Targeted gene correction of RUNX1 in induced pluripotent stem cells derived from familial platelet disorder with propensity to myeloid malignancy restores normal megakaryopoiesis
2015; Elsevier BV; Volume: 43; Issue: 10 Linguagem: Inglês
10.1016/j.exphem.2015.05.004
ISSN1873-2399
AutoresHiromitsu Iizuka, Yuki Kagoya, Keisuke Kataoka, Akihide Yoshimi, Masashi Miyauchi, Kazuki Taoka, Keiki Kumano, Takashi Yamamoto, Akitsu Hotta, Shunya Arai, Mineo Kurokawa,
Tópico(s)Pluripotent Stem Cells Research
Resumo•Induced pluripotent stem cells were generated from dermal fibroblasts of a patient with familial platelet disorder (FPD) with propensity to myeloid malignancy.•The induced pluripotent stem cells exhibited a prominent dysfunction in megakaryocytic differentiation.•Transcription activator-like effector nuclease-mediated correction of the RUNX1 mutation restored megakaryopoiesis in the induced pluripotent stem cells. Familial platelet disorder with propensity to acute myeloid leukemia (FPD/AML) is an autosomal dominant disease associated with a germline mutation in the RUNX1 gene and is characterized by thrombocytopenia and an increased risk of developing myeloid malignancies. We generated induced pluripotent stem cells (iPSCs) from dermal fibroblasts of a patient with FPD/AML possessing a nonsense mutation R174X in the RUNX1 gene. Consistent with the clinical characteristics of the disease, FPD iPSC-derived hematopoietic progenitor cells were significantly impaired in undergoing megakaryocytic differentiation and subsequent maturation, as determined by colony-forming cell assay and surface marker analysis. Notably, when we corrected the RUNX1 mutation using transcription activator-like effector nucleases in conjunction with a donor plasmid containing normal RUNX1 cDNA sequences, megakaryopoiesis and subsequent maturation were restored in FPD iPSC-derived hematopoietic cells. These findings clearly indicate that the RUNX1 mutation is robustly associated with thrombocytopenia in patients with FPD/AML, and transcription activator-like effector nuclease-mediated gene correction in iPSCs generated from patient-derived cells could provide a promising clinical application for treatment of the disease. Familial platelet disorder with propensity to acute myeloid leukemia (FPD/AML) is an autosomal dominant disease associated with a germline mutation in the RUNX1 gene and is characterized by thrombocytopenia and an increased risk of developing myeloid malignancies. We generated induced pluripotent stem cells (iPSCs) from dermal fibroblasts of a patient with FPD/AML possessing a nonsense mutation R174X in the RUNX1 gene. Consistent with the clinical characteristics of the disease, FPD iPSC-derived hematopoietic progenitor cells were significantly impaired in undergoing megakaryocytic differentiation and subsequent maturation, as determined by colony-forming cell assay and surface marker analysis. Notably, when we corrected the RUNX1 mutation using transcription activator-like effector nucleases in conjunction with a donor plasmid containing normal RUNX1 cDNA sequences, megakaryopoiesis and subsequent maturation were restored in FPD iPSC-derived hematopoietic cells. These findings clearly indicate that the RUNX1 mutation is robustly associated with thrombocytopenia in patients with FPD/AML, and transcription activator-like effector nuclease-mediated gene correction in iPSCs generated from patient-derived cells could provide a promising clinical application for treatment of the disease. Familial platelet disorder with propensity to acute myeloid leukemia (FPD/AML) is an autosomal dominant disease characterized by mild to moderate thrombocytopenia, impaired platelet function, and an increased risk for developing hematopoietic malignancies such as myelodysplastic syndrome (MDS) and acute myeloid leukemia [1Dowton S.B. Beardsley D. Jamison D. Blattner S. Li F.P. Studies of a familial platelet disorder.Blood. 1985; 65: 557-563Crossref PubMed Google Scholar, 2Gerrard J.M. Israels E.D. Bishop A.J. et al.Inherited platelet-storage pool deficiency associated with a high incidence of acute myeloid leukaemia.Br J Haematol. 