Portal de Periódicos da CAPES

Expression of the Extracellular Domain of the Thyrotropin Receptor in the Baculovirus System Using a Promoter Active Earlier than the Polyhedrin Promoter

1995; Elsevier BV; Volume: 270; Issue: 4 Linguagem: Inglês

10.1074/jbc.270.4.1543

1083-351X

Gregorio D. Chazenbalk, Basil Rapoport,

Viral Infectious Diseases and Gene Expression in Insects

Conventional baculovirus vectors that utilize the very late polyhedrin promoter have not proved successful for expressing a thyrotropin (TSH) receptor capable of ligand and Graves' disease autoantibody binding comparable to the receptor produced in mammalian cells. Because of the clinical importance of high level expression of this protein, we reassessed the baculovirus system using a new transfer vector (pAcMP3) containing the late basic protein promoter, which functions earlier than the classical polyhedrin promoter. Maximal synthesis of the [35S]methionine-labeled TSH receptor extracellular domain, affinity-purified using a 6-histidine tag, occurred earlier (1 day after insect cell infection) than with a vector (pVL1393) containing the polyhedrin promoter. The pAcMP3-derived TSH receptor extracellular domain was larger (∼68 kDa) than the pVL1393-derived protein (∼63 kDa). Only the 68-kDa product was secreted, albeit in trace amounts detectable only by precursor labeling. Enzymatic deglycosylation reduced both 68- and 63-kDa cellular proteins to ∼54 kDa, indicating that the pAcMP3 vector generated a protein with greater carbohydrate content. However, despite its greater degree of glycosylation, most of the 68-kDa protein remained within the cell, almost entirely in the particulate fraction. Remarkably, the trace amounts of 68-kDa receptor protein affinity-purified from the soluble cytosolic fraction of infected insect cells completely neutralized TSH receptor autoantibodies in patients' sera and partly inhibited TSH binding.In conclusion, a baculovirus vector with a promoter active earlier than the conventional polyhedrin promoter generates a more glycosylated and functional TSH receptor extracellular domain protein, albeit at low levels. These data carry important implications for the expression by baculovirus vectors of functional, highly glycosylated proteins. Conventional baculovirus vectors that utilize the very late polyhedrin promoter have not proved successful for expressing a thyrotropin (TSH) receptor capable of ligand and Graves' disease autoantibody binding comparable to the receptor produced in mammalian cells. Because of the clinical importance of high level expression of this protein, we reassessed the baculovirus system using a new transfer vector (pAcMP3) containing the late basic protein promoter, which functions earlier than the classical polyhedrin promoter. Maximal synthesis of the [35S]methionine-labeled TSH receptor extracellular domain, affinity-purified using a 6-histidine tag, occurred earlier (1 day after insect cell infection) than with a vector (pVL1393) containing the polyhedrin promoter. The pAcMP3-derived TSH receptor extracellular domain was larger (∼68 kDa) than the pVL1393-derived protein (∼63 kDa). Only the 68-kDa product was secreted, albeit in trace amounts detectable only by precursor labeling. Enzymatic deglycosylation reduced both 68- and 63-kDa cellular proteins to ∼54 kDa, indicating that the pAcMP3 vector generated a protein with greater carbohydrate content. However, despite its greater degree of glycosylation, most of the 68-kDa protein remained within the cell, almost entirely in the particulate fraction. Remarkably, the trace amounts of 68-kDa receptor protein affinity-purified from the soluble cytosolic fraction of infected insect cells completely neutralized TSH receptor autoantibodies in patients' sera and partly inhibited TSH binding. In conclusion, a baculovirus vector with a promoter active earlier than the conventional polyhedrin promoter generates a more glycosylated and functional TSH receptor extracellular domain protein, albeit at low levels. These data carry important implications for the expression by baculovirus vectors of functional, highly glycosylated proteins. INTRODUCTIONThe TSH 1The abbreviations used are: TSHthyrotropinNi-NTAnickel-nitrilotriacetic acidCHOChinese hamster ovary. receptor is the primary autoantigen in Graves' disease, one of the most common human autoimmune diseases (reviewed in (1Rees Smith B. McLachlan S.M. Furmaniak J. Endocr. Rev. 1988; 9: 106-121Crossref PubMed Scopus (527) Google Scholar)). Large amounts of conformationally intact TSH receptor protein are a fundamental requirement for future diagnostic and therapeutic approaches to this disease. Generating a functional TSH receptor in stably transfected eukaryotic cells has been straightforward (reviewed in (2Nagayama Y. Rapoport B. Mol. Endocrinol. 