Portal de Periódicos da CAPES

The Second Stalk Composed of the b- and δ-subunits Connects F0 to F1 via an α-Subunit in theEscherichia coli ATP Synthase

1998; Elsevier BV; Volume: 273; Issue: 45 Linguagem: Inglês

10.1074/jbc.273.45.29406

1083-351X

Andrew Rodgers, Roderick Capaldi,

Ion Transport and Channel Regulation

The b- and δ-subunits of the Escherichia coli ATP synthase are critical for binding ECF1 to the F0 part, and appear to constitute the stator necessary for holding the α3β3 hexamer as the c-ε-γ domain rotates during catalysis. Previous studies have determined that the b-subunits are dimeric for a large part of their length, and interact with the F1 part through the δ-subunit (Rodgers, A. J. W., Wilkens, S., Aggeler, R., Morris, M. B., Howitt, S. M., and Capaldi, R. A. (1997)J. Biol. Chem. 272, 31058–31064). To further study b-subunit interactions, three mutants were constructed in which Ser-84, Ala-144, and Leu-156, respectively, were replaced by Cys. Treatment of purified ECF1F0 from all three mutants with CuCl2 induced disulfide formation resulting in b-subunit dimer cross-link products. In addition, the mutant bL156C formed a cross-link from a b-subunit to an α-subunit via αCys90. Neither b-b nor b-α cross-linking had significant effect on ATPase activities in any of the mutants. Proton pumping activities were measured in inner membranes from the three mutants. Dimerization of the b-subunit did not effect proton pumping in mutants bS84C or bA144C. In the mutant bL156C, CuCl2 treatment reduced proton pumping markedly, probably because of uncoupling caused by the b-α cross-link formation. The results show that the α-subunit forms part of the binding site on ECF1 for the b2δ domain and that the b-subunit extends all the way from the membrane to the top of the F1 structure. Some conformational flexibility in the connection between the second stalk and F1 appears to be required for coupled catalysis. The b- and δ-subunits of the Escherichia coli ATP synthase are critical for binding ECF1 to the F0 part, and appear to constitute the stator necessary for holding the α3β3 hexamer as the c-ε-γ domain rotates during catalysis. Previous studies have determined that the b-subunits are dimeric for a large part of their length, and interact with the F1 part through the δ-subunit (Rodgers, A. J. W., Wilkens, S., Aggeler, R., Morris, M. B., Howitt, S. M., and Capaldi, R. A. (1997)J. Biol. Chem. 272, 31058–31064). To further study b-subunit interactions, three mutants were constructed in which Ser-84, Ala-144, and Leu-156, respectively, were replaced by Cys. Treatment of purified ECF1F0 from all three mutants with CuCl2 induced disulfide formation resulting in b-subunit dimer cross-link products. In addition, the mutant bL156C formed a cross-link from a b-subunit to an α-subunit via αCys90. Neither b-b nor b-α cross-linking had significant effect on ATPase activities in any of the mutants. Proton pumping activities were measured in inner membranes from the three mutants. Dimerization of the b-subunit did not effect proton pumping in mutants bS84C or bA144C. In the mutant bL156C, CuCl2 treatment reduced proton pumping markedly, probably because of uncoupling caused by the b-α cross-link formation. The results show that the α-subunit forms part of the binding site on ECF1 for the b2δ domain and that the b-subunit extends all the way from the membrane to the top of the F1 structure. Some conformational flexibility in the connection between the second stalk and F1 appears to be required for coupled catalysis. 