Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

DNA Binding and Transcriptional Activation by a PDX1·PBX1b·MEIS2b Trimer and Cooperation with a Pancreas-specific Basic Helix-Loop-Helix Complex

2001; Elsevier BV; Volume: 276; Issue: 21 Linguagem: Inglês

10.1074/jbc.m100678200

ISSN

1083-351X

Autores

Ying Liu, Raymond J. MacDonald, Galvin H. Swift,

Tópico(s)

Congenital heart defects research

Resumo

In pancreatic acinar cells, the HOX-like factor PDX1 acts as part of a trimeric complex with two TALE class homeodomain factors, PBX1b and MEIS2b. The complex binds to overlapping half-sites for PDX1 and PBX. The trimeric complex activates transcription in cells to a level about an order of magnitude greater than PDX1 alone. The N-terminal PDX1 activation domain is required for detectable transcriptional activity of the complex, even though PDX1 truncations bearing only the PDX1 C-terminal homeodomain and pentapeptide motifs can still participate in forming the trimeric complex. The conserved N-terminal PBC-B domain of PBX, as well as its homeodomain, is required for both complex formation and transcriptional activity. Only the N-terminal region of MEIS2, including the conserved MEIS domains, is required for formation of a trimer on DNA and transcriptional activity: the MEIS homeodomain is dispensable. The activity of the pancreas-specific ELA1 enhancer requires the cooperation of the trimer-binding element and a nearby element that binds the pancreatic transcription factor PTF1. We show that the PDX1· PBX1b·MEIS2b complex cooperates with the PTF1 basic helix-loop-helix complex to activate an ELA1 minienhancer in HeLa cells and that this cooperation requires all three homeoprotein subunits, including the PDX1 activation domain. In pancreatic acinar cells, the HOX-like factor PDX1 acts as part of a trimeric complex with two TALE class homeodomain factors, PBX1b and MEIS2b. The complex binds to overlapping half-sites for PDX1 and PBX. The trimeric complex activates transcription in cells to a level about an order of magnitude greater than PDX1 alone. The N-terminal PDX1 activation domain is required for detectable transcriptional activity of the complex, even though PDX1 truncations bearing only the PDX1 C-terminal homeodomain and pentapeptide motifs can still participate in forming the trimeric complex. The conserved N-terminal PBC-B domain of PBX, as well as its homeodomain, is required for both complex formation and transcriptional activity. Only the N-terminal region of MEIS2, including the conserved MEIS domains, is required for formation of a trimer on DNA and transcriptional activity: the MEIS homeodomain is dispensable. The activity of the pancreas-specific ELA1 enhancer requires the cooperation of the trimer-binding element and a nearby element that binds the pancreatic transcription factor PTF1. We show that the PDX1· PBX1b·MEIS2b complex cooperates with the PTF1 basic helix-loop-helix complex to activate an ELA1 minienhancer in HeLa cells and that this cooperation requires all three homeoprotein subunits, including the PDX1 activation domain. base pair(s) basic helix-loop-helix kilobase(s) in vitrotranscription and translation electrophoretic mobility shift assay cytomegalovirus activation domain homeodomain pentapeptide motif The HOX transcription factors are key mediators for establishing the embryonic body plan and guiding organogenesis (1Sharkey M. Graba Y. Scott M.P. Trends Genet. 1997; 13: 145-151Abstract Full Text PDF PubMed Scopus (112) Google Scholar, 2Krumlauf R. Cell. 1994; 78: 191-201Abstract Full Text PDF PubMed Scopus (1749) Google Scholar, 3Lawrence P.A. Morata G. Cell. 1994; 78: 181-189Abstract Full Text PDF PubMed Scopus (248) Google Scholar). The many members of this large gene family have distinct roles in development, despite having very similar DNA binding specificities and overlapping patterns of expression. At least part of the increased binding specificity required to distinguish the roles of the various HOX proteins comes from their interaction with members of the TALE class of homeodomain proteins (for review see Ref. 4Mann R.S. Affolter M. Curr. Opin. Genet. Dev. 1998; 8: 423-429Crossref PubMed Scopus (326) Google Scholar). The TALE proteins are characterized by the presence of a 3-amino acid loop extension between α-helices 1 and 2 of the homeodomain (5Burglin T.R. Nucleic Acids Res. 1997; 25: 4173-4180Crossref PubMed Scopus (499) Google Scholar) and include both the PBC class (mammalian PBX proteins, Drosophila Extradenticle, andCaenorhabditis elegans Ceh-20 (6Burglin T.R. Ruvkun G. Nat. Genet. 