ATF-7, a Novel bZIP Protein, Interacts with the PRL-1 Protein-tyrosine Phosphatase
2001; Elsevier BV; Volume: 276; Issue: 17 Linguagem: Inglês
10.1074/jbc.m011562200
ISSN1083-351X
AutoresCharles S. Peters, Xianping Liang, Shuixing Li, Subburaj Kannan, Yong Peng, Rebecca Taub, Robert H. Diamond,
Tópico(s)PI3K/AKT/mTOR signaling in cancer
ResumoWe have identified a novel basic leucine zipper (bZIP) protein, designated ATF-7, that physically interacts with the PRL-1 protein-tyrosine phosphatase (PTPase). PRL-1 is a predominantly nuclear, farnesylated PTPase that has been linked to the control of cellular growth and differentiation. This interaction was initially found using the yeast two-hybrid system. ATF-7 is most closely related to members of the ATF/CREB family of bZIP proteins, with highest homology to ATF-4. ATF-7 homodimers can bind specifically to CRE elements. ATF-7 is expressed in a number of different tissues and is expressed in association with differentiation in the Caco-2 cell model of intestinal differentiation. We have confirmed the PRL-1·ATF-7 interaction and mapped the regions of ATF-7 and PRL-1 important for interaction to ATF-7's bZIP region and PRL-1's phosphatase domain. Finally, we have determined that PRL-1 is able to dephosphorylate ATF-7 in vitro. Further insight into ATF-7's precise cellular roles, transcriptional function, and downstream targets are likely be of importance in understanding the mechanisms underlying the complex processes of maintenance, differentiation, and turnover of epithelial tissues. We have identified a novel basic leucine zipper (bZIP) protein, designated ATF-7, that physically interacts with the PRL-1 protein-tyrosine phosphatase (PTPase). PRL-1 is a predominantly nuclear, farnesylated PTPase that has been linked to the control of cellular growth and differentiation. This interaction was initially found using the yeast two-hybrid system. ATF-7 is most closely related to members of the ATF/CREB family of bZIP proteins, with highest homology to ATF-4. ATF-7 homodimers can bind specifically to CRE elements. ATF-7 is expressed in a number of different tissues and is expressed in association with differentiation in the Caco-2 cell model of intestinal differentiation. We have confirmed the PRL-1·ATF-7 interaction and mapped the regions of ATF-7 and PRL-1 important for interaction to ATF-7's bZIP region and PRL-1's phosphatase domain. Finally, we have determined that PRL-1 is able to dephosphorylate ATF-7 in vitro. Further insight into ATF-7's precise cellular roles, transcriptional function, and downstream targets are likely be of importance in understanding the mechanisms underlying the complex processes of maintenance, differentiation, and turnover of epithelial tissues. It is clear that many cellular processes are regulated through protein phosphorylation. This post-translational modification is responsible for the control of a wide variety of important processes, including the regulation of metabolism, cell proliferation, the cell cycle, gene expression, protein synthesis, and cellular transport (1Hunter T. Cell. 1995; 80: 225-236Abstract Full Text PDF PubMed Scopus (2607) Google Scholar,2Karin M. Curr. Opin. Cell Biol. 1995; 6: 415-424Crossref Scopus (359) Google Scholar). Because phosphorylation is a dynamic and reversible process, it follows that phosphatases are as important as kinases in its regulation (3Tonks N.K. Neel B.G. Cell. 1996; 87: 365-368Abstract Full Text Full Text PDF PubMed Scopus (495) Google Scholar, 4Fauman E.B. Saper M.A. Trends Biochem. Sci. 1996; 21: 413-417Abstract Full Text PDF PubMed Scopus (319) Google Scholar). Phosphorylation of transcription factors and their associated proteins is one of the principal methods used