4-morpholinepropanesulfonic acid dithiothreitol polyacrylamide gel electrophoresis. An F1F0 type ATPase is located in mitochondrial, chloroplast, and bacterial membranes where it catalyzes the terminal step in oxidative- and photo-phosphorylation. InEscherichia coli, the enzyme contains five different subunits in the F1 part, α, β, γ, δ, and ε, in the stoichiometry 3:3:1:1:1, and three different subunits in the F0 part, a, b and c, in the ratio 1:2:9–12. The F1 part contains three catalytic sites on β-subunits and is an ATPase when released from the F0, whereas the F0 part forms a proton pore (1Senior A.E. Physiol. Rev. 1988; 68: 177-231Crossref PubMed Scopus (463) Google Scholar, 2Boyer P.D. Biochim. Biophys. Acta. 1993; 1140: 215-250Crossref PubMed Scopus (928) Google Scholar). The F1 and F0 parts of the E. colienzyme are joined by a central stalk 40–45 Å in length (3Gogol E.P. Lücken U. Capaldi R.A. FEBS Lett. 1987; 219: 274-278Crossref PubMed Scopus (96) Google Scholar) that is constituted by the γ- and ε-subunits (4Capaldi R.A. Aggeler R. Turina P. Wilkens S. Trends Biochem. Sci. 1994; 19: 284-289Abstract Full Text PDF PubMed Scopus (133) Google Scholar), both of which make contact with the c-subunit ring (5Watts S.D. Capaldi R.A. J. Biol. Chem. 1997; 272: 15065-15068Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 6Zhang Y. Fillingame R.H. J. Biol. Chem. 1995; 270: 24609-24614Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Two other subunits, δ of the F1 part and the two copies of the b-subunit of the F0 part, are also involved in binding F1 to F0 (7Perlin D.S. Senior A.E. Arch. Biochem. Biophys. 1985; 236: 603-611Crossref PubMed Scopus (31) Google Scholar, 8Sternweis P.C. Smith J.B. Biochemistry. 1977; 16: 4020-4025Crossref PubMed Scopus (71) Google Scholar, 9Wilkens S. Dunn S.D. Chandler J. Dahlquist F.W. Capaldi R.A. Nat. Struct. Biol. 1997; 4: 198-201Crossref PubMed Scopus (110) Google Scholar, 10Rodgers A.J.W. Wilkens S. Aggeler R. Morris M.B. Howitt S.M. Capaldi R.A. J. Biol. Chem. 1997; 272: 31058-31064Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Recent studies indicate that the b2δ domain forms a second connection, a stator that fixes the α3β3 subdomain to the a-subunit to allow rotation of a γ-ε-c subunit subdomain during energy coupling within the complex (9Wilkens S. Dunn S.D. Chandler J. Dahlquist F.W. Capaldi R.A. Nat. Struct. Biol. 1997; 4: 198-201Crossref PubMed Scopus (110) Google Scholar, 10Rodgers A.J.W. Wilkens S. Aggeler R. Morris M.B. Howitt S.M. Capaldi R.A. J. Biol. Chem. 1997; 272: 31058-31064Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). This stator function is consistent with the observed binding of the b-subunits to F1 as a dimer and via the δ-subunit (10Rodgers A.J.W. Wilkens S. Aggeler R. Morris M.B. Howitt S.M. Capaldi R.A. J. Biol. Chem. 1997; 272: 31058-31064Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar) and with experiments which show that, in the mutant αQ2C, a disulfide cross-link can be formed between α (at Cys-2) and δ at (Cys-140), which is without effect on ATPase, ATP-dependent proton pumping, or ATP synthesis activities (11Ogilvie I. Aggeler R. Capaldi R.A. J. Biol. Chem. 1997; 272: 16652-16656Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). The second stalk has recently been visualized by electron microscopy of single particles (12Wilkens S. Capaldi R.A. Nature. 1998; 393: 29Crossref PubMed Scopus (135) Google Scholar). There are four Cys residues intrinsic to the wild-type α-subunit. Of these, Cys-90 readily forms a disulfide bond with δ in isolated ECF1 (13Ogilvie, I., Wilkens, S., Rodgers, A. J. W., Aggeler, R., and Capaldi, R. A. (1998) Acta Physiol. Scand., in pressGoogle Scholar). Based on the crystal structure of bovine mitochondrial F1-ATPase (14Abrahams J.P. Leslie A.G.W. Lutter R. Walker J.E. Nature. 