1992; 6: 145-156Crossref PubMed Scopus (151) Google Scholar)). However, the amount of receptor protein produced by these cells is insufficient for purification. There has also been no difficulty in expressing large amounts of the TSH receptor extracellular domain in prokaryotic cells(3Takai O. Desai R.K. Seetharamaiah G.S. Jones C.A. Allaway G.P. Akamizu T. Kohn L.D. Prabhakar B.S. Biochem. Biophys. Res. Commun. 1991; 179: 319-326Crossref PubMed Scopus (75) Google Scholar, 4Huang G.C. Collison K.S. McGregor A.M. Banga J.P. J. Mol. Endocrinol. 1992; 8: 137-144Crossref PubMed Scopus (35) Google Scholar, 5Loosfelt H. Pichon C. Jolivet A. Misrahi M. Caillou B. Jamous M. Vannier B. Milgrom E. Proc. Natl. Acad. Sci. U. S. A. 1992; 895: 3765-3769Crossref Scopus (175) Google Scholar, 6Harfst E. Johnstone A.P. Nussey S.S. J. Mol. Endocrinol. 1992; 9: 227-236Crossref PubMed Scopus (43) Google Scholar). 2G. D. Chazenbalk and B. Rapoport, unpublished data. However, in this case, most of the protein is present in inclusion bodies, and attempts at renaturation have failed to produce protein capable of specific binding by TSH and TSH receptor autoantibodies(3Takai O. Desai R.K. Seetharamaiah G.S. Jones C.A. Allaway G.P. Akamizu T. Kohn L.D. Prabhakar B.S. Biochem. Biophys. Res. Commun. 1991; 179: 319-326Crossref PubMed Scopus (75) Google Scholar, 4Huang G.C. Collison K.S. McGregor A.M. Banga J.P. J. Mol. Endocrinol. 1992; 8: 137-144Crossref PubMed Scopus (35) Google Scholar).For the past 4 years, the baculovirus system (7Summers M.D. Smith G.E. A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures. Texas A & M University, College Station, TX1987Google Scholar) has been viewed as a promising solution to this dilemma. Unlike in prokaryotes, proteins expressed in insect cells are glycosylated, albeit not identically to eukaryotic cells. However, all attempts to generate the full-length TSH receptor in the baculovirus system failed(8Harfst E. Johnstone A.P. Gout I. Taylor A.H. Waterfield M.D. Nussey S.S. Mol. Cell. Endocrinol. 1992; 83: 117-123Crossref PubMed Scopus (42) Google Scholar, 9Huang G.C. Page M.J. Nicholson L.B. Collison K.S. McGregor A.M. Banga J.P. J. Mol. Endocrinol. 1993; 10: 127-142Crossref PubMed Scopus (75) Google Scholar). 3B. Rapoport, unpublished data. Efforts then focused on the TSH receptor extracellular domain (9Huang G.C. Page M.J. Nicholson L.B. Collison K.S. McGregor A.M. Banga J.P. J. Mol. Endocrinol. 1993; 10: 127-142Crossref PubMed Scopus (75) Google Scholar, 10Seetharamaiah G.S. Desai R.K. Dallas J.S. Tahara K. Kohn L.D. Prabhakar B.S. Autoimmunity. 1993; 14: 315-320Crossref PubMed Scopus (67) Google Scholar) because of the importance of this region in TSH and TSH receptor autoantibody binding (reviewed in (2Nagayama Y. Rapoport B. Mol. Endocrinol. 1992; 6: 145-156Crossref PubMed Scopus (151) Google Scholar)). Again, despite much effort, the general experience using conventional baculovirus vectors with the very late polyhedrin promoter has been frustrating. A number of laboratories, including our own, failed to produce functional protein (5Loosfelt H. Pichon C. Jolivet A. Misrahi M. Caillou B. Jamous M. Vannier B. Milgrom E. Proc. Natl. Acad. Sci. U. S. A. 1992; 895: 3765-3769Crossref Scopus (175) Google Scholar) or have not reported their data. Others have described the generation of receptor protein incapable of physiological, high affinity ligand binding (9Huang G.C. Page M.J. Nicholson L.B. Collison K.S. McGregor A.M. Banga J.P. J. Mol. Endocrinol. 