1991; 79: 246-255Crossref PubMed Scopus (45) Google Scholar, 3Arepally G. Rebbeck T.R. Song W. Gilliland G. Maris J.M. Poncz M. Evidence for genetic homogeneity in a familial platelet disorder with predisposition to acute myelogenous leukemia (FPD/AML).Blood. 1998; 92: 2600-2602Crossref PubMed Google Scholar]. The disease is associated with an inherited mutation in the RUNX1 gene [4Song W. Sullivan M.G. Legare R.D. et al.Haploinsufficiency of CBFA2 causes familial thrombocytopenia with propensity to develop acute myelogenous leukemia.Nat Genet. 1999; 23: 166-175Crossref PubMed Scopus (899) Google Scholar], which is located at chromosome 21q22 and known as a transcription factor that regulates fetal and adult hematopoiesis. Genetic mutations and translocations involving RUNX1 have been reported in a variety of hematopoietic malignancies including MDS and AML [5Growney J.D. Shigematsu H. Li Z. et al.Loss of Runx1 perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype.Blood. 2005; 106: 494-504Crossref PubMed Scopus (354) Google Scholar, 6Harada H. Harada Y. Niimi H. Kyo T. Kimura A. Inaba T. High incidence of somatic mutations in the AML1/RUNX1 gene in myelodysplastic syndrome and low blast percentage myeloid leukemia with myelodysplasia.Blood. 2004; 103: 2316-2324Crossref PubMed Scopus (235) Google Scholar, 7Kohlmann A. Grossmann V. Klein H.U. et al.Next-generation sequencing technology reveals a characteristic pattern of molecular mutations in 72.8% of chronic myelomonocytic leukemia by detecting frequent alterations in TET2, CBL, RAS, and RUNX1.J Clin Oncol. 2010; 28: 3858-3865Crossref PubMed Scopus (252) Google Scholar, 8Tang J.L. Hou H.A. Chen C.Y. et al.AML1/RUNX1 mutations in 470 adult patients with de novo acute myeloid leukemia: Prognostic implication and interaction with other gene alterations.Blood. 2009; 114: 5352-5361Crossref PubMed Scopus (259) Google Scholar]. Although the prevalence of FPD/AML was initially considered to be very low, there has recently been an increase in the number of reported cases worldwide, along with an increased awareness of FPD/AML by clinicians [9Bujis A. Poddighe P. van Wijk R. et al.A novel CBFA2 single-nucleotide mutation in familial platelet disorder with propensity to develop myeloid malignancies.Blood. 2001; 98: 2856-2858Crossref PubMed Scopus (98) Google Scholar, 10Heller P.G. Glembotsky A.C. Gandhi M.J. et al.Low Mpl receptor expression in a pedigree with familial platelet disorder with predisposition to acute myelogenous leukemia and a novel AML1 mutation.Blood. 2005; 105: 4664-4670Crossref PubMed Scopus (82) Google Scholar, 11Sun L. Mao G. Rao A.K. Association of CBFA2 mutation with decreased platelet PKC-theta and impaired receptor-mediated activation of GPIIb-IIIa and pleckstrin phosphorylation: Proteins regulated by CBFA2 play a role in GPIIb–IIIa activation.Blood. 2004; 103: 948-954Crossref PubMed Scopus (68) Google Scholar, 12Owen C.J. Toze C.L. Koochin A. et al.Five new pedigrees with inherited RUNX1 mutations causing familial platelet disorder with propensity to myeloid malignancy.Blood. 2008; 112: 4639-4645Crossref PubMed Scopus (184) Google Scholar, 13Kirito K. Sakoe K. Shinoda D. Takiyama Y. Kaushansky K. Komatsu N. A novel RUNX1 mutation in familial platelet disorder with propensity to develop myeloid malignancies.Haematologica. 2008; 93: 155-156Crossref PubMed Scopus (32) Google Scholar, 14Michaud J. Wu F. Osato M. et al.In vitro analysis of known and novel RUNX1/AML1 mutations in dominant familial platelet disorder with predisposition to acute myelogenous leukemia: Implications for mechanisms of pathogenesis.Blood. 2002; 99: 1364-1372Crossref PubMed Scopus (314) Google Scholar]. Because RUNX1 is a key regulator in megakaryocytic differentiation in hematopoiesis [15Elagib K.E. Racke F.K. Mogass M. Khetawat R. Delehanty L.L. Goldfarb A.N. RUNX1 and GATA-1 coexpression and cooperation in megakaryocytic differentiation.Blood. 