genes Dev. 2001; 15: 3243-3248Crossref PubMed Scopus (1477) Google Scholar, 10Ichikawa T Yano Y Uchida M Otani S Hagiwara K Yano T The activation of K-ras gene at early stage of lung tumoriogenesis in mice.Cancer Lett. 1997; 107: 165-170Abstract Full Text PDF Scopus (30) Google Scholar, 11Horio Y Chen A Rice P Roth JA Malkinson AM Schrump DS Ki-ras and p53 mutaion are early events respectively in urethane-unduced pulmonary carcinogenesis in A/J mice.Mol Carcinog. 1995; 17: 217-223Crossref Scopus (91) Google Scholar However, how this gene mutation mediates the development of lung adenocarcinoma has not been fully clarified. Biochemical studies have revealed that K-ras gene point mutations cause constitutive activation of the protein product by reducing its intrinsic GTPase activity, resulting in excessive activation of its downstream factors.12Campbell SL Khosravi-Far R Rossman KL Clark GJ Der GJ Increasing complexity of Ras signaling.Oncogene. 1998; 17: 1395-1413Crossref PubMed Scopus (924) Google Scholar Raf and phosphatidylinositol 3-OH kinase (PI3K) are among the best-studied downstream factors of K-ras.13Datta SR Brunet A Greenberg ME Cellular survival: a play in three Akts.Genes Dev. 1999; 13: 2905-2927Crossref PubMed Scopus (3748) Google Scholar Raf transmits a signal via phosphorylation of MEK, which subsequently activates its downstream effector, mitogen-activated protein kinase (Erk1/2).14Feig RA Schaffhausen B Signal transduction: hunt for Ras targets.Nature. 1994; 370: 508-509Crossref PubMed Scopus (71) Google Scholar Activated Erk1/2 binds to other kinases and translocates into the nucleus, and the complexes interact with various transcription factors to regulate the expression of genes facilitating cell cycle progression and inhibiting apoptosis.14Feig RA Schaffhausen B Signal transduction: hunt for Ras targets.Nature. 1994; 370: 508-509Crossref PubMed Scopus (71) Google Scholar, 15Egan SE Weinberg RA The pathway to signal achievement.Nature. 1993; 365: 781-783Crossref PubMed Scopus (527) Google Scholar, 16Edme N Downward J Thiery JP Boyer B Ras induces NBT-II epithelial cell scattering through the coordinate activities of Rac and MAPK pathways.J Cell Sci. 2002; 115: 2591-2601PubMed Google Scholar, 17Giehl K Skripczynski B Mansard A Menke A Gierschik P Growth factor-dependent activation of the Ras-Raf-MEK-MAPK pathway in the human pancreatic carcinoma cell line PANC-1 carrying activated K-ras: implications for cell proliferation and cell migration.Oncogene. 2000; 19: 2930-2942Crossref PubMed Scopus (107) Google Scholar On the other hand, PI3K phosphorylates membrane phophatidylinositide to recruit and activate many factors containing a plekstrin homology (PH) domain, such as Akt and phosphatidylinositide-dependent kinase (PDK), which has also been shown to transmit signals mediating cell survival, cell cycle progression, and glucose metabolism.13Datta SR Brunet A Greenberg ME Cellular survival: a play in three Akts.Genes Dev. 1999; 13: 2905-2927Crossref PubMed Scopus (3748) Google Scholar Thus, it is conceivable that the constitutive and excessive activation of the raf-Erk1/2 and/or PI3K-Akt pathways resulting from K-ras gene mutation promotes cancer development by providing survival and growth advantages for neoplastic cells. In addition, vigorous motility is also one of the essential properties of cancer cells, since malignant neoplasms are characterized by high invasive and metastatic potentials. Several recent studies have demonstrated that Erk1/2 and/or Akt could also transmit signals mediating the cellular motility, and have suggested their possible contribution to tumor expansion, invasion, or metastasis.18Park BK Zeng X Glazer RI Akt1 induce extracellular matrix and matrix metalloproteinase-2 activity in mouse mammary epithelial cells.Cancer Res. 2001; 61: 7647-7653PubMed Google Scholar, 19Grille SJ Bellacosa A Upson J Klein-Szanto AJ van Roy F Lee-Kwon W Donowitz M Tsichlis PN Larue L The protein kinase Akt induces epithelial mesenchymal transition and promotes enhanced motility and invasiveness of squamous cell carcinoma lines.Cancer Res. 2003; 63: 2172-2178PubMed Google Scholar The purpose of the present study is to