1993; 10: 127-142Crossref PubMed Scopus (75) Google Scholar, 10Seetharamaiah G.S. Desai R.K. Dallas J.S. Tahara K. Kohn L.D. Prabhakar B.S. Autoimmunity. 1993; 14: 315-320Crossref PubMed Scopus (67) Google Scholar) even after attempts at protein renaturation(11Seetharamaiah G.S. Kurosky A. Desai R.K. Dallas J.S. Prabhakar B.S. Endocrinology. 1994; 134: 549-554Crossref PubMed Scopus (73) Google Scholar).In this study, we have attempted to express a functional TSH receptor using a baculovirus vector with the late basic protein promoter. This promoter is active earlier than the very late polyhedrin promoter, which functions at a time when expression of the enzymes involved in post-translational protein modification is suppressed(12Gruenwald S. Heitz J. Baculovirus Expression Vector System: Procedures and Methods Manual. Pharmingen, San Diego, CA1993Google Scholar). In contrast to experience with conventional baculovirus vectors, we generated a more highly glycosylated, soluble, and functional TSH receptor, although with a very low yield. These data carry important implications for the expression by baculovirus vectors of functional highly glycosylated proteins.MATERIALS AND METHODSTruncation of the 5′-Untranslated Region of the TSH Receptor cDNAFalse ATG initiation codons in frame with a stop codon in the 5′-untranslated region of the TSH receptor were removed by generating a 0.23-kilobase fragment of the TSH receptor by the polymerase chain reaction (13Saiki R.K. Gelfand D.N. Stoffel S. Scharf S.J. Higuchi R. Horn G.T. Mullis K.B. Erlich H.A. Science. 1988; 239: 487-491Crossref PubMed Scopus (13400) Google Scholar) using the pBS-hTSHR-mod cDNA (14Nagayama Y. Wadsworth H.L. Chazenbalk G.D. Russo D. Seto P. Rapoport B. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 902-905Crossref PubMed Scopus (184) Google Scholar) as template. The upstream primer (with SalI and EcoRI restriction sites) was 5′TAAGTCGACGAATTCCCCGAGTCCCGTGGAAAATGAGG, and the downstream primer (with an SnaBI site) was 5′-ATCTATAGATACGTAGATTCTGGA. The polymerase chain reaction was performed using Pfu DNA polymerase (Stratagene, La Jolla, CA). The 0.23-kilobase fragment was restricted with SalI and SnaBI and used to replace the same fragment in the full-length TSH receptor cDNA in pSV2-NEO-ECE-TSHR(14Nagayama Y. Wadsworth H.L. Chazenbalk G.D. Russo D. Seto P. Rapoport B. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 902-905Crossref PubMed Scopus (184) Google Scholar). The nucleotide sequence was confirmed by the dideoxynucleotide termination method(15Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52361) Google Scholar).Baculovirus Expression Vector ConstructionA cassette formed by two oligonucleotides (5′-CTAGTGGGAGGTGGACATCACCATCACCATCACTGATAATCTA and 5′-GATCTAGATTATCAGTGATGGTGATGGTGATGTCCACCTCCCA) was used to introduce 3 glycine and 6 histidine residues followed by two stop codons at the carboxyl terminus of the 420-amino acid residue TSH receptor extracellular domain (including the signal peptide). This cassette was inserted into the SpeI and BglII sites in the modified human TSH receptor cDNA in pBluescript (pBS-hTSHR-mod)(14Nagayama Y. Wadsworth H.L. Chazenbalk G.D. Russo D. Seto P. Rapoport B. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 902-905Crossref PubMed Scopus (184) Google Scholar). The 1.6-kilobase MluI-XbaI fragment including the 6-His cassette was excised and used to replace the corresponding fragment of the modified pSV2-NEO-ECE-TSHR (see above). From this plasmid, the 1.3-kilobase TSH receptor extracellular domain cDNA with the 6-His tag was released with EcoRI and BglII and subcloned into the same sites in the baculovirus transfer vectors pAcMP3 and pVL1393 (Pharmingen, San Diego, CA) to generate the plasmids pAcMP3-TSHR-EX-6H and pVL1393-TSHR-EX-6H, respectively.Expression of TSH Receptor Extracellular Domain (TSHR-EX-6H) ProteinPurified pAcMP3-TSHR-EX-6H or pVL1393-TSHR-EX-6H plasmid (2 μg) was cotransfected with 0.5 μg of BaculoGold viral DNA (Pharmingen) according to the protocol of the manufacturer. Monolayers of Sf9 insect cells were cultured at 27°C in Hink's medium with 10% heat-inactivated fetal calf serum. After 5 days of incubation, the virus in the supernatant was titered, and individual plaques