to regulate gene expression (1Hunter T. Cell. 1995; 80: 225-236Abstract Full Text PDF PubMed Scopus (2607) Google Scholar, 2Karin M. Curr. Opin. Cell Biol. 1995; 6: 415-424Crossref Scopus (359) Google Scholar, 5Boulikas T. Crit. Rev. Eukaryot. Gene Expr. 1995; 5: 1-77PubMed Google Scholar, 6Hunter T. Karin M. Cell. 1992; 70: 375-387Abstract Full Text PDF PubMed Scopus (1119) Google Scholar). Alterations in protein phosphorylation states bring about these changes in a number of different ways, including the regulation of subcellular localization (7Ghosh S. Baltimore D. Nature. 1990; 344: 678-682Crossref PubMed Scopus (909) Google Scholar, 8Darnell J.E. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3399) Google Scholar, 9Beals C.R. Clipstone N.A. Hu S.N. Crabtree G.R. Genes Dev. 1997; 11: 824-834Crossref PubMed Scopus (342) Google Scholar), changes in DNA binding (10Boyle W.J. Smeal T. Defize L.H. Angel P. Woodgett J.R. Karin M. Hunter T. Cell. 1991; 64: 573-584Abstract Full Text PDF PubMed Scopus (856) Google Scholar, 11Bourbon H.M. Martin-Blanco E. Rosen D. Kornberg T.B. Cell. 1995; 270: 11130-11139Google Scholar), or alterations in transactivating ability. Classic examples of this latter phenomenon include the basic leucine zipper (bZIP) 1The abbreviations used are: bZIPbasic leucine zipper proteinPTPaseprotein-tyrosine phosphataseCREcyclic-AMP response elementCREBCRE-binding proteinATFactivating transcription factorbpbase pair(s)C/EBPCCAAT enhancer-binding proteinGSTglutathione S-transferaseTKthymidine kinaseaaamino acid(s)PAGEpolyacrylamide gel electrophoresiskbkilobase(s) proteins CREB and c-Jun, where phosphorylation of specific residues in the transactivating domain has been demonstrated to up-regulate transactivation, probably by allowing interaction of these proteins with transcriptional coactivators such as CREB-binding protein (12Chrivia J.C. Kwok R.P.S. Lamb N. Hagiwara M. Montminy M.R. Goodman R.H. Nature. 1993; 365: 855-859Crossref PubMed Scopus (1770) Google Scholar,13Kwok R.P.S. Lundblad J.R. Chrivia J.C. Richards J.P. Bachinger H.P. Brennan R.G. Roberts S.G.E. Green M.R. Goodman R.H. Nature. 1994; 370: 223-226Crossref PubMed Scopus (1282) Google Scholar). Kinases or phosphatases may also, in some situations, bind transcription factors but influence transcription by acting on proteins other than the transcription factors themselves (7Ghosh S. Baltimore D. Nature. 1990; 344: 678-682Crossref PubMed Scopus (909) Google Scholar, 14Baskaran R. Dahmus M.E. Wang J.Y.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11167-11171Crossref PubMed Scopus (188) Google Scholar). An example of this phenomenon is the nuclear tyrosine kinase c-Abl, which binds to p53 and increases its transactivating ability without phosphorylating it. It is thought that Abl may be able to execute this function by phosphorylating the C-terminal domain of RNA polymerase II, which is known to be extensively phosphorylated on tyrosine (14Baskaran R. Dahmus M.E. Wang J.Y.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11167-11171Crossref PubMed Scopus (188) Google Scholar, 15Kharbanda S. Yuan Z.M. Weichselbaum R. Kufe D. Oncogene. 1998; 17: 3309-3318Crossref PubMed Scopus (153) Google Scholar). basic leucine zipper protein protein-tyrosine phosphatase cyclic-AMP response element CRE-binding protein activating transcription factor base pair(s) CCAAT enhancer-binding protein glutathione S-transferase thymidine kinase amino acid(s) polyacrylamide gel electrophoresis kilobase(s) The PRL-1 protein-tyrosine phosphatase (PTPase) was initially identified as an immediate-early response gene in regenerating liver and mitogen-stimulated fibroblasts (16Diamond R.H. Cressman D.E. Laz T.M. Abrams C.S. Taub