elucidate the cell biological significance of the K-ras gene mutations in the development of lung adenocarcinoma. In our preliminary study, we tried to generate K-rasV12 gene transfectants of the primary human airway epithelial cells. However, we failed to obtain stable gene transfectants, as the K-rasv12 induced a non-apoptotic type of cell death with vacuolar degeneration in these cells (unpublished observations). This observation suggested that a K-ras gene mutation alone is insufficient to induce the development of lung adenocarcinoma, and that additional genetic abnormalities are necessary. Although the abnormality participating in this process has not been strictly identified, it has been reported that inactivation of tumor suppressors such as p53 and retinoblastoma protein (Rb) could be observed along with K-ras gene mutations in the human lung adenocarcinomas.8Kitamura H Kemeda Y Ito T Hayashi H Atypical adenomatous hyperplasia of the lung: implications for the pathogenesis of peripheral lung adenocarcinoma.Am J Clin Pathol. 1999; 111: 610-622Crossref PubMed Scopus (167) Google Scholar, 9Jackson EJ Willis N Mercer K Bronson RT Crowley D Montoya R Jacks T Tuveson AD Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras.Genes Dev. 2001; 15: 3243-3248Crossref PubMed Scopus (1477) Google Scholar, 10Ichikawa T Yano Y Uchida M Otani S Hagiwara K Yano T The activation of K-ras gene at early stage of lung tumoriogenesis in mice.Cancer Lett. 1997; 107: 165-170Abstract Full Text PDF Scopus (30) Google Scholar The large T antigen of simian virus 40 (SV40) has the potential to disrupt the cell cycle regulation by binding to and inactivating p53 and Rb protein, and to immortalize various types of human cells.20Bryan TM Reddel RR SV40-induced immortalization of human cells.Crit Rev Oncogene. 1994; 5: 331-357Crossref PubMed Scopus (185) Google Scholar We have therefore used a SV40-immortalized human peripheral airway epithelial cell line (HPL1D)21Masuda A Kondo M Saito T Yatabe Y Kobayashi T Okamoto M Suyama M Takahashi T Takahashi T Establishment of human peripheral lung epithelial cell lines (HPL1) retaining differentiated characteristics and responsiveness to epidermal growth factor, hepatocyte growth factor, and transforming growth factor β1.Cancer Res. 1997; 57: 4898-4904PubMed Google Scholar to evaluate the significance of K-ras gene mutations in the lung adenocarcinoma. The present study focused on the role of the K-ras-PI3K-Akt pathway in cell motility, since vigorous autonomous motility is one of the important features of malignant neoplasms. The simian virus 40 (SV40)-immortalized human peripheral airway cell line (HPL1D) was established by the procedure described previously.21Masuda A Kondo M Saito T Yatabe Y Kobayashi T Okamoto M Suyama M Takahashi T Takahashi T Establishment of human peripheral lung epithelial cell lines (HPL1) retaining differentiated characteristics and responsiveness to epidermal growth factor, hepatocyte growth factor, and transforming growth factor β1.Cancer Res. 1997; 57: 4898-4904PubMed Google Scholar The lung adenocarcinoma cell lines A549 and H820 were obtained from Riken Cell Bank (Tsukuba, Japan), and TKB6 and TKB14 were kind gifts from Dr. Kanma (Tsukuba University, Tsukuba, Japan). The A549 and H820 cells have a K-ras gene codon 12 point mutation, and the TKB6 and TKB14 cells do not. These cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM)/F12 medium (GIBCO, Rockville, MD) with 1% fetal bovine serum (FBS, GIBCO). The cells in a semi-confluent condition were used for all of the following examinations. Transwell chambers (6-well, 8-μm pore size, Becton Dickinson, Franklin Lakes, NJ) were used, and the upper and lower chambers were filled with DMEM/F12 containing 1% FBS. The cells were harvested by trypsinization, and suspended in the medium. Five hundred thousand cells were seeded into the upper chambers, and hepatocyte growth factor (HGF) (final concentration 20 ηg/ml, R&D systems, McKinley, NE) was added into the lower chambers of the transwell insert. For inhibitory experiments, inhibitors of ras (manumycin, 50 μM, Calbiochem, Darmstadt, Germany), MEK (PD98059, 50 μM, Cell Signaling