2003; 101: 4333-4341Crossref PubMed Scopus (262) Google Scholar, 16Ichikawa M. Asai T. Saito T. et al.AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis.Nat Med. 2004; 10: 299-304Crossref PubMed Scopus (476) Google Scholar], its mutation is considered to be definitely associated with the pathogenesis of FPD/AML, and developing a gene therapy that corrects the RUNX1 mutation could lead to fundamental therapeutics for the disease.Induced pluripotent stem cells (iPSCs) provide an attractive platform for studying heritable diseases [17Takahashi K. Tanabe K. Ohnuki M. et al.Induction of pluripotent stem cells from adult human fibroblasts by defined factors.Cell. 2007; 131: 861-872Abstract Full Text Full Text PDF PubMed Scopus (14654) Google Scholar]. Once iPSCs harboring genomic abnormalities specific for a disease are established, they can be differentiated into cells with relevant lineages. Particularly because sufficient patient samples are not available in rare diseases including FPD/AML, patient-derived iPSCs have great potential as a disease model, as they could generate unlimited quantities of cells. Furthermore, genetic manipulations, such as introduction of exogenous genes and specific correction of the defined mutation in established iPSCs, could lead to novel cellular therapy. Previous studies reported that gene correction of iPSCs from patients with sickle cell anemia, beta thalassemia, and Fanconi anemia successfully reestablished normal hematopoiesis [18Ye L. Chang J.C. Lin C. Sun X. Yu J. Kan Y.W. Induced pluripotent stem cells offer new approach to therapy in thalassemia and sickle cell anemia and option in prenatal diagnosis in genetic diseases.Proc Natl Acad Sci U S A. 2009; 106: 9826-9830Crossref PubMed Scopus (172) Google Scholar, 19Wang Y. Jiang Y. Liu S. Sun X. Gao S. Generation of induced pluripotent stem cells from human beta-thalassemia fibroblast cells.Cell Res. 2009; 19: 1120-1123Crossref PubMed Scopus (47) Google Scholar, 20Wang Y. Zheng C.G. Jiang Y. et al.Genetic correction of beta-thalassemia patient-specific iPS cells and its use in improving hemoglobin production in irradiated SCID mice.Cell Res. 2012; 22: 637-648Crossref PubMed Scopus (92) Google Scholar, 21Sebastiano V. Maeder M.L. Angstman J.F. et al.In situ genetic correction of the sickle cell anemia mutation in human induced pluripotent stem cells using engineered zinc finger nucleases.Stem Cells. 2011; 29: 1717-1726Crossref PubMed Scopus (264) Google Scholar, 22Hanna J. Wernig M. Markoulaki S. et al.Treatment of sickle cell anemia mouse model with iPS cells generated from autologous skin.Science. 2007; 318: 1920-1923Crossref PubMed Scopus (1224) Google Scholar, 23Ma N. Liao B. Zhang H. et al.Transcription activator-like effector nuclease (TALEN)-mediated gene correction in integration-free β-thalassemia induced pluripotent stem cells.J Biol Chem. 2013; 288: 34671-34679Crossref PubMed Scopus (132) Google Scholar, 24Raya A. Rodriguez-Piza I. Guenechea G. et al.Disease-corrected haematopoietic progenitors from Fanconi anaemia induced pluripotent stem cells.Nature. 2009; 460: 53-59Crossref PubMed Scopus (578) Google Scholar]. In FPD/AML, RUNX1-corrected hematopoietic cells with the capacity to produce both qualitatively and quantitatively normal platelets could be a new source for autologous hematopoietic stem cell transplantation.In this study, we generated iPSCs from dermal fibroblasts derived from a patient with FPD/AML. Consistent with the clinical phenotype of the disease, we found that FPD iPSC-derived hematopoietic cells had a prominent dysfunction in megakaryocytic differentiation. Additionally, we demonstrated that transcription activator-like effector nuclease (TALEN)-mediated gene correction of the RUNX1 mutation restored megakaryopoiesis in FPD iPSC-derived hematopoietic cells.MethodsGeneration and culture of iPSCs from a patient with FPD/AMLThis research was approved by the ethics committees at the University of Tokyo. Skin biopsy of an adult female patient with FPD/AML was performed after she provided written informed consent. The fibroblasts obtained were culture expanded and reprogrammed to iPSCs as previously described, with retroviral transduction of four factors: OCT3/4, SOX2, KLF4, and c-MYC [17Takahashi K. Tanabe K. Ohnuki M. et al.Induction of pluripotent stem cells from adult human fibroblasts by defined factors.Cell. 2007; 131: 861-872Abstract Full Text Full Text PDF PubMed Scopus (14654) Google Scholar]. Normal control human iPSCs were established from fibroblasts of healthy volunteers in the same manner. Human iPSCs were routinely maintained on mouse embryonic fibroblast (MEF) feeders and passaged as described previously [25Kumano K. Arai S. Hosoi M. et al.Generation of induced pluripotent stem cells from primary chronic myelogenous leukemia patient samples.Blood. 