1994; 370: 621-628Crossref PubMed Scopus (2764) Google Scholar), αCys47 and αCys90 are in close proximity, whereas the two remaining Cys residues are buried in the protein. Interestingly, only one αCys90 residue per F1 complex is reactive to labeling withN-ethylmaleimide (15Mendel-Hartvig J. Capaldi R.A. Biochim. Biophys. Acta. 1991; 1060: 115-124Crossref PubMed Scopus (41) Google Scholar), demonstrating an inherent asymmetry of F1. Previous studies have shown that the b-subunit is dimeric for at least a portion of its length proximal to the C terminus (10Rodgers A.J.W. Wilkens S. Aggeler R. Morris M.B. Howitt S.M. Capaldi R.A. J. Biol. Chem. 1997; 272: 31058-31064Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 16Howitt S.M. Rodgers A.J.W. Jeffrey P.D. Cox G.B. J. Biol. Chem. 1996; 271: 7038-7042Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar, 17McLachlin D.T. Dunn S.D. J. Biol. Chem. 1997; 272: 21233-21239Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar) and also in the N-terminal membrane-spanning region (18Fillingame R.H. Jones P.C. Jiang W. Valiyaveetil F.I. Dmitriev O.Y. Biochim. Biophys. Acta. 1998; 1365: 135-142Crossref PubMed Scopus (59) Google Scholar). It has not been determined whether dimerization extends to the very C terminus of the protein. Interaction of the b-subunit with F1 has been shown to involve the δ-subunit, specifically its C terminus (10Rodgers A.J.W. Wilkens S. Aggeler R. Morris M.B. Howitt S.M. Capaldi R.A. J. Biol. Chem. 1997; 272: 31058-31064Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar), although it is not clear whether the b-subunit interacts with α or β as well. To examine interactions involving the b-subunit more fully, three new mutants were constructed in which Cys replaced Ser-84, Ala-144, and Leu-156 (the C-terminal residue), respectively, and disulfide cross-link formation in ECF1F0 was studied. Upon treatment with CuCl2, b-subunit dimers were formed in the mutant bL156C in competition with cross-linking to an α-subunit. This interaction of the very C terminus of b is shown to involve αCys90. Dimers of subunit b were also formed via Cys residues introduced at positions 84 and 144. These results show that the α-subunit forms part of the binding site on F1 for the second stalk and that the b-subunit extends from the membrane to the N-terminal domain of the α-subunit. Site-directed mutagenesis was carried out on an M13 mp18 clone containing the unc genes B, E, F, and H on a 2356-base pairHindIII/EcoRI fragment, according to the method of Kunkel et al. (19Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4560) Google Scholar). Residues bSer84, bAla144, and bLeu156 were replaced by Cys using the following oligonucleotides (sequence changes underlined): AAACGCCGCTGCCAGATTCTG (bS84C), GGATGAAGCTTGTAACAGCGAC (bA144C), and GCTGCTAACTGTGACATCGTG (bL156C). 909-base pairBsrGI/BssHII fragments carrying the mutateduncF genes were excised from the M13 mp18 replicative form and ligated into the vector pRA100 (described in Aggeler et al. (20Aggeler R. Chicas-Cruz K. Cai S.X. Keana J.F.W. Capaldi R.A. Biochemistry. 1992; 31: 2956-2961Crossref PubMed Scopus (95) Google Scholar)). These plasmids were used to transform theunc − E. coli strain AN888 (21Gibson F. Downie J.A. Cox G.B. Radik J. J. Bacteriol. 1978; 134: 728-736Crossref PubMed Google Scholar). Strains XL1-Blue (Stratagene) and CJ236 (New England Biolabs) were used in cloning and mutagenesis procedures. ECF1F0 was isolated and reconstituted into egg-lecithin vesicles as described in Aggeler et al. (22Aggeler R. Haughton M.A. Capaldi R.A. J. Biol. Chem. 1995; 270: 9185-9191Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Final resuspension was in 50 mm MOPS,1 pH 7.0, 2 mm MgCl2, and 10% glycerol, at a protein concentration of 1 mg/ml. Cross-linking was carried out at 22 °C for 2 h using concentrations of between 5 μm and 200 μm CuCl2. All cross-linking reactions were stopped by the addition of 5 mm EDTA, and ATPase activities (23Lötscher H.-R. deJong C. Capaldi R.A. Biochemistry. 