were isolated and amplified 2-4 times using Sf9 cell suspensions (Pharmingen)(16O'Reilly D.R. Miller L.K. Luckow V.A. Baculovirus Expression Vectors: A Laboratory Manual. W. H. Freeman & Co., New York1992Google Scholar). TSHR-EX-6H protein was generated by infecting Sf9 or High Five insect cells (Pharmingen) in monolayer for different periods of time as indicated in the text for individual experiments. Infections were performed with viral stocks of 0.5-2 × 108 plaque-forming units/ml at multiplicities of infection of 10-20 plaque-forming units/cell.To generate radiolabeled TSH receptor, infected cells in 25-cm2 flasks were preincubated for 4 h in Ex-Cell 401 methionine-free medium (JRH Biosciences, Lenexa, KS). The medium was then replaced with the same medium (1.5 ml) containing 100-250 μCi of [35S]methionine (>1000 Ci/mmol; DuPont NEN). After a 4-h pulse, the medium was removed, and the cells were rinsed once and then either lysed or a chase was performed for ∼16 h in Hink's medium. Intact cells were lysed directly in 1.5 ml of 8 M urea, 0.1 M sodium phosphate, 0.01 M Tris, pH 8.0, and centrifuged for 5 min in a microcentrifuge, and the supernatant was retained.The distribution of the [35S]methionine-labeled TSH receptor between the particulate and cytosolic fractions of the cells was determined by a modification of the above approach, using guanidine to dissolve the insoluble fraction. After infection and labeling (see above), the Sf9 cells were resuspended in 1.5 ml of 0.05 M sodium phosphate buffer containing phenylmethylsulfonyl fluoride (100 μg/ml), leupeptin (1 μg/ml), aprotinin (1 μg/ml), and pepstatin A (2 μg/ml) (all from Sigma). The cells were disrupted by two freeze-thaw cycles and centrifuged (4°C) for 60 min at 100,000 × g. The supernatant was retained, and the pellet was dissolved in 6 M guanidine HCl, 0.1 M sodium phosphate, 0.01 M Tris, pH 8.0.Larger scale preparations of soluble TSH receptor protein were made in the same manner, except that the cells were not pulsed with [35S]methionine, and we used High Five insect cells in 175-cm2 flasks. These cells were cultured in serum-free Ex-Cell 400 medium (JRH Biosciences).Nickel Chelate Column Purification of the TSH Receptor ProteinAffinity purification of [35S]methionine-labeled TSHR-EX-6H from (i) urea-solubilized intact cells, (ii) culture medium following chase (secreted protein), (iii) the cytosolic fraction of disrupted cells, and (iv) the guanidine-solubilized particulate fraction of disrupted cells was performed by adding 50 μl of a 50% slurry of Ni-NTA resin (QIAGEN Inc., Chatsworth, CA) to 1.5 ml of these solutions. After mixing for 60 min at room temperature, the resin was washed three times with 1 ml of buffer B (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris, pH 6.3), and protein was released with 40 μl of buffer B containing 0.1 M EDTA. Aliquots (20 μl) in Laemmli buffer (17Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (206048) Google Scholar) containing 0.7 M β-mercaptoethanol were electrophoresed on SDS-polyacrylamide gels, followed by autoradiography (XAR-5 film, Eastman Kodak Co.).Larger scale purification of nonradioactive soluble protein involved the addition of 0.5 ml of resin slurry to 10-20 ml of High Five cell cytosolic proteins (see above). The resin was poured into a column and rinsed with 20 volumes of 0.05 M phosphate buffer, pH 7.4, followed by the same volume of 0.05 M phosphate buffer, pH 6.3. Protein was eluted in two steps with phosphate buffer, pH 5.9 and 4.5 (10 ml each), and immediately neutralized to pH 7.0. Both eluted fractions were pooled and concentrated by Centriprep-30 (Amicon, Inc., Beverly, MA) to ∼0.7 ml.Enzymatic Deglycosylation of TSHR-EX-6H ProteinFollowing Ni-NTA affinity purification, radiolabeled samples (∼10 μl in buffer B with 0.1 M EDTA) were added to 0.25 ml of 0.05 M sodium phosphate buffer, pH 7.4, containing 25 mM EDTA, 1% SDS, 1%β-mercaptoethanol, and 0.5% Nonidet P-40. Samples were incubated for 16 h at 37°C with 2 units of endoglycosidase F (Boehringer Mannheim) and then subjected to SDS-polyacrylamide gel electrophoresis, followed by autoradiography.Effect of TSHR-EX-6H Protein on 125I-TSH BindingRadiolabeled