1992; 1: 319-320Crossref PubMed Scopus (68) Google Scholar)) and the MEIS-like TALE factors (mammalian MEIS and PREP1 proteins, DrosophilaHomothorax (HTH), C. elegans Ceh-25 (5Burglin T.R. Nucleic Acids Res. 1997; 25: 4173-4180Crossref PubMed Scopus (499) Google Scholar, 7Knoepfler P.S. Calvo K.R. Chen H. Antonarakis S.E. Kamps M.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14553-14558Crossref PubMed Scopus (168) Google Scholar)). Other homeodomain proteins important in development also form complexes with the TALE proteins, including the pancreas/duodenal homeobox-1 protein (PDX1) (8Goudet G. Delhalle S. Biemar F. Martial J.A. Peers B. J. Biol. Chem. 1999; 274: 4067-4073Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar, 9Peers B. Sharma S. Johnson T. Kamps M. Montminy M. Mol. Cell. Biol. 1995; 15: 7091-7097Crossref PubMed Scopus (145) Google Scholar, 10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar). Pdx1 is a member of the PARAHOX cluster of homeobox genes implicated in the development of endoderm-derived organs (11Brooke N.M. Garcia-Fernandez J. Holland P.W.H. Nature. 1998; 392: 920-923Crossref PubMed Scopus (357) Google Scholar). Pdx1 is essential to the development of both the endocrine and exocrine compartments of the pancreas (12Stoffers D.A. Zinkin N.T. Stanojevic V. Clarke W.L. Habener J.F. Nat. Genet. 1997; 15: 106-110Crossref PubMed Scopus (938) Google Scholar, 13Jonsson J. Carlsson L. Edlund T. Edlund H. Nature. 1994; 371: 606-609Crossref PubMed Scopus (1574) Google Scholar, 14Offield M.F. Jetton T.L. Labosky P.A. Ray M. Stein R.W. Magnuson M.A. Hogan B.L.M. Wright C.V.E. Development. 1996; 122: 983-995Crossref PubMed Google Scholar). The interaction of PDX1 with PBX is required for the expansion of the various endocrine and exocrine cell types during development (15Dutta S. Gannon M. Peers B. Wright C. Bonner-Weir S. Montminy M. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 1065-1070Crossref PubMed Scopus (112) Google Scholar). Although Pdx1 is expressed throughout the pancreas during embryonic development, its expression is predominantly localized to the β-cells of the islets of Langerhans of adult mammals (16Ohlsson H. Karlsson K. Edlund T. EMBO J. 1993; 12: 4251-4259Crossref PubMed Scopus (775) Google Scholar, 17Guz Y. Montminy M.R. Stein R. Leonard J. Gamer L.W. Wright C.V.E. Teitelman G. Development. 1995; 121: 11-18Crossref PubMed Google Scholar). PDX1 has been implicated in the transcriptional control of a number of β-cell-specific genes, including insulin (16Ohlsson H. Karlsson K. Edlund T. EMBO J. 1993; 12: 4251-4259Crossref PubMed Scopus (775) Google Scholar, 18Peers B. Leonard J. Sharma S. Teitelman G. Montminy M.R. Mol. Endocrinol. 1994; 8: 1798-1806PubMed Google Scholar), glucokinase (19Watada H. Kajimoto Y. Umayahara Y. Matsuoka T. Kaneto H. Fujitani Y. Kamada T. Kawamori R. Yamasaki Y. Diabetes. 1996; 45: 1478-1488Crossref PubMed Google Scholar), islet amyloid polypeptide (20Serup P. Jensen J. Andersen F.G. Jorgensen M.C. Blume N. Holst J.J. Madsen O.D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9015-9020Crossref PubMed Scopus (130) Google Scholar, 21Carty M.D. Lillquist J.S. Peshavaria M. Stein R. Soeller W.C. J. Biol. Chem. 1997; 272: 11986-11993Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar), and glucose transporter type 2 (22Waeber G. Thompson N. Nicod P. Bonny C. Mol. Endocrinol. 