1984; 23: 4140-4143Crossref PubMed Scopus (99) Google Scholar) were measured with and without prior incubation of the samples with 20 mm DTT for 2 h at 22 °C. Cross-linking in inner membranes was carried out at 22 °C for 2 h using 400 μm CuCl2. Cross-linking reactions were stopped by the addition of 5 mm EDTA, and ATPase and atebrin fluorescence quenching activities were measured with and without prior incubation of the samples with 50 mm DTT for 2 h at 22 °C. ECF1F0 was prepared as described above and resuspended in 50 mm MOPS, pH 7.0, 2 mm MgCl2, and 10% glycerol, at a protein concentration of 1 mg/ml. Stripped ECF1F0 was prepared by adding KSCN to a final concentration of 1 m and pelleting the enzyme at 175,000 × g for 30 min at 4 °C in a Beckman TLA100.2 rotor. The pellets were washed twice by successive resuspension and centrifugation steps in 50 mmTris, pH 7.4, 5 mm MgCl2, 1 mm DTT, 40 mm 6-amino-n-hexanoic acid, and 20% glycerol. Stripped vesicles and F1-ATPase dissolved in this buffer were mixed to give final protein concentrations of 0.5 mg/ml and 3.0 mg/ml, respectively, and incubated at 22 °C for 4 h. The enzyme was pelleted at 175,000 × g for 30 min at 4 °C in a Beckman TLA100.2 rotor and washed twice by successive resuspension and centrifugation steps in 50 mm MOPS, pH 7.0, 2 mm MgCl2, and 10% glycerol. Atebrin fluorescence quenching activities were assayed as described by Hatch et al. (24Hatch L. Fimmel A.L. Gibson F. Biochim. Biophys. Acta. 1993; 1141: 183-189Crossref PubMed Scopus (6) Google Scholar). Protein concentrations were determined using the BCA protein assay from Pierce, with bovine serum albumin as standard. F1-ATPase was prepared from membranes of strain AN1460 (25Downie J.A. Langman L. Cox G.B. Yanofsky C. Gibson F. J. Bacteriol. 1980; 143: 8-17Crossref PubMed Google Scholar) as described by Wiseet al. (26Wise J.G. Latchney L.R. Ferguson A.M. Senior A.E. Biochemistry. 1984; 23: 1426-1432Crossref PubMed Scopus (61) Google Scholar) and modified by Gogol et al. (27Gogol E.P. Lücken U. Bork T. Capaldi R.A. Biochemistry. 1989; 28: 4709-4716Crossref PubMed Scopus (72) Google Scholar). Strains used for the preparation of inner membranes and of F1F0-ATPase were grown in minimal medium with supplements (28Gibson F. Cox G.B. Downie J.A. Radik J. Biochem. J. 1977; 164: 193-198Crossref PubMed Scopus (51) Google Scholar). Studies reported here involve three new mutants in which residues Ser-84, Ala-144, and Leu-156 are each replaced by Cys. Previous studies had established that a Cys at position 146 can form cross-links with both the corresponding residue of its b-subunit pair and the δ-subunit (10Rodgers A.J.W. Wilkens S. Aggeler R. Morris M.B. Howitt S.M. Capaldi R.A. J. Biol. Chem. 1997; 272: 31058-31064Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). The implication is that the C-terminal region of the b-subunit is involved in binding to the F1. It was of interest therefore to examine a mutant with a Cys at the very C terminus of the b-subunit. Residue 144 lies on the opposite face of a predicted α-helix which is continuous with that formed by a hydrophobic patch (residues 124 to 131). This patch is known to be important for dimer formation (16Howitt S.M. Rodgers A.J.W. Jeffrey P.D. Cox G.B. J. Biol. Chem. 1996; 271: 7038-7042Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). Residue 84 is within a putative β-turn (residues 82–85) that is sensitive to tryptic digestion (10Rodgers A.J.W. Wilkens S. Aggeler R. Morris M.B. Howitt S.M. Capaldi R.A. J. Biol. Chem. 1997; 272: 31058-31064Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar) and is one of the few regions not predicted to be α-helical. The CuCl2 dependence of cross-linking of reconstituted ECF1F0 from the mutant bL156C is shown in Fig. 1 a. Monomeric subunit b disappeared after incubation with 50 μm CuCl2into two competing products with approximate M r70,000 and 38,000, respectively. Analysis by Western blotting