R. Mol. Cell. Biol. 1994; 14: 3752-3762Crossref PubMed Scopus (248) Google Scholar). PRL-1 is a 20-kDa protein that contains the "signature" amino acid sequence for the active site of PTPases but otherwise does not contain regions of homology to any previously described protein (16Diamond R.H. Cressman D.E. Laz T.M. Abrams C.S. Taub R. Mol. Cell. Biol. 1994; 14: 3752-3762Crossref PubMed Scopus (248) Google Scholar). PRL-1 is primarily localized to the cell nucleus with a discrete, reproducible "speckled" pattern on immunofluorescence. Under certain circumstances, PRL-1 also is localized to extranuclear sites in the cell (17Kong W. Swain G.P. Li S. Diamond R.H. Am. J. Physiol. 2000; 279: G613-G621Crossref PubMed Google Scholar, 18Zeng Q. Si X. Horstmann H. Xu Y. Hong W. Pallen C.J. J. Biol. Chem. 2000; 275: 21444-21452Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar). PRL-1 is found in the insoluble cellular fraction, despite the fact that it is readily soluble when expressed in bacteria (16Diamond R.H. Cressman D.E. Laz T.M. Abrams C.S. Taub R. Mol. Cell. Biol. 1994; 14: 3752-3762Crossref PubMed Scopus (248) Google Scholar). This is likely a result of protein prenylation, because PRL-1 is a farnesylated protein (19Cates C.A. Michael R.L. Stayrook K.R. Harvey K.A. Burke Y.D. Randall S.K. Crowell P.L. Crowell D.N. Cancer Lett. 1996; 110: 49-55Crossref PubMed Scopus (191) Google Scholar). When PRL-1 was stably overexpressed in 3T3 fibroblasts, altered growth characteristics became apparent, including a faster doubling time, growth to a greater saturation density, altered morphology, and evidence of anchorage-independent growth manifested by the ability of these cells to grow in soft agar (16Diamond R.H. Cressman D.E. Laz T.M. Abrams C.S. Taub R. Mol. Cell. Biol. 1994; 14: 3752-3762Crossref PubMed Scopus (248) Google Scholar). Overexpression of PRL-1 in epithelial cells resulted in tumor formation in nude mice (19Cates C.A. Michael R.L. Stayrook K.R. Harvey K.A. Burke Y.D. Randall S.K. Crowell P.L. Crowell D.N. Cancer Lett. 1996; 110: 49-55Crossref PubMed Scopus (191) Google Scholar). PRL-1 is also significantly expressed in intestinal epithelia, and in contrast to PRL-1's expression pattern in liver, its expression is associated with cellular differentiation in the intestine. Specifically, PRL-1 is expressed in villus but not crypt enterocytes, and in differentiated, but not proliferating, Caco-2 cells (20Diamond R.H. Peters C. Jung S.P. Greenbaum L.E. Haber B.A. Silberg D.G. Traber P.G. Taub R. Am. J. Physiol. 1996; 271: G121-G129Crossref PubMed Google Scholar). Recently, PRL-1 protein was found to be expressed during development in a number of differentiating epithelial tissues (17Kong W. Swain G.P. Li S. Diamond R.H. Am. J. Physiol. 2000; 279: G613-G621Crossref PubMed Google Scholar). These results suggest that PRL-1 may have divergent roles in different tissues. It is an established feature of some growth response genes that they may play a role in terminal differentiation in some tissues (21Bar-Sagi D. Feramisco J.R. Cell. 1985; 42: 841-848Abstract Full Text PDF PubMed Scopus (569) Google Scholar, 22Benito M. Porras A. Nebreda A.R. Santos E. Science. 1991; 253: 565-568Crossref PubMed Scopus (141) Google Scholar, 23Cass L.A. Meinkoth J.L. Oncogene. 2000; 19: 924-932Crossref PubMed Scopus (51) Google Scholar, 24Celano P.C.M. Berchtold M. Mabry M. Carroll M. Sidransky D. Casero R.A. Lupu R. Cell Growth Differ. 1993; 4: 341-347PubMed Google Scholar, 25Yamaguchi-Iwai Y. Satake M. Murakami Y. Sakai M. Muramatsu M. Ito Y. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 8670-8674Crossref PubMed Scopus (65) Google Scholar). The apparently paradoxical dual roles may be explained by the availability of different substrates or cofactors in different cells, different kinetics of protein expression, or by the presence of scaffolding or anchoring proteins that may direct an enzyme to a different cellular location and different substrates (26Pawson T. Scott J.D. Science. 1997; 275: 2075-2080Crossref Scopus (1903) Google Scholar, 27Marshall C.J. Cell. 1995; 80: 179-185Abstract Full Text PDF PubMed Scopus (4239) Google Scholar). Significant insight into PRL-1's specific cellular functions and the reasons for its apparently varied expression pattern in different tissues may be derived from identification of PRL-1's substrates and other cellular partners. To that end, we performed a yeast two-hybrid screen using PRL-1 as bait. We have identified a novel protein that interacts with PRL-1. This protein, which we have designated ATF-7, is a novel bZIP protein most closely related to members of the ATF/CREB family. We have functionally confirmed that ATF-7 is a bZIP protein by showing that its homodimers specifically bind to cyclic AMP response (CRE) elements. We have confirmed the interaction of PRL-1 and ATF-7 using GST binding and coimmunoprecipitation assays, and we have mapped the sites of interaction to include PRL-1's phosphatase domain and ATF-7's bZIP domain. ATF-7 is expressed in a number of different tissues, and it is expressed in association with differentiation in the Caco-2 cell model of intestinal differentiation. Finally, we have determined that PRL-1 is able to dephosphorylate ATF-7 in vitro. It is likely that further insight into ATF-7's precise cellular roles, transcriptional function, and downstream targets will be of importance in understanding the mechanisms underlying the complex processes of maintenance, differentiation, and turnover of epithelial tissues. The N-terminal 132 amino acids of PRL-1 fused to the C terminus of the GAL4 DNA binding domain in the yeast expression vector pGBT9 (CLONTECH) was constructed from the full-length PRL-1 cDNA. This construct contains most of the full-length PRL-1 cDNA except for the C-terminal basic region and CCIQ farnesylation domain. The active site cysteine (Cys-104) was mutated to serine as previously described (C104S) (16Diamond R.H. Cressman D.E. Laz T.M. Abrams C.S. Taub R. Mol. Cell. Biol. 1994; 14: 3752-3762Crossref PubMed Scopus (248) Google Scholar). Use of active site cysteine-serine mutant PTPases to demonstrate binding of PTPases to other proteins is a well-established and validated method (28Sun H. Charles C.H. Lau L.F. Tonks N.K. Cell. 1993; 75: 487-493Abstract Full Text PDF PubMed Scopus (1027) Google Scholar, 29Garton A.J. Flint A.J. Tonks N.K. Mol. Cell. Biol. 1996; 16: 6408-6418Crossref PubMed Scopus (232) Google Scholar, 30Zhang S.H. Liu J. Koyabashi R. Tonks N.K. J. Biol. Chem. 1999; 274: 17806-17812Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). A 3T3-L1 adipocyte library was synthesized from fully differentiated adipocytes with a cDNA synthesis kit (Stratagene) and constructed in the pGAD-10 GAL4 vector (CLONTECH) (gift of Dr. Alan Saltiel) (31Ribon V. Printen J.A. Hoffman N.G. Kay B.K. Saltiel A.R. Mol. Cell. Biol. 1998; 18: 872-879Crossref PubMed Scopus (192) Google Scholar). The yeast strain HF7c was cotransformed with the GAL4-PRL-1 construct and with the 3T3-L1 adipocyte library. The resulting transformants were plated on selection medium lacking tryptophan, leucine, and histidine and were incubated at 30 °C for 4–5 days. 5 × 106 clones were analyzed. Colonies positive for growth on selective media lacking histidine were blotted on filter paper (Whatman number 5), permeabilized in liquid nitrogen, and placed on another filter soaked in Z buffer (60 mmNa2HPO4, 40 mmNaH2PO4, 10 mm KCl, 1 mm MgSO4, 