1996; 10: 1327-1334Crossref PubMed Scopus (326) Google Scholar). PDX1 also participates in the activation of an acinar cell-specific gene, elastase 1 (ELA1); in this instance it acts as part of a trimeric complex with PBX1b and MEIS2 (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar). Our previous studies identified the PDX1·PBX1b·MEIS2 trimer as one of two pancreatic transcription factor complexes that cooperate in the transcriptional activation of the ELA1 enhancer in acinar cells (23MacDonald R.J. Swift G.H. Int. J. Dev. Biol. 1998; 42: 983-994PubMed Google Scholar). The ELA1 enhancer comprises three functional elements (A, B, and C) within 100 bp1 (24Rose S.D. Kruse F. Swift G.H. MacDonald R.J. Hammer R.E. Mol. Cell. Biol. 1994; 14: 2048-2057Crossref PubMed Scopus (34) Google Scholar). The proper acinar activity of the enhancer requires the synergistic cooperation between the A and B elements (25Swift G.H. Kruse F. MacDonald R.J. Hammer R.E. Genes Dev. 1989; 3: 687-696Crossref PubMed Scopus (45) Google Scholar, 26Kruse F. Rose S.D. Swift G.H. Hammer R.E. MacDonald R.J. Mol. Cell. Biol. 1995; 15: 4385-4394Crossref PubMed Scopus (35) Google Scholar). The PDX1·PBX1b·MEIS2 complex binds and mediates the acinar activity of the B element (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar). The other factor, PTF1, is a bHLH acinar cell-specific complex that binds and mediates the activity of the A element (24Rose S.D. Kruse F. Swift G.H. MacDonald R.J. Hammer R.E. Mol. Cell. Biol. 1994; 14: 2048-2057Crossref PubMed Scopus (34) Google Scholar,27Cockell M. Stevenson B.J. Strubin M. Hagenbuchle O. Wellauer P.K. Mol. Cell. Biol. 1989; 9: 2464-2476Crossref PubMed Scopus (117) Google Scholar). 2S. D. Rose, R. J. MacDonald, M. J. Peyton, R. E. Hammer, and G. H. Swift, manuscript in preparation. PTF1 is essential for the formation of the exocrine pancreas (28Krapp A. Knofler M. Ledermann B. Burki K. Berney C. Zoerkler N. Hagenbuchle O. Wellauer P.K. Genes Dev. 1998; 12: 3752-3763Crossref PubMed Scopus (443) Google Scholar) as well as for the transcription of the digestive enzyme genes (24Rose S.D. Kruse F. Swift G.H. MacDonald R.J. Hammer R.E. Mol. Cell. Biol. 1994; 14: 2048-2057Crossref PubMed Scopus (34) Google Scholar, 29Krapp A. Knofler M. Frutiger F. Hughes G.J. Hagenbuchle O. Wellauer P.K. EMBO J. 1996; 15: 4317-4329Crossref PubMed Scopus (196) Google Scholar). In this report, we show which domains of PDX1, PBX1b, and MEIS2b are essential for the formation of the trimeric complex, for binding of the complex to DNA, for transcriptional activity, and for cooperative activation with PTF1. PDX1 contributes the only transcriptional activation domain, even though the activity of the trimer is an order of magnitude greater than that of PDX1 alone. PDX1 recruits PBX1b, and they bind in tandem to adjacent PDX1 and PBX half-sites. PBX1b recruits MEIS2b to the DNA-bound complex. MEIS2b is required for both the transcriptional activity of the PDX1·PBX1b·MEIS2 trimer and its cooperation with PTF1. The ELAI B element has been described previously (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar); the top strand sequences of the B element and its derivatives B2 and B7 are shown in Fig. 1 A. The CRS1 element from the bovine CYP17 gene has the top strand sequence of CCTCGAGACGTTGATGGACAGTGAGCAAGG, and the bottom strand sequence of TCGACCTTGCTCACTGTCCATCAACGTCTCGAGGAGCT; the adjoining PBX and MEIS binding sites are underlined(30Bischof L.J. Kagawa N. Moskow J.J. Takahashi Y. Iwamatsu A. Buchberg A.M. Waterman M.R. J. Biol. Chem. 1998; 273: 7941-7948Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). Polyclonal rabbit antibodies against PDX1, PBX, PBX1, and MEIS2 have been described previously (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar). The polyclonal rabbit antiserum specific for the a and b isoforms of MEIS2 proteins were raised against an 18-amino acid peptide, PMSGMGMNMGMDGQWHYM, corresponding to amino acids 377–394 of MEIS2b. Similarly, a 16-amino acid peptide, SVDPNVGGQVMDIHAQ, spanning amino acids 455–470 of MEIS2d, was used to produce the anti-MEIS2c/d. A 7-amino acid insert, GFLLDPS, corresponding to amino acids 346–352 of MEIS2a and MEIS2c, is specifically present in these two isoforms. The antibody αMEIS2a/c was raised against