TSH binding to the wild-type human TSH receptor stably expressed on the surface of Chinese hamster ovary cells in monolayer culture was performed as described previously (18Chazenbalk G.D. Nagayama Y. Russo D. Wadsworth H.L. Rapoport B. J. Biol. Chem. 1990; 265: 20970-20975Abstract Full Text PDF PubMed Google Scholar) with the following modifications. Dilutions of affinity-purified TSHR-EX-6H in 0.05 M sodium phosphate buffer, pH 7.4, were prepared (see "Results"). Fifty μl of each dilution was preincubated for 1 h at room temperature with ∼10,000 cpm 125I-TSH in 450 μl of TSH binding buffer(18Chazenbalk G.D. Nagayama Y. Russo D. Wadsworth H.L. Rapoport B. J. Biol. Chem. 1990; 265: 20970-20975Abstract Full Text PDF PubMed Google Scholar). Aliquots (230 μl) were then added to the CHO cells for 8 h at 4°C, and the cells were then processed as described previously(18Chazenbalk G.D. Nagayama Y. Russo D. Wadsworth H.L. Rapoport B. J. Biol. Chem. 1990; 265: 20970-20975Abstract Full Text PDF PubMed Google Scholar). Specific TSH binding was calculated by subtraction of nonspecific binding in the presence of 10−6M TSH (2-5% of total counts).TSH Receptor Autoantibody Neutralization by TSHR-EX-6H ProteinA standard TSH binding inhibition assay (19Filetti S. Foti D. Costante G. Rapoport B. J. Clin. Endocrinol. & Metab. 1991; 72: 1096-1101Crossref PubMed Scopus (62) Google Scholar, 20Nagayama Y. Wadsworth H.L. Russo D. Chazenbalk G.D. Rapoport B. J. Clin. Invest. 1991; 88: 336-340Crossref PubMed Scopus (144) Google Scholar) was used, with the addition of a preincubation step to test for autoantibody neutralization. IgG was prepared from the sera of patients containing TSH receptor autoantibodies by ammonium sulfate precipitation; dialyzed against 10 mM phosphate buffer, pH 7.4; and diluted to 1.5 mg/ml in TSH binding buffer (see above). Dilutions of affinity-purified TSHR-EX-6H protein (50 μl each) were added to 450 μl of IgG in TSH binding buffer and preincubated for 1 h at room temperature. The mixture was then added to the CHO TSH receptor cells for 8 h at 4°C. The IgG/TSHR-EX-6H mixture was removed, the cells were rinsed once with 1 ml of ice-cold TSH binding buffer, and ∼10,000 cpm 125I-TSH in 0.25 ml of TSH binding buffer was added for 12-16 h at 4°C. Specifically bound TSH was then determined as described above.RESULTSTSH Receptor Extracellular Domain Expression in Intact Insect CellsWe approached the problem of high level expression of a functional TSH receptor extracellular domain by using a new baculovirus transfer vector (pAcMP3) with a late basic protein promoter active at an earlier stage than the conventional very late polyhedrin promoter. After removing the 5′-untranslated region, we inserted the cDNA for the TSH receptor extracellular domain into the pAcMP3 transfer vector and generated by homologous recombination the baculovirus pAcMP3-TSHR-EX-6H. This cDNA (TSHR-EX-6H) encodes the first 420 amino acid residues of the TSH receptor followed by a 3-Gly spacer and a 6-His tag at its 3′-end.Ten individual viral plaques were selected for protein expression in Sf9 insect cells. [35S]Methionine-labeled proteins extracted from intact cells with 6 M urea buffer were subjected to Ni-NTA affinity purification. Relative to control cells infected with baculovirus without the TSH receptor cDNA, all 10 TSHR-EX-6H clones expressed (9/10 strongly) a labeled protein of ∼68 kDa (Fig. 1). Typically, in different experiments, a protein of smaller size (∼63 kDa) and variable intensity was also affinity-purified with the Ni-NTA resin (Fig. 1). Consistent with the relatively uniform levels of expression by most of the individual clones, the signal with the uncloned viral stock (viral "pool") was similar to that of the clones. All subsequent experiments with the pAcMP3-TSHR-EX-6H construct were performed with viral stock amplified from clone 2.The time course of radiolabeled TSHR-EX-6H protein expression in intact Sf9 cells was determined. Consistent with the time of activity of the basic protein promoter, the major 68-kDa band, affinity-purified by Ni-NTA chromatography, was apparent only after 1 day of infection with the pAcMP3-TSHR-EX-6H virus (Fig. 2). For