showed that both of these products contained b-subunit and that theM r 70,000 band also contained α-subunit (see Fig. 1 b). Additional evidence that theM r 70,000 band consists of b cross-linked to α was obtained by excising the cross-link product from the gel, incubating the band in loading buffer containing DTT, and then identifying the components by SDS-PAGE in a second dimension (see Fig. 1 c). Previous studies have established that only one of the four Cys residues in the α-subunit can be labeled withN-ethylmaleimide, and this is αCys90 (11Ogilvie I. Aggeler R. Capaldi R.A. J. Biol. Chem. 1997; 272: 16652-16656Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). The other three Cys residues are buried within the protein and are not expected to be available for interaction with the b-subunit. The α-b cross-link, therefore, almost certainly forms between αCys90 and bCys156. TheM r 38,000 band is a dimer of the b-subunit based on antibody binding as well as on molecular weight considerations. Table I lists the effect of cross-linking from the Cys at position 156 on the ATPase activity of the purified enzyme. Essentially full cross-linking of b-subunits into dimers or b-α caused no more than 15% inhibition of activity (Table I).Table IEffect of subunit b mutations on growth and ATPase activitiesMutantGrowth on succinateATPase activity of reconstituted F1F0Inhibition of ATPase activity after maximal cross-linkingμmol/min/mg%bS84C++++23.415bA144C++++27.15bL156C++13.319 Open table in a new tab To establish more directly that Cys-156 of b is interacting with Cys-90 of α, a reconstitution experiment was conducted using F0from the mutant bL156C along with ECF1 isolated from the mutant αC90A. Rebinding of wild-type or mutant F1 to membranes containing F0 from the bL156C mutant reconstituted a functional ECF1F0. Cross-linking of these reassembled enzyme preparations by CuCl2 treatment is shown in Fig. 2. Rebinding of wild-type ECF1 led to cross-links between α and b as well as generation of the b-dimer (Fig. 2, lane 2) as in the experiments in Fig. 1. An α-δ cross-link occurs, migrating just above the α-b product, which is most likely produced in that fraction of ECF1 improperly bound back to the F0-containing membranes (it is not seen in intact ECF1F0; see Ref. 11Ogilvie I. Aggeler R. Capaldi R.A. J. Biol. Chem. 1997; 272: 16652-16656Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). No α-b cross-linking was observed in ECF1F0 reconstituted to contain the Cys at b156 but with the Cys at α90 absent (Fig. 2, lane 4). However b-dimer was obtained (note that b-dimer is present even in the absence of Cu2+, being formed during the reconstitution procedure). In the reconstituted mutant αC90A/bL156C enzyme, there is internal cross-linking within the δ-subunit, as seen previously, Ref. 11Ogilvie I. Aggeler R. Capaldi R.A. J. Biol. Chem. 1997; 272: 16652-16656Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Treatment of ECF1F0 from the mutant bA144C with CuCl2 at a concentration as low as 25 μm caused essentially full cross-linking of b-subunit into dimers (see Fig. 3). In the mutant bS84C, a concentration of 150 μm also gave high yields of cross-linking into dimers (result not shown). The essentially complete linkage of b-subunit into dimers at positions 84 or 144 had no major effect on ATPase activity (Table I). Cross-linking in the mutants bA144C and bL156C was examined in E. coli inner membranes so that effects on proton pumping activity could be measured more readily. Dimers of b-subunits were produced in both mutants, which could be detected with the monoclonal antibody to this subunit. Based on the disappearance of monomeric b-subunit, the yield of cross-link in membranes from the mutant bL156C was around 70% in the experiment shown in Fig. 4. However, the intensity of the cross-link products on the