a 14-amino acid peptide containing a tandem repeat of the insert. All of the MEIS isoform-specific antibodies were raised against peptide sequences common to mouse and human orthologues. The B element reporter construct (5B.EIp.hGH) has five head-to-tail copies of the B element (Fig.1 A) linked to the Ela1 minimal promoter from −92 to +8 and fused to an hGH reporter gene (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar). In the B2 and B7 multimer constructs, sense strand and antisense strand oligonucleotides containing five copies of the B2 or B7 elements (Fig. 1 A) were annealed and cloned into the Ela1 minimal promoter/hGH reporter plasmid. The mini-enhancer construct 3(BA).EIp.hGH (26Kruse F. Rose S.D. Swift G.H. Hammer R.E. MacDonald R.J. Mol. Cell. Biol. 1995; 15: 4385-4394Crossref PubMed Scopus (35) Google Scholar) has three head-to-tail copies of adjacent B and A elements (PDX1·PBX1b·MEIS2b and PTF1 binding sites, respectively) from theEla1 gene inserted in front of the Ela1 promoter. The Pdx1.luciferase reporter plasmid, used as an internal control in RIN1046–38 cell transfections, has 4.5 kb of 5′-flanking sequence from the Mus musculus Pdx1 gene (GenBank™ accession number AF192495; a gift of Dr. Chris Wright, Nashville, TN) inserted upstream of the luciferase gene in pGL3basic (Promega, Madison, WI). The deletion series of PDX1, PBX1b, and MEIS2b were created by polymerase chain reaction amplification of the corresponding coding regions and cloning of the fragments into expression vectors. The full-length and PDX1 deletion cDNAs were cloned into pcDNA3.1/V5/His TOPO (Invitrogen Co., Carlsbad, CA). The encoded PDX1 proteins contain V5 and His epitope tags at their C termini. To synthesize the PBX1b deletion series by in vitrotranscription and translation (IVT), the cDNAs were cloned into FLAG-pSP65, thereby adding a FLAG-tag at the N terminus of each protein. Each PBX1b cDNA, together with the N-terminal FLAG-tag, was transferred into pcDNA1.1/Amp (Invitrogen) for expression in transfected cells. The MEIS2b deletion series was cloned into pET-28b (Novagen, Madison, WI) under the control of the T7 promoter for IVT. Tandem His and T7 epitope tags were included at the N terminus of each MEIS2b protein. For expression in transfected cells, the MEIS2b cDNAs, together with the His and T7 tags, were transferred into pcDNA1.1/Amp. An IVT expression plasmid for MEIS2d was generated by polymerase chain reaction amplification of Meis2d cDNA using Meis2d/pBS.SK− (a gift of Professor Pierre Chambon, CNRS-INSERM, Strasbourg, France) as template, and the insert was cloned into pET-28b. The cDNA for the mouse p48 subunit of PTF1 (a gift of Dr. Scott Rose, University of Texas Southwestern, Dallas) and the cDNA for HEB (a gift of Dr. Richard Baer, New York, NY) were transferred to pcDNA1.1/Amp for transfection experiments. Procedures for preparing nuclear extracts, in vitro translation (IVT), EMSA, and antibody supershift assays have been described previously (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar). In all EMSA reactions containing nuclear extract from 266–6 cells, a GATA binding site oligonucleotide βG1 (31Swift G.H. Rose S.D. MacDonald R.J. J. Biol. Chem. 1994; 269: 12809-12815Abstract Full Text PDF PubMed Google Scholar) was added to compete with GATA4 binding to the B or mutant B elements. IVT proteins were incubated at 37 °C for 15 min prior to the standard EMSA protocol. Western blot analyses were conducted as previously described (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar). 30 μg of nuclear extracts, or 0.25 μl of the rabbit reticulocyte lysates containing the IVT proteins were resolved by sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis and electrophoretically transferred onto Immobilon polyvinylidene difluoride membranes (Millipore, Bedford MA). Immune complexes were detected by enhanced chemiluminescence with Supersignal West (Pierce, Inc., Rockford, IL). The exocrine cell lines were: 266-6 (ATCC CRL-2151) (32Ornitz D.M. Hammer R.E. Messing A. Palmiter R.D. Brinster R.L. Science. 