comparison, insect cells were infected with virus generated by the same TSH receptor cDNA in the transfer vector, pVL1393, with the standard very late polyhedrin promoter. In contrast to the earlier expression of labeled protein with the pAcMP3-TSHR-EX-6H virus, specific protein expression was maximal on the second post-infection day and was still evident 3 days after infection (Fig. 2). Of note, the cellular protein generated with the polyhedrin promoter was smaller (∼63 kDa) than the major protein generated under the influence of the basic protein promoter (∼68 kDa) (Fig. 2).Figure 2Left panel, time course of radiolabeled TSH receptor extracellular domain protein in insect cells. Sf9 cells were infected for up to 4 days with recombinant baculovirus generated either with the pAcMP3 (late basic protein promoter) or pVL1393 (very late polyhedrin promoter) transfer vector. Both transfer vectors contained the same cDNA insert (TSHR-EX-6H) coding for the TSH receptor extracellular region with a 6-His tag at its carboxyl-terminal end. Infected cells were pulsed for 4 h with [35S]methionine. Urea extracts of intact cells were subjected to Ni-NTA affinity purification, and aliquots were electrophoresed on a SDS-polyacrylamide gel under reducing conditions. Autoradiography was for ∼16 h. Right panel, comparison of the sizes of affinity-purified radiolabeled protein generated in Sf9 cells infected with the pAcMP3-TSHR-EX-6H and pVL1393-TSHR-EX-6H viruses. In this experiment, infections were for 1 and 2 days, respectively, prior to a 4-h pulse with [35S]methionine and extraction of intact cells with buffer containing 6 M urea (see "Materials and Methods"). Autoradiography was for 16 h.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Secretion of the TSH Receptor Extracellular Domain by Insect CellsAn extracellular protein that has traversed the secretory pathway is most likely to be correctly processed and folded. It was therefore important to determine whether the extracellular domain of the TSH receptor could be secreted by infected insect cells. For this purpose, Sf9 cells infected for 1-4 days were pulsed for 4 h with [35S]methionine. Medium harvested after a 16-h chase was subjected to affinity purification with Ni-NTA resin.Cells infected with virus generated with pAcMP3-TSHR-EX-6H did secrete recombinant protein into the culture medium, but only in very small amounts (Fig. 3). Autoradiograph exposures of weeks, rather than hours, were required for detection. A single protein of ∼68 kDa was present in the medium in maximal amounts after 1 day of infection, consistent with the time course of synthesis of cellular protein (Fig. 2). Mainly, degradation products were present in the medium 2-4 days post-infection. In contrast, no TSH receptor extracellular domain was detectable in the medium when insect cells were infected with baculovirus containing the polyhedrin promoter in the pVL1393-TSHR-EX-6H transfer vector (Fig. 3).Figure 3Secretion of the TSH receptor extracellular domain by insect cells. Sf9 cells were infected for 1-4 days with virus that had recombined with either the pAcMP3-TSHR-EX-6H or pVL1393-TSHR-EX-6H transfer vector. Cells were then pulsed for 4 h with [35S]methionine. Medium was harvested after a 16-h chase and subjected to affinity purification with Ni-NTA resin (see "Materials and Methods"). Aliquots of affinity-purified material were electrophoresed on a SDS-polyacrylamide gel under reducing conditions. Autoradiography was for 3 weeks.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Particulate and Cytosolic Distribution of the TSH Receptor Extracellular DomainThe very low level of secretion of TSH receptor extracellular domain protein by infected insect cells suggested that most of this protein was retained within the cells. Regardless of whether the pAcMP3- or pVL1393-derived virus was used, most of the affinity-purified, [35S]methionine-labeled TSH receptor protein was in the particulate fraction of the infected insect cells (Fig. 4). This material could not be solubilized with detergent (1% Triton X-100; data not shown). As seen with urea extracts of whole cells (Fig. 2), the major labeled protein obtained with the pAcMP3-derived