blots was not as high as expected for such a yield. This may be because the cross-linking affects the accessibility of the antibody for its epitope. Cross-linking of the mutant bA144C in E. coli inner membranes also gave a greater disappearance of monomeric b-subunit than appearance of dimeric cross-link products (result not shown). The effect of Cu2+-induced cross-linking on ATP-dependent proton pumping by the various mutants is shown in Fig. 5. With the mutants bS84C and bA144C, the effect on proton pumping was minimal (see Figs. 5,a and b). Proton pumping was reduced in bL156C, consistent with the lower growth rate of this strain on succinate (see Table I). Either the mutation itself or a small amount of cross-linking between α and b in the absence of added Cu2+ makes the membranes leaky to protons. Cross-linking by addition of Cu2+ further diminished the function of the mutant bL156C (Fig. 5 c). DTT treatment reversed the cross-linking-induced inhibition, confirming that it was the disulfide bond formation that was affecting function and not the effect of Cu2+ on other membrane components. Proton-translocating activity was not recovered completely on addition of DTT, possibly because of poor accessibility of the reductant to the disulfide bond in the bL156C mutant. We have seen similar variations in accessibility of disulfide bridges to DTT in our previous cross-linking studies. An important new result of the present study is that the b-subunit with a Cys at position 156 forms a cross-link with an α-subunit at αCys90. This Cys lies in the N-terminal domain of the α-subunit, the portion of F1 most distant from the membrane. Therefore, the b-subunits must extend from the bilayer all of the way to the top of ECF1. Previously, we found that a Cys at position 146 of the b-subunit reacts with the δ-subunit (10Rodgers A.J.W. Wilkens S. Aggeler R. Morris M.B. Howitt S.M. Capaldi R.A. J. Biol. Chem. 1997; 272: 31058-31064Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). This is additional evidence that b-subunits run the length of the F1F0 because the δ-subunit has itself been shown to lie at the top of the F1 part (11Ogilvie I. Aggeler R. Capaldi R.A. J. Biol. Chem. 1997; 272: 16652-16656Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 29Lill H. Hensel F. Junge W. Engelbrecht S. J. Biol. Chem. 1996; 271: 32737-32742Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). The accumulated cross-linking data indicate that residues Cys-2 and Cys-90 of the α-subunit, Cys-140 of the δ-subunit, and Cys-156 of the b-subunits must be in close proximity. Presumably, δCys140 and bCys156 are not properly oriented for their interaction. From the x-ray crystal structure, the distance from αCys90 to the bottom of the globular sphere of F1 is approximately 65 Å, whereas electron microscopy reveals the central stalk to be about 45 Å in length (see Ref. 3Gogol E.P. Lücken U. Capaldi R.A. FEBS Lett. 1987; 219: 274-278Crossref PubMed Scopus (96) Google Scholar). The b-subunits must therefore extend at least 110 Å from the bilayer. The cytosolic domain of the b-subunit, composed of some 125 residues, is predicted from circular dichroism measurements and structural assessment algorithms to be overwhelmingly α-helical. In all, 80 amino acids would be required to traverse the expected distance in a continuous α-helix. However, the strong prediction of a turn around residues 82–85 implies that a continuous α-helix extending from the membrane to the top of F1 is unlikely. A second important observation is that b-subunit with a Cys at positions 84, 144, or 156 in each case forms a homodimer. Taken together with our previous data and the studies of McLachlin and Dunn (17McLachlin D.T. Dunn S.D. J. Biol. Chem. 1997; 272: 21233-21239Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar) and Sorgen et al. (30Sorgen P.L. Bubb M.R. McCormick K.A. Edison A.S. Cain B.D. Biochemistry. 