1987; 238: 188-193Crossref PubMed Scopus (184) Google Scholar), C5–2E, (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar), ARIP (ATCC CRL-1674) (33Jessop N.W. Hay R.J. In Vitro. 1980; 16: 212Google Scholar), and AR4–2J (ATCC CRL-1492) (33Jessop N.W. Hay R.J. In Vitro. 1980; 16: 212Google Scholar). The β-cell lines were: βTC3 (34Efrat S. Linde S. Kofod H. Spector D. Delannoy M. Grant S. Hanahan D. Baekkeskov S. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 9037-9041Crossref PubMed Scopus (474) Google Scholar), Ins1 (35Asfari M. Janjic D. Meda P. Li G. Halban P.A. Wollheim C.B. Endocrinology. 1992; 130: 167-178Crossref PubMed Scopus (748) Google Scholar), and RIN1046–38 (36Phillipe J. Chick W.L. Habener J.F. J. Clin. Invest. 1987; 79: 351-358Crossref PubMed Scopus (105) Google Scholar). Co-immunoprecipitation of the PBX and MEIS proteins was performed as follows. 10 μl of reticulocyte lysate containing equimolar amounts of35S-labeled IVT protein and the unlabeled IVT partner was incubated at 37 °C for 40 min. 5 μl of polyclonal antibody specific for the non-labeled protein was added, and the reaction volume was increased to 300 μl by adding buffer containing 10 mmHEPES (pH 7.6), 250 mm NaCl, 0.1% Nonidet P-40, and 5 mm EDTA. After gentle mixing by rotation at 4 °C for 1 h, 20 μl of protein A beads (Santa Cruz Biotechnology Inc., Santa Cruz, CA) was added, and the mixing was continued overnight. Following the incubation, the beads were collected and washed, then resuspended in SDS-gel loading buffer. Samples were separated by SDS-10% polyacrylamide gel electrophoresis, and the35S-labeled IVT proteins were detected with a PhosphorImager (Molecular Dynamics, Santa Clara, CA). Transfections of the RIN1046-38 β-cell line (RIN-38) (36Phillipe J. Chick W.L. Habener J.F. J. Clin. Invest. 1987; 79: 351-358Crossref PubMed Scopus (105) Google Scholar) and HeLa (ATCC CCL-2) were performed with FuGene (Roche Molecular Biochemicals, Indianapolis, IN) according to the manufacturer's instructions. All of the plasmids for the expression of transcription factors, as well as the β-galactosidase internal control plasmid (pCMVβ, CLONTECH, Palo Alto, CA) utilized the CMV enhancer/promoter. All transfections contained the same total amount of CMV enhancer/promoter, balanced as necessary by the addition of insertless CMV vector (e.g.pcDNA1.1/Amp). The activity of the hGH reporter gene was assayed by radioimmunoassay (Nichols Institute, San Juan Capistrano, CA). Transfections of HeLa cells were corrected for relative efficiency based on the activity of the cotransfected β-galactosidase reporter assayed with a Galacto-Light Plus kit (Tropix Inc., Bedford, MA). Transfections of RIN1046-38 cells were corrected for relative efficiency based on the activity of a cotransfected Pdx1.luciferase reporter, in which the luciferase reporter gene was under the transcriptional control of the Pdx1 gene promoter sequence. Luciferase activity was assayed with a kit from Promega (Madison, WI). Transfection results reported are the mean and standard error of a minimum of four transfections, except as noted. For those deletion plasmids of PDX1, PBX1b, and MEIS2b that had significantly less than wild type activity in transfections, we confirmed the production of protein and its nuclear localization by immunohistochemical staining using monoclonal antibodies recognizing their peptide tags (PDX1 with anti-V5, Invitrogen, Carlsbad, CA; PBX1b with anti-FLAG, Sigma Chemical Co., St Louis, MO; MEIS2b with anti-T7, Novagen, Madison, WI). All were expressed and localized to the nucleus at approximately wild type levels, except for PDX116–206, which was found only in the cytoplasm (data not shown). We previously identified a trimeric homeoprotein complex that binds to and mediates the activity of the B element of the elastase I (ELA1) enhancer in pancreatic acinar cell lines (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar). The complex consists of a pancreatic HOX-like protein, PDX1, and two TALE-class homeodomain proteins, PBX1b and an isoform of MEIS2/MRG1. The trimeric complex binds an 11-bp region