virus (∼68 kDa) was larger than that obtained with the pVL1393-derived virus (∼63 kDa). Coomassie Blue staining of these proteins revealed a similar pattern (data not shown).Figure 4Particulate and cytosolic distribution of the TSH receptor extracellular domain in infected insect cells. Sf9 cells were infected with virus obtained by recombination with either the pAcMP3-TSHR-EX-6H or pVL1393-TSHR-EX-6H transfer vector. Infections were for 1 and 2 days, respectively. Cells were pulsed for 4 h with [35S]methionine, rinsed, and disrupted by freeze-thaw cycles (see "Materials and Methods"). The 100,000 × g supernatants and pellets were subjected to affinity purification with Ni-NTA resin, with elution in similar volumes (40 μl) (see "Materials and Methods"). Equal aliquots (∼18 μl) were electrophoresed on a SDS-polyacrylamide gel under reducing conditions. A, affinity-purified material from pAcMP3-TSHR-EX-6H-infected cells; B, affinity-purified material from pVL1393-TSHR-EX-6H-infected cells. In the middle lane, the particulate fraction was diluted 20-fold. Autoradiography in this representative experiment was for 2 days.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Enzymatic Deglycosylation of the TSH Receptor Extracellular DomainWe examined whether or not the different sizes of the TSH receptor extracellular domain generated in insect cells under the influence of the two different promoters (Fig. 2) could be explained by different degrees of glycosylation. This was indeed the case. Radiolabeled TSH receptor was affinity-purified with Ni-NTA resin and subjected to enzymatic deglycosylation with endoglycosidase F (see "Material and Methods"). The proteins generated by both the pAcMP3- and pVL1393-derived viruses were reduced to the same size, ∼54 kDa (Fig. 5).Figure 5Enzymatic deglycosylation of the TSH receptor extracellular domain. Sf9 insect cells were infected with virus obtained by recombination with either the pAcMP3-TSHR-EX-6H or pVL1393-TSHR-EX-6H transfer vector. Infections were for 1 and 2 days, respectively. Cells were pulsed for 4 h with [35S]methionine, proteins were extracted from the intact cells with buffer containing 6 M urea, and specific proteins were purified with Ni-NTA resin (see "Materials and Methods"). Aliquots were treated with endoglycosidase F (Endo F) for 16 h (see "Materials and Methods"), followed by electrophoresis on a SDS-polyacrylamide gel under reducing conditions. Autoradiography was for 4 days. Con, control.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Functional Activity of the TSH Receptor Extracellular Domain Generated in Insect CellsAlthough high levels of TSH receptor protein can be generated in insect cells under the influence of the very late polyhedrin promoter, this material is nonfunctional, or poorly functional, in terms of ligand and autoantibody binding (see above). Because of the greater extent of glycosylation of TSH receptor extracellular protein generated with the pAcMP3-derived virus, we tested the functional activity of this material. To generate larger amounts of unlabeled TSH receptor protein, we used High Five insect cells, which were more efficient in generating the protein than Sf9 cells (data not shown). Despite this greater efficiency, the yield with the pAcMP3 vector remained small. Typically, guanidine solubilization of 3 × 107 intact High Five cells yielded ∼20 μg of affinity-purified TSH receptor protein. Furthermore, the inability to remove urea from the eluting buffer without loss of solubility precluded testing the protein in a functional assay.We therefore tested for the presence of TSH receptor functional activity in affinity-purified soluble protein from the 100,000 × g supernatant of infected insect cells. Despite the fact that the yield of unlabeled TSH receptor extracellular domain was too low to quantitate, TSH binding activity was clearly observed in a standard radiolabeled TSH binding assay. Thus, the column eluate inhibited in a dose-dependent manner 125I-TSH binding to the wild-type TSH receptor expressed on the surface of CHO cells (Fig. 6). A 20-fold dilution of the eluate reduced TSH binding by ∼50%. Control affinity column buffer was without effect.