37.5 mmβ-mercaptoethanol) containing 1 mm5-bromo-4-chloro-3-indolyl-β-d-galactoside. Yeast colonies were scored as positive when a bright color developed within 3 h. Library-derived plasmids were rescued from positive clones and then transformed into HB101 Escherichia coli by electroporation. False positives were eliminated by transforming the rescued plasmids back into yeast along with either the PRL-1 bait construct, empty vector, or a control p53 bait construct. True positives were identified by their requirement for the PRL-1 bait construct to activate the reporter genes, and these were then sequenced. Sequence analysis was performed using GenAlign software, and FASTA and BLAST searches were performed against the SwissProt and GenBank™ data libraries. RNA preparation, Northern blot analyses, and labeling of recombinant plasmids have been described elsewhere (16Diamond R.H. Cressman D.E. Laz T.M. Abrams C.S. Taub R. Mol. Cell. Biol. 1994; 14: 3752-3762Crossref PubMed Scopus (248) Google Scholar,32Mohn K.L. Laz T.M. Hsu J.C. Melby A.E. Bravo R. Taub R. Mol. Cell. Biol. 1991; 11: 381-390Crossref PubMed Scopus (187) Google Scholar). Caco-2 cells were grown and harvested with respect to proliferating and differentiated phenotypes as previously described (20Diamond R.H. Peters C. Jung S.P. Greenbaum L.E. Haber B.A. Silberg D.G. Traber P.G. Taub R. Am. J. Physiol. 1996; 271: G121-G129Crossref PubMed Google Scholar). Total RNA was extracted from cells and from mouse tissues using the techniques previously described (32Mohn K.L. Laz T.M. Hsu J.C. Melby A.E. Bravo R. Taub R. Mol. Cell. Biol. 1991; 11: 381-390Crossref PubMed Scopus (187) Google Scholar, 33Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). Hybridization buffer consisted of 10% dextran sulfate, 40% formamide, 0.6 mNaCl, 0.06 m sodium citrate, 7 mm Tris (pH 7.6), 0.8× Denhardt's solution, and 0.002% heat-denatured, sonicated salmon sperm DNA. Northern blots were hybridized at 42 °C for 16 h and washed for 30 min twice at 60 °C in 0.015m NaCl-0.0015 m sodium citrate-0.1% SDS prior to exposure to film (33Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). The cDNA insert of a full-length ATF-7 clone isolated in the yeast two-hybrid screen and the cDNA insert of full-length C104S-PRL-1 were cloned into the pSPUTK (Stratagene) both with and without an Myc epitope fused to the N-terminal end. This vector provides a strong Kozak (34Kozak M. J. Biol. Chem. 1991; 266: 19867-19870Abstract Full Text PDF PubMed Google Scholar) consensus sequence and methionine for translation. C104S-PRL-1 and wild type PRL-1 were cloned into the pGEX GST fusion vector (Amersham Pharmacia Biotech). The appropriate restriction sites and the indicated epitope tags were added by performing the polymerase chain reaction with primers containing these sequences. Plasmid constructs were confirmed by sequencing and by protein expression. For interaction site mapping studies, the following constructs were made in pSPUTK: pSPUTK-ATF-7-amino (amino acids (aa) 1–139) and pSPUTK-ATF-7-bZIP (aa 140–217). The following constructs were made in pGEX: PGEX-PRL-1-aa-1–96, PGEX-PRL-1-aa-1–132, PGEX-PRL-1-aa-60–118, PGEX-PRL-1-aa-97–173, PGEX-PRL-1-aa-97–132, and PGEX-PRL-1-aa-118–173. All deletion and truncation constructs were made using polymerase chain reaction with appropriate primers and restriction sites and were sequenced completely prior to use in experiments. The in vitro translated proteins (pSPUTK) or bacterially expressed proteins (pGEX) were all of the predicted size. Rabbit polyclonal anti-ATF-7 antibodies were prepared by Cocalico Biologicals (Reamstown, PA) against bacterially expressed purified denatured ATF-7 protein expressed as a fusion protein linked