Technology, Beverly, MA), and/or PI3K (LY29004, 50 μM, Cell Signaling Technology) were added to the lower chambers. After 18 hours of incubation, the cells were fixed with 4% (w/v) paraformaldehyde, and stained with hematoxylin. Non-migrated cells on the upper side of the membranes were wiped away. The membranes were mounted on glass slides, and cells that had migrated through the membranes were counted in five random fields at a magnification of ×100, under a light microscope (Olympus, Tokyo, Japan). Five hundred thousand cells were seeded into 18-well culture plates (which have the same diameter as the upper chamber of the transwells used in the migration assays). If needed, the inhibitors described above were added to the medium at the same concentration. After 18 hours, the cells were harvested and stained with trypan blue. The numbers of living cells were determined as cell growth values, and the percentages of dead cells were determined as the cell death index. K-ras cDNA with a codon 12 point mutation (GGT to GTT; glycine to valine, pSw11-1) was purchased from Riken Gene Bank. Using pSw11-1 as a template, mutated K-ras cDNA was amplified with primers containing restriction enzyme recognition sites, GACGGCCGAAGCTTGCTGAAAATGACTGAATATAAACTTG (underline shows the HindIII site) and CAGGATCCTCATTACATAATTACACACTTTG (underline shows the BamHI site). The wild-type construct was also generated by PCR using pSw11-1 as a template with primers 5′-GACGGCCGAACGTTATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGT (double underline shows codon 12) and 5′-CAGGATCCTCATTACATAATTACACACTTTG. The resultant PCR products were inserted into the mammalian expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA) at the position between the HindIII and BamHI sites. Akt1 cDNA was amplified by RT-PCR (RNA LA PCR kit, Takara, Kyoto, Japan) with primers containing restriction enzyme recognition sites 5′-GAGCCTCGGGCATCATGAGCGAC (underline shows BspH1 site) and 5′-TAAAGGCCGTGCTGCTGGCCGAGTAG. Template RNA prepared from HPL1D cells using an Isogen RNA Extraction Kit (Nippon Gene, Tokyo, Japan). The cDNA was inserted into pT7blue vector (Takara). A dominant-negative mutant of Akt1 (dnAkt; K179 mol/L) was generated from the Akt1 cDNA using an In Vitro Mutagenesis Kit (Takara) with a mismatch primer, 5′-CTACGCCATGATGATCCTCAA(underline shows codon 179). Then, the Akt or dnAkt cDNA was inserted into the pTriEx Vector (Takara) at the position between the NcoI and BamHI sites to be tagged with polyhistidine. The Akt-His or dnAkt-His fusion construct was amplified by PCR with primers containing restriction enzyme recognition sites, 5′- AATCAAAGGAGAGCTAGCATGAGCGACG (underline shows the NheI site) and 5′- TAGGCAGCCTGCACTTAAGGTTAATCAC (underlines shows the AflII site), and was inserted into the expression vector pZeoSv(−) (Invitrogen) or pIRES-EGFP2 (Clontech, Palo Alto, CA). The constructions of the designed vectors were confirmed by DNA sequencing using a Dye-deoxy sequencing kit (Amersham Life Science, Piscataway, NJ). The genes were transfected into cells using Lipofectoamine Plus reagents (GIBCO). To obtain the stable gene transfectants, the vectors pcDNA 3.1(K-ras/K-rasV12) and pZeo SV(−)(Akt-His/dnAkt-His) were linearized by SspI-digestion before use. The transfectants were selected with 1 mg/ml Neomycin (G418, Invitrogen) or Zeocin (Invitrogen). The expression of the desired genes was confirmed by Western blotting. The cultured cells were washed twice with cold 0.1 mol/L phosphate-buffered solution (pH 7.5), and were mixed with an appropriate volume of extraction buffer containing 10 mmol/L HEPES (pH 7.5), 0.1% Nonidet P-40 (NP-40), 1 mmol/L EDTA, 2.5 mmol/L EGTA, 1 mmol/L DTT, 0.5 mmol/L PMSF, 10 μg/ml aprotinin, 1 mmol/L NaF, and 10 mmol/L β-glycerophosphate. After centrifugation, the supernatants were recovered as protein extracts. Equal volumes of 2X SDS buffer containing 0.05 mol/L Tris (pH 6.8), 2% SDS, 6% β-ME, 5% glycerol, and 0.005% BPB were added, and the mixture was boiled. Fifty micrograms of the extracts were subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and then were blotted onto nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany). The membranes were