2012; 119: 6234-6242Crossref PubMed Scopus (122) Google Scholar]. Immunofluorescence staining was carried out with Alexa fluor 555 mouse antihuman TRA-1-60 antigen (BD Pharmingen) and Alexa fluor 488 mouse anti-human SSEA4 antigen (BD Pharmingen, San Diego, CA) as described previously [17Takahashi K. Tanabe K. Ohnuki M. et al.Induction of pluripotent stem cells from adult human fibroblasts by defined factors.Cell. 2007; 131: 861-872Abstract Full Text Full Text PDF PubMed Scopus (14654) Google Scholar].Hematopoietic differentiation of iPSCsTo differentiate iPSCs into hematopoietic cells, we used the same protocol as previously used with embryonic stem cells and iPSCs [26Takayama N. Nishikii H. Usui J. et al.Generation of functional platelets from human embryonic stem cells in vitro via ES-sacs, VEGF-promoted structures that concentrate hematopoietic progenitors.Blood. 2008; 111: 5298-5306Crossref PubMed Scopus (241) Google Scholar]. In brief, small clusters of iPSCs were transferred onto mitomycin C-treated C3H10T1/2 cells and co-cultured in hematopoietic cell differentiation medium, which consisted of Iscove's modified Dulbecco medium supplemented with a cocktail of 10 μg/mL human insulin, 5.5 μg/mL human transferrin, 5 ng/mL sodium selenite, 2 mmol/L L-glutamine, 0.45 mmol/L monothioglycerol, 50 μg/mL ascorbic acid, and 15% highly filtered fetal bovine serum (FBS) in the presence of 20 ng/mL human vascular endothelial growth factor (VEGF). Culture medium was replaced on days 3, 6, 9, 11, and 13. After 14 to 15 days of culture, the iPSC sacs were crashed with pipette tips and filtered with cell strainer, and CD34+CD43+ hematopoietic progenitor cells (HPCs) were isolated with anti-CD34 antibody (eBioscience, San Diego, CA) and anti-CD43 antibody (Beckman Coulter, Brea, CA) using FACS Aria II (Becton Dickinson, Franklin Lakes, NJ).Hematopoietic colony-forming cell assayColony-forming cell (CFC) assays for evaluating the capacity to produce erythroid, myeloid, and multilineage cells were performed in MethoCult H4034 semisolid medium (StemCell Technologies). Twenty thousand HPCs harvested from iPSC sacs were plated in 1 mL of medium and cultured for 14 days. Megakaryocytic CFC assays were performed in MegaCult-C semisolid medium (StemCell Technologies). Twenty-five thousand HPCs were cultured in double-chamber slides for 10 to 12 days. Afterward, the slides were dehydrated, fixed, and stained for anti-CD41 antibody according to the manufacturer's protocols. All colonies were classified into three categories: megakaryocytic colony (Mk), mixed Mk colony, and non-Mk colony.Megakaryocytic differentiation of hematopoietic progenitor cellsTo differentiate iPSC-derived HPCs into megakaryocytes, CD34+CD43+ HPCs were transferred onto mitomycin C-treated C3H10T1/2 cells in six-well plates and maintained in differentiation medium supplemented with 25 mg/mL human megakaryocyte growth and development factor (MGDF), 50 ng/mL human stem cell factor, and heparin. Culture medium was refreshed every 3 days. Nonadherent cells were collected, and CD41a/CD42b positivity was examined with flow cytometry after 9 days of culture [27Takayama N. Nishimura S. Nakamura S. et al.Transient activation of c-MYC expression is critical for efficient platelet generation from human induced pluripotent stem cells.J Exp Med. 2010; 207: 2817-2830Crossref PubMed Scopus (247) Google Scholar]. Data analysis was performed with FlowJo software (Treestar, Ashland, OR). The CD41a+CD42b+ cells were sorted by flow cytometry and stained using the Wright–Giemsa method.RUNX1 TALEN constructionWe constructed a pair of TALENs that make DNA double-strand breaks at the site of the RUNX1 mutation in the REAL assembly method, as previously described [28Sander J.D. Cade L. Khayter C. et al.Targeted gene disruption in somatic zebrafish cells using engineered TALENs.Nat Biotechnol. 