to six histidines (35Rosenberg A.H. Lade B.N. Chui D.S. Lin S.W. Dunn J.J. Studier F.W. Gene. 1987; 56: 125-135Crossref PubMed Scopus (1044) Google Scholar). The anti-Myc epitope tag monoclonal antibody (9E10) was obtained commercially (Babco, Richmond, CA). In vitrotranscription/translation was performed using the TnT-coupled lysate system (Promega) according to the manufacturer's instructions. The reaction was incubated for 2 h at 30 °C in the presence of [35S]methionine, and the products were analyzed directly by SDS-PAGE or subjected to immunoprecipitation or binding assays prior to SDS-PAGE as described in the text. Radiolabeled in vitrotranslated proteins (5 μl) were incubated with GST or GST-PRL-1 C104S fusion proteins (1 μg), or with the indicated PRL-1 protein fragments attached to glutathione-Sepharose beads in 500 μl of binding buffer (20 mm HEPES, pH 7.5, 150 mmNaCl) for 1 h at 4 °C with gentle rotation. The beads were washed five times with binding buffer and resuspended in Laemmli sample buffer, and the sample was analyzed by SDS-PAGE followed by autoradiography. The two proteins or protein fragments being tested were in vitro translated simultaneously as described above. One protein used was fused to the Myc-tag epitope. 7.5 μl of the in vitro translated protein was incubated with to 5 μl of the anti-Myc-tag antibody or control sera in 500 μl of IP buffer (50 mm Tris, pH 7.4, 1 mm EDTA, 150 mm NaCl, 1% Triton) for 1 h at 4 °C. Immunocomplexes were bound to protein A-agarose beads and, after washing four times in IP buffer, were resolved by SDS-PAGE and visualized by autoradiography. Preannealed, gel-purified, double-stranded oligonucleotides were radiolabeled and incubated with 5 μl of in vitro translated proteins or 10 μg of mouse liver nuclear extract for 15 min at room temperature in binding buffer (10 mm Tris, pH 7.5/50 mm NaCl/1 mmEDTA/1 mm dithiothreitol/5 mmMgCl2/10% (v/v) glycerol). 1–2 μg of poly(dI-dC) was used as a nonspecific competitor in each reaction. Nuclear extracts from liver were prepared according to the method of Hattori (36Hattori M. Tugores A. Veloz L. Karin M. Brenner D.A. DNA Cell Biol. 1990; 9: 777-781Crossref PubMed Scopus (113) Google Scholar), with modifications (37Greenbaum L.E. Cressman D.E. Haber B.A. Taub R. J. Clin. Invest. 1995; 96: 1351-1365Crossref PubMed Scopus (84) Google Scholar). The mixtures were electrophoresed on a nondenaturing polyacrylamide gel in 1× TBE buffer (88 mmTris, 88 mm boric acid, 2 mm EDTA). Gels were dried and exposed to x-ray film. Supershifts were performed by incubating 1–1.5 μl of primary antibody with in vitrotranslated proteins in binding buffer for 45 min at 4 °C, prior to addition of labeled oligonucleotide. Cold competitions were performed by incubating unlabeled oligonucleotide in 100-fold excess within vitro translated proteins in binding buffer for 45 min at 4 °C prior to the addition of labeled oligonucleotide. The double-stranded oligonucleotides used were: CRE: TCATGGTAAAAATGACGTCATGGTAATTA, C/EBP: GATCCGGTTGCCAAACATTGCGCAATCT, and AP1: TATCGATAAGCTATGACTCATCCGGGGGA. Oligonucleotides were end-labeled with [γ-32P]ATP using polynucleotide kinase. GST-ATF-7 was expressed in bacteria and purified using the methods outlined above. The protein, attached to glutathione beads, was tyrosine-phosphorylated with 32P using c-Src kinase (Upstate Biotechnology) according to the manufacturer's directions. After the kinase reaction was stopped, the beads were washed four times in 1 ml of phosphatase buffer (50 mm HEPES, pH 7.5, 0.1% β-mercaptoethanol), resuspended, and split into three equal aliquots. PRL-1 active phosphatase and C104S-PRL-1 inactive mutant phosphatase were prepared as described previously (16Diamond