incubated with 1% nonfat milk in 0.01 mol/L Tris-buffered saline containing 0.1% Tween-20 (TBS-T) to block non-immunospecific protein binding, and then with 0.1 μg/ml primary antibody against K-ras (Transduction Laboratories, Franklin Lakes, NJ), C-met (Fuji Drug, Tokyo, Japan), whole Akt, Ser473-phosphorylated Akt, whole, phosphorylated Erk1/2 (Cell Signaling Technology), C-terminal polyhistidine (Invitrogen), and β-actin (Sigma Japan, Kyoto, Japan). After washing with TBS-T, the membranes were incubated with animal-matched HRP-conjugated secondary antibodies (Amersham). Immunoreactivities were visualized with the enhanced chemiluminescence system (Amersham). The expression levels of phosphorylated Akt and Erk1/2 were analyzed using NIH Image computer software. The expression levels were standardized relative to β-actin levels in the same cell lysates. One hundred eight cases of lung tumors, which consisted of 5 atypical adenomatous hyperplasia (AAH), 4 bronchiloalveolar carcinoma (BAC), 42 well (Wel), 34 moderately (Mod), and 23 poorly (Por) differentiated adenocarcinomas were studied. These tumors were surgically resected in the Kanagawa Cardiovascular and Respiratory Disease Center Hospital during the period between 1987–1996. The resected materials were fixed with 10% formalin and embedded in paraffin. The paraffin sections were mounted on MPS-coated glass slides. The paraffin sections were deparaffinized and rehydrated, and were then immersed in 3% hydrogen peroxide/methanol to block the endogenous peroxidase activities. After this step, microwave treatment was required to detect Akt, but not phospho Ser473 Akt (p-ser473Akt). Then the sections were briefly washed with TBS-T (described above for Western blotting), and were incubated with 5% goat serum, followed by endogenous avidin and biotin masking treatment using an Avidin/Biotin Blocking Kit (Vector Laboratories, Burlingame, CA), to block the non-immunospecific protein binding. Rabbit polyclonal antibodies against Akt (Santa Cruz) and p-ser473Akt (Cell Signaling Technology) were incubated with the sections. The immunoreactivity for Akt was visualized by the avidin-biotin complex method using an LSAB 2 Kit (DAKO, Tokyo, Japan). To detect p-ser473Akt, the tyramide-coupled signal amplification procedure using a CSA Kit (DAKO) was used. Immunoreactivity for p-ser473Akt was scored according to the criteria described in Table 1.Table 1Scoring of Immunoreactivities for p-ser473AktPositive areaIntensityScoreNegative (0%)0Very focal (<5%)0.5Small area (<30%)Modest1.0Strong1.5Moderate (<60%)Modest2.0Strong2.5Diffuse (<100%)Modest3.0Strong3.5Positive area, the percentage of positive cells in the observed fields. Open table in a new tab Positive area, the percentage of positive cells in the observed fields. Among the 108 lung tumors described above, 68 tumors were examined for K-ras gene status. The mutations were screened by single-strand conformation polymorphism analysis (SSCP), and were confirmed by direct DNA sequencing. The genomic DNA of the lung tumors was extracted from the paraffin sections by the following method. The sections were deparaffinized and stained briefly with toluidine blue. The desired areas were dissected, and the fragments were incubated with DNA lysis buffer containing 10 mmol/L Tris-HCl (pH8.3), 1 mmol/L EDTA, 1% SDS, and 2 μg/ul proteinase K. The sample DNA was purified by phenol/chloroform extraction and ethanol precipitation. One hundred thirty-four-bp DNA fragments surrounding K-ras gene codon 12 were amplified by PCR with the primers, 5′-GGCTGCTGAAAATGACTGAATATA and 5′-CAAGATTTACCTCTATTGTT. Ten μl of the PCR products were mixed with 5 μl of denaturing solution containing 95% formamide, 0.05% bromophenol blue, 0.05% xylencyanol, and 20 mmol/L EDTA, and were boiled, then rapidly cooled on ice. The samples were subjected to 6% polyacrylamide gel electrophoresis, and then stained with silver (BioRad, Hercules, CA). For the samples showing abnormal band shifts, the DNA sequence of the PCR products was determined using a DNA sequencing kit (Amersham). The differences in mean values from the cell migration, cell growth and cell death assays, or of p-ser473Akt immunoreactive