of the B element containing overlapping half-sites for PDX1 and PBX but no recognizable site for MEIS (Fig. 1 A). Mutations in either the PDX1 or PBX half-site eliminate trimer binding (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar). The central role of PDX1 in trimer binding was demonstrated by mutation of a single nucleotide in the PDX1 half-site of the B element (the A at position 7 of the PBX-HOX consensus): neither PDX1 nor the PDX1-containing trimeric complex from 266-6 acinar cell nuclear extracts bound detectably to the oligonucleotide containing this A to C transversion (B7, Fig. 1 B) and this B7 oligonucleotide was unable to compete for trimer binding in EMSA competition assays (Fig. 1 C). These results confirmed the binding of PDX1 to its half-site and demonstrated that the formation of the trimeric complex is dependent on an intact PDX1 half-site. To be able to study the structure of the trimeric complex, it was necessary to increase the PBX binding affinity of the B element without altering the qualitative nature of the activity of the element in cells. The binding affinity is low, because nucleotides at positions 1, 2, and 6 differ from the consensus binding sequence for PBX/HOX heterodimers (37Chan S.-K. Mann R.S. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5223-5228Crossref PubMed Scopus (101) Google Scholar, 38Chang C.-P. Shen W.-F. Rozenfeld S. Lawrence H.J. Largman C. Cleary M.L. Genes Dev. 1995; 9: 663-674Crossref PubMed Scopus (353) Google Scholar). Changing the A at position 2 to T matches the consensus PBX half-site (B2, Fig. 1 A) and increased the binding of the trimeric complex from acinar cell nuclear extracts without affecting the binding of the PDX1 monomer (Fig.1 B). In competition assays the B2 element was ∼5-fold more effective than the unmodified B element (Fig. 1 C). Antisera specific for PDX1, PBX, and MEIS2 eliminated the B and B2 complexes with equal effectiveness (Fig. 1 D), confirming that the homeodomain protein composition is the same for the two complexes. The transcriptional activities of B and B2 in transfected cells were also qualitatively the same (see Fig. 4, below). We subsequently used the more effective B2 element to test the ability of various forms of the three transcription factors to form complexes on DNA and activate transcription. To determine which of four MEIS2 isoforms are present in the trimeric complex, we developed antisera against distinguishing peptide regions of the isoforms. Four alternatively spliced variants of Meis2 mRNA encode four distinct protein products: 2a, 2b, 2c, and 2d (39Oulad-Abdelghani M. Chazaud C. Bouillet P. Sapin V. Chambon P. Dolle P. Dev. Dyn. 1997; 210: 173-183Crossref PubMed Scopus (85) Google Scholar). MEIS2a and 2b have a different C-terminal tail (18 amino acids) than MEIS2c and 2d (94 amino acids); MEIS2a and 2c share a common seven amino acid insert, GFLLDPS, which MEIS2b and 2d lack. The antiserum specific for MEIS2a/b supershifted most of the trimeric complex from acinar cell extracts, leaving behind a residual complex of slightly slower electrophoretic mobility (Fig.2 A, lane 3). The antiserum specific for MEIS2c/d decreased the amount of the trimeric complex slightly (lane 5 versus lane 4), although a supershifted band was not observed. Antiserum against the MEIS2a/c-specific heptapeptide did not reduce the amount of the trimeric complex more than the preimmune serum (lanes 6and 7). These results indicate that MEIS2b and possibly MEIS2d are present in the complex, but MEIS2a and 2c are not. To determine whether the residual slower mobility complex remaining after treatment with αMEIS2a/b antiserum contained MEIS2d, nuclear extract was treated with a mixture of αMEIS2a/b and αMEIS2c/d antisera (Fig. 2 B, lane 4). The combination eliminated all of the trimeric complex. In contrast, combining αMEIS2a/b and αMEIS2a/c did not eliminate the slower migrating complex (lane 6), further showing that MEIS2c is not in the trimeric complex. PDX1, PBX1b, and MEIS2 proteins synthesized by translation in vitro can form trimeric complexes on DNA (Fig. 2 