R.H. Cressman D.E. Laz T.M. Abrams C.S. Taub R. Mol. Cell. Biol. 1994; 14: 3752-3762Crossref PubMed Scopus (248) Google Scholar). Equal amounts of active or mutant PRL-1, or buffer (negative control), were added to each tube, which were then incubated for 60 min at 37 °C. The phosphatase reaction was terminated by the addition of equal volumes of 2× Laemmli buffer, the products were then boiled, and run on an SDS-PAGE gel, which was then dried and exposed to x-ray film (Kodak). The results were quantified by densitometry. To identify PRL-1-interacting proteins, a truncated PRL-1 (amino acids 1–132) fused to the DNA binding domain of GAL4 was used as bait to screen a 3T3-L1 adipocyte cDNA expression library fused to the GAL4 transcriptional activation domain in the yeast two-hybrid interaction system. The bait construct used contains most of the full-length PRL-1 protein except for the C-terminal basic and farnesylation domains. Full-length PRL-1 bait did not yield any positives (true or false), although we later determined that full-length PRL-1 can in fact interact with ATF-7. We were able to document that the full-length fusion protein was able to be expressed in the yeast (data not shown). Because PRL-1 is a farnesylated protein residing in the insoluble cellular fraction (despite being readily soluble itself when expressed in bacteria) (16Diamond R.H. Cressman D.E. Laz T.M. Abrams C.S. Taub R. Mol. Cell. Biol. 1994; 14: 3752-3762Crossref PubMed Scopus (248) Google Scholar), we surmise that the C-terminal basic and farnesylation domains caused misdirection of the protein to a cellular site in the yeast where it was unable to interact with potential prey proteins. Of 5 × 106 total transformants, 38 colonies positive for β-galactosidase activity were isolated from histidine-minus plates. When the library-derived plasmids were recovered from these 38 colonies, we determined that 31 were true positives. 16 of these clones encoded either full-length or near full-length ATF-7. The remaining 15 clones all encoded another novel protein that has no homology to ATF-7 and is not a transcription factor. 2R. Diamond, unpublished data. This protein will be the subject of a separate report. As summarized in Fig.1, each of the GAL4-AD/ATF-7 clones induced histidine-minus growth and β-galactosidase activity only when they were coexpressed with PRL-1-derived/GAL4-BD fusion protein and not with an unrelated GAL4-BD fusion protein containing p53 or the GAL4 DNA binding domain alone (empty vector). Sequence analysis of the clone with the longest insert (1.6 kb) revealed a single open reading frame of 651 bp fused in-frame to the GAL4 activation domain. The sequence is shown in Fig. 2 A. An ATG initiation codon was present near the 5′-end, which was a good match for the canonical Kozak eukaryotic translation initiation consensus (34Kozak M. J. Biol. Chem. 1991; 266: 19867-19870Abstract Full Text PDF PubMed Google Scholar). The sequence encodes a protein of 217 amino acid residues, with a predicted molecular mass of 24 kDa and a pI of 5.46. In vitro translation of the ATF cDNA yielded an ∼30-kDa protein (Fig. 4), probably due to post-translational modification of the protein.Figure 4PRL-1 and ATF-7 interact in vitro. A, in vitrotranscription/translation of ATF-7, Myc-tagged C104S-PRL-1 (full-length), and luciferase control protein was performed in the presence of [35S]methionine as described under "Experimental Procedures." Immunoprecipitation with an anti-Myc-tag antibody was then carried out as described under "Experimental Procedures," and the products were resolved by SDS-PAGE and visualized by autoradiography. Lanes 1–3 show the results of the in vitro translation; lanes 4–6 show the results of the