scores were analyzed by the Student's t-test. The correlation between the immunoreactive score and lymphatic metastasis (N factor) was analyzed by Spearman's correlation coefficient. To evaluate the relationship between the immunoreactive score and survival distribution, the T1 cases, in which the patients died of causes other that lung adenocarcinoma, were excluded, and the data were examined by Kaplan-Meier's survival analysis with the log rank test. The differences with a P value less than 0.05 were considered significant in these analyses. The success of K-ras or K-rasV12 gene transfections was confirmed by Western blotting. In the empty vector-transfected cells (HPL-E cell), the amount of endogenous K-ras was too small to detect under this experimental condition. Both K-ras- and K-rasV12-transfected cells (HPL-K and HPL-V12 cells) expressed the corresponding protein products at similar levels (Figure 1a). Since we used HGF as a chemoattractant for the cell migration assays in the present study, the expression of the HGF receptor, c-met, in these transfectants was examined to exclude the possibility that the K-ras gene status could influence its expression. As shown in Figure 1a, the expression of c-met was not modified by K-ras or K-rasv12 transfection. HGF has been shown to promote the scattering of a wide variety of cells including the airway epithelial cells,22Zahm JM Debordeaux C Raby B Klossel JM Bonnet N Puchelle E Motogenic effect of recombinant HGF on airway epithelial cells during the in vitro wound repair of the respiratory epithelium.J Cell Physiol. 2000; 185: 447-453Crossref PubMed Scopus (42) Google Scholar and to simultaneously activate the ras- and ras-PI3K-Akt pathways.23Zeng Q Chen S You Z Yang F Carey TE Saims D Wang CY Hepatocyte growth factor inhibits anoikis in head and neck squamous cell carcinoma cells by activation of ERK and Akt signaling independent of NFκB.J Biol Chem. 2002; 277: 25203-25208Crossref PubMed Scopus (128) Google Scholar, 24Zheng DQ Woodard AS Tallini G Languino LR Substrate specificity of αVβ3 integrin-mediated cell migration and phospahtidylinositol 3-kinase/Akt pathway activation.J Biol Chem. 2000; 275: 24565-24574Crossref PubMed Scopus (129) Google Scholar We therefore anticipated that airway cells bearing an activating mutation of the K-ras gene would be able to migrate well even in the absence of HGF. As expected, HPL-V12 cells migrated well through the pores of transwell membranes (6.5- and 3.5-fold better than HPL-E and HPL-K cells, respectively) under conditions without HGF stimulation (Figure 1, b and c). This enhanced migration of HPL-V12 cells was similar to that of HPL-K cells stimulated with HGF (Figure 1c). No difference in the cell growth of the transfectants was seen at least during the period of the migration assay (see Figure 2a). To identify the pathways mediating the cell motility of these transfectants, the phosphorylation status of Akt and Erk1/2 was examined. Irrespective of the presence or absence of HGF, HPL-V12 cells showed a constitutively higher level of Akt phosphorylation compared to either HPL-E or HPL-K cells (Figure 1, d and e). Erk1/2, especially Erk1, phosphorylation was also slightly enhanced by K-rasV12 transfection (Figure 1, d and e). The HGF treatment increased Akt phosphorylation in HPL-E and HPL-V12 cells. The phosphorylation levels reached the similar level of HPL-V12 cells at 90 minutes after the treatment (Figure 1, d and e), and reduced to the basal level at 6 to 12 hours (data not shown). Erk1/2 phosphorylation was also enhanced by the HGF treatment, but the change was modest in HPL-V12 cells compared to the other two cells (Figure 1, d and e). Our preliminary study showed that the elevation of Erk1/2 phosphorylation in HPL-V12 cells was very transient and the phosphorylation levels was reduced to almost the basal level by 30 minutes after the treatment (data not shown), while in contrast, it continued for 120 minutes in HPL-E and HPL-K cells (data not shown). The expression levels of whole Akt and Erk1/2 were not changed by K-ras or K-rasV12 gene transfection, or by HGF treatment (Figure 1d, the results of densitometric analysis are not shown).