B,lanes 7 and 8). The complex formed with recombinant PDX1·PBX1b·MEIS2b comigrates with the predominant trimer from 266-6 acinar cells (Fig. 2 B, lane 7), whereas the PDX1·PBX1b·MEIS2d complex (lane 8) comigrates with the slower mobility complex that remains after αMEIS2b treatment. Thus, we conclude that the major molecular form of the acinar trimeric complex comprises PDX1, PBX1b, and MEIS2b and that MEIS2d replaces MEIS2b in a small fraction of the complexes. The presence of MEIS2b and 2d in acinar cells was confirmed by Western blot analysis (Fig. 3). Unlike PBX1b, which is present in pancreatic acinar but not β-cell lines (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar), the MEIS2 proteins were detected in nuclear extracts from both. The levels of the MEIS2 proteins were lower in β-cells than in acinar cells. Multimers of the B element are transcriptionally active in the β-cell line RIN1046-38 (RIN-38), due to the presence of endogenous PDX1 in these cells (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar). PBX1 is absent in these β-cells (10Swift G.H. Liu Y. Rose S.D. Bischof L. Steelman S. Buchberg A.M. Wright C.V.E. MacDonald R.J. Mol. Cell. Biol. 1998; 18: 5109-5120Crossref PubMed Scopus (147) Google Scholar), and MEIS2 is present at extremely low levels (Fig. 3). Adding either PBX1b or MEIS2b to the β-cell line by transfection had little or no effect on the activity of the B multimer or on the B element with the augmented PBX1b binding site (B2) (Fig.4 A). Co-expression of PBX1b and MEIS2b in RIN-38 β-cells increased the activity of either the B or B2 multimer severalfold over the activity directed by the endogenous PDX1 (7-fold for the B element; 4-fold for the B2 element). These results indicate that the trimer complex is more transcriptionally active in RIN-38 cells than PDX1 alone. The B7 mutation which eliminated PDX1 and trimer binding in EMSA had no activity in the β-cell line, whether in the presence or absence of cotransfected PBX1b and MEIS2b (Fig. 4 A), confirming the central importance of PDX1 binding to the activity of this element. PDX1 contains three important functional domains (Fig. 5 A): an activation domain (AD) at the N terminus (amino acid residues 1–79), a pentapeptide motif (PP; residues 121–125) that directly contacts PBX, and the homeodomain (HD) (residues 145–206) (9Peers B. Sharma S. Johnson T. Kamps M. Montminy M. Mol. Cell. Biol. 1995; 15: 7091-7097Crossref PubMed Scopus (145) Google Scholar, 40Lu M. Miller C. Habener J. Endocrinology. 1996; 137: 2959-2967Crossref PubMed Scopus (53) Google Scholar, 41Peshavaria M. Henderson E. Sharma A., E. Wright C.V. Stein R. Mol. Cell. Biol. 1997; 17: 3987-3996Crossref PubMed Scopus (85) Google Scholar). A cryptic C-terminal activation domain also functions in the transcriptional activation of the somatostatin gene by PDX1 (40Lu M. Miller C. Habener J. Endocrinology. 1996; 137: 2959-2967Crossref PubMed Scopus (53) Google Scholar). We constructed a series of PDX1 deletion mutants to test the function of each domain in the context of the trimer (Fig. 5 A). The mutant proteins were synthesized by in vitro translation (IVT), and their ability to bind DNA was assayed by EMSA. Full-length PDX1 binds to the B2 element as a monomer, a heterodimer with PBX1b, and a heterotrimer with PBX1b and MEIS2b (Fig.5 B, lane 2). PDX1 mutants missing the regions C-terminal to the HD or N-terminal to the PP motif had similar DNA binding activities as the wild type PDX1 (lanes 3,4, and 6). When the PP motif was also deleted, however, the protein was unable to form heterodimeric and heterotrimeric complexes on DNA (lane 5). Therefore, only the DNA-binding domain and the PBX-interaction motif are required for PDX1 to participate fully in forming the trimeric complex on DNA. These are the same domains required for dimer formation with PBX1 (Fig.5 B and Ref. 9Peers B. Sharma S. Johnson T. Kamps M. Montminy M. Mol. Cell. Biol. 1995; 15: 7091-7097Crossref PubMed Scopus (145) Google Scholar). To investigate which PDX1 domains are essential for trimer function, we tested the

Referência(s)