immunoprecipitation, which demonstrates that ATF-7 coimmunoprecipitates with the Myc-tagged C104S PRL-1. B,in vitro transcription/translation of C104S-PRL-1 (full-length), Myc-tagged ATF-7, and luciferase control protein was performed in the presence of [35S]methionine as described under "Experimental Procedures." Immunoprecipitation with an anti-Myc-tag antibody was then carried out as described under "Experimental Procedures," and the products were resolved by SDS-PAGE and visualized by autoradiography. Lanes 1–3 show the results of the in vitro translation; lanes 4–6 show the results of the immunoprecipitation, which demonstrates that C104S PRL-1 co-immunoprecipitates with the Myc-tagged ATF-7. C, in vitro translated ATF-7 was incubated with GST or GST-PRL-1 C104S full-length fusion proteins attached to glutathione-Sepharose beads, and after washing, the sample was analyzed by SDS-PAGE followed by autoradiography. The bottom panelshows a Coomassie Blue-stained SDS-PAGE gel demonstrating that the fusion proteins were expressed and were of the expected size.View Large Image Figure ViewerDownload (PPT) Comparison with data bases revealed that the sequence is novel but that it has several characteristics of a bZIP transcription factor. The extreme C-terminal end of the predicted ATF-7 protein contains three leucines and three valines, each separated by six other amino acids, suggesting a leucine zipper structure (38Landschulz W.H. Johnson P.F. McKnight S.L. Science. 1988; 240: 1759-1764Crossref PubMed Scopus (2544) Google Scholar). This hybrid leucine-valine zipper is unique to ATF-7 among the previously described bZIP proteins. Immediately upstream of this leucine-valine zipper sequence is an arginine-lysine-rich basic domain, thought to be necessary for sequence-specific DNA binding by bZIP proteins (39Dang C.V. McGuire M. Buckmire M. Lee W.M.F. Nature. 1989; 337: 664-666Crossref PubMed Scopus (128) Google Scholar, 40Neuberg M.M. Schuermann M. Hunter J.B. Muller R. Nature. 1989; 338: 589-590Crossref PubMed Scopus (89) Google Scholar). The N-terminal end of the predicted protein is negatively charged and proline-rich, reminiscent of the acidic activation domains of bZIP transcription factors. The bZIP family can be divided into three groups on the basis of binding site preference (41Lamb P. McKnight S.L. Trends Biochem. Sci. 1991; 16: 417-422Abstract Full Text PDF PubMed Scopus (259) Google Scholar): (i) the C/EBPs, (ii) the AP1 group of transcription factors, and (iii) the CREB/ATF family, which contains the ATFs, the original CREBs, and the CRE modulators. Distinctions within the bZIP family are also based upon differences in transactivating ability, patterns of tissue expression, and phosphorylation by specific kinases (41Lamb P. McKnight S.L. Trends Biochem. Sci. 1991; 16: 417-422Abstract Full Text PDF PubMed Scopus (259) Google Scholar). As shown in Fig.2 B and summarized in Fig. 2 C, ATF-7 is most closely related to ATF-4 (also known as CREB-2, C/ATF, and TAXREB67 (42Tsujimoto A. Nyunoya H. Morita T. Sato T. Shimotohno K. J. Virol. 1991; 65: 1420-1426Crossref PubMed Google Scholar, 43Mielnicki L.M. Hughes R.G. Chevray P.M. Pruitt S.C. Bichem. Biophys Res. Commun. 1996; 228: 586-595Crossref PubMed Scopus (17) Google Scholar, 44Karpinski B.A. Marle G.D. Huggenvik J. Uhler M.D. Leiden J.M. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4820-4824Crossref PubMed Scopus (211) Google Scholar, 45Vallejo M. Ron D. Miller C.P. Habener J.F. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4679-4683Crossref PubMed Scopus (211) Google Scholar)). In a number of cases, especially near the C terminus, ATF-7 and ATF-4 contain identical amino acids that diverge from the consensus deduced
Referência(s)