1998; 37: 923-932Crossref PubMed Scopus (47) Google Scholar), the evidence is that the b-subunit is a dimer for its entire length. Mutational analysis by Howitt et al. (16Howitt S.M. Rodgers A.J.W. Jeffrey P.D. Cox G.B. J. Biol. Chem. 1996; 271: 7038-7042Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar) clearly established that residues 124 to 131 are α-helical and form a hydrophobic patch important for dimer formation. This α-helix has been proposed to continue to at least residue 139 (17McLachlin D.T. Dunn S.D. J. Biol. Chem. 1997; 272: 21233-21239Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Sorgen et al. (30Sorgen P.L. Bubb M.R. McCormick K.A. Edison A.S. Cain B.D. Biochemistry. 1998; 37: 923-932Crossref PubMed Scopus (47) Google Scholar) found that Ala-79 is also critical for dimer formation. In this work, we show that mutants with Cys at both positions 144 and 146 readily form dimers, and cross-linking does not affect ATPase activity or ATP-dependent proton pumping. If this region is α-helical, these residues would fall on opposite faces of the helix. There must therefore be significant flexibility in this portion of the protein that, when limited by cross-linking, does not affect catalysis. The alternative interpretation of the cross-linking data is that the region around residues 144–146 adopts a structure other than α-helix. Higher resolution structural data on the b-subunit than are available now will be needed to decide between these possibilities. Cross-linking of the two b-subunits to one another, of a b-subunit to an α-subunit or of the δ-subunit to an α-subunit (as reported before) does not block cooperative, multisite ATPase activity. This is in contrast to α to β, α to ε, β to ε, α to γ, and β to γ cross-links, all of which block this activity essentially fully (see Ref. 11Ogilvie I. Aggeler R. Capaldi R.A. J. Biol. Chem. 1997; 272: 16652-16656Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). The lack of effect on ATP hydrolysis would be anticipated if the two b-subunits and the δ-subunit together form the second stalk, a stator connecting F1 to the F0. Cross-links through Cys residues introduced at any position up to residue 146 of the b-subunit were found to have little effect on proton pumping. In contrast, cross-linking in the mutant bL156C inhibited proton pumping markedly, an effect reversed by breaking the disulfide bond with DTT. As described already, this mutant forms a cross-link with the α-subunit. It may, therefore, be the b-α cross-link rather than the b-b cross-link that uncouples ATP hydrolysis from proton movements through the F0. The torque generated by rotation of the γ-ε domain within the α3β3hexamer could require compensation by way of conformational flexibility in the connection between the second stalk and F1. Based on the results here, such flexibility would be in interactions at the very C terminus of the b-subunit only, e.g. in its interactions with the α-subunit. Using genetic approaches, Takeyama et al. (31Takeyama M. Noumi T. Maeda M. Futai M. J. Biol. Chem. 1988; 263: 16106-16112Abstract Full Text PDF PubMed Google Scholar) also found a critical role for the very C terminus of the b-subunit. Removal of this single residue caused significant reduction of both F1 binding and proton translocation, whereas the loss of two or more residues from the C terminus abolished both activities completely. In summary, we add to the evidence that the b-subunits, along with the δ-subunit, form a second stalk connecting the F1 and F0 parts of the ATP synthase. Cross-linking has been observed between α and b which does not affect ATPase activity but inhibits proton pumping, presumably by disrupting the F1subunit b interface. The expert technical assistance of Kathy Chicas-Cruz is gratefully acknowledged.