2011; 29: 697-698Crossref PubMed Scopus (483) Google Scholar]. In brief, the plasmids harboring modules of repeat-variable di-residue (RVD) nucleotide, which recognizes each DNA code, were digested with either BsaI or BbsI, and BamHI. The digested strands were ligated in a stepwise manner into designed order. Then the specific DNA sequence recognition parts assembled were inserted into expression vectors, which include the Fok1 nuclease domain. In this way, fusion proteins combining the TALE DNA recognition domain and nuclease domain were made. The donor sequence for homologous recombination was made by using OCT4-2A-EGFP-PGK-puro vector as a backbone vector [29Hockemeyer D. Wang H. Kiani S. et al.Genetic engineering of human pluripotent cells using TALE nucleases.Nat Biotechnol. 2011; 29: 731-734Crossref PubMed Scopus (930) Google Scholar], and RUNX1 cDNA sequences after the mutation site followed by polyadenylation signal were inserted between approximately 700 bp of homologous arms of both 5′ and 3′ sides.TALEN-mediated gene correction of iPSCsWe dissociated iPSCs into single cells with Accutase after the Y-27632 treatment and suspended them in Opti-MEM. The TALEN pair and a donor plasmid were transfected with NEPA21 electroporator (Nepa Gene, Ichikawa, Chiba, Japan). After transfection, iPSCs were seeded on MEF feeder cells with supplemented with 10 μmol/L Y-27632. Puromycin was added to iPSC medium 2 days after electroporation, and resistant clones were picked up after 10–14 days. Every puromycin-resistant clone was examined by polymerase chain reaction (PCR) amplification to determine whether insertion accompanied by homologous recombination has occurred at the specific site. The following primers were used for genomic PCR: primer 1, GAGTCATCAATTTTATTCTGACTGATCC; primer 2, TAAAGGCAGTGGAGTGGTTCA; primer 3, CCACCAACCTCATTCTGTTT; primer 4, GAGGCGCCGTAGTACAGGT; primer 5, TTTCCAGAACCACACCCTTC; primer 6, TCCCTCACTCCAAGAAGAGAGTAT. For sequencing of the RUNX1 cDNA, mutation-containing regions of RUNX1 were amplified with the following primers: forward, TTTGTCGGTCGAAGTGGAAG; reverse, GGCAATGGATCCCAGGTATT.ImmunoblottingTotal-cell lysates were subjected to immunoblotting. Membranes were probed with anti-RUNX1 (Cell Signaling) and anti-β-actin (Cell Signaling) monoclonal antibody. Detection was performed with horseradish peroxidase-labeled secondary antibodies (Santa Cruz Biotechnology), Immunostar LD Western blotting detection reagent (Wako), and an LAS-3000 image analyzer (FujiFilm).Real-time quantitative PCRReal-time quantitative PCR was carried out on the LightCycler480 system (Roche) using SYBR Green reagents according to the manufacturer's instructions. The results were normalized to 18S rRNA levels. Relative expression levels were calculated using the standard curve method. The following primers were used for quantitative PCR experiments: 18S forward, CGCGGTTCTATTTTGTTGGT, and reverse, AGTCGGCATCGTTTATGGTC; RUNX1 forward, TGGAAGAGGGAAAAGCTTCA, and reverse, TTCTGCCGATGTCTTCGAG.ResultsGeneration of iPSCs from a patient with FPD/AMLIn this study, we analyzed a patient with FPD/AML of the pedigree we had previously reported [30Nishimoto N. Imai Y. Ueda K. et al.T cell acute lymphoblastic leukemia arising from familial platelet disorder.Int J Hematol. 2010; 92: 194-197Crossref PubMed Scopus (35) Google Scholar]. The pedigree displayed a C-T mutation in exon 5 of one of the RUNX1 alleles, changing the codon for the arginine residue at position 174 (runt domain) into a stop codon (R174X mutation). The nonsense mutant has been found to interfere with transactivation by normal RUNX1 in a dominant-negative manner [14Michaud J. Wu F. Osato M. et al.In vitro analysis of known and novel RUNX1/AML1 mutations in dominant familial platelet disorder with predisposition to acute myelogenous leukemia: Implications for mechanisms of pathogenesis.Blood. 2002; 99: 1364-1372Crossref PubMed Scopus (314) Google Scholar]. We established iPSCs from the dermal fibroblasts of the patient by reprogramming with retroviral transduction of OCT3/4, SOX2, KLF4, and c-MYC, as previously described [17Takahashi K. Tanabe K. Ohnuki M. et al.Induction of pluripotent stem cells from adult human fibroblasts by defined factors.Cell. 2007; 131: 861-872Abstract Full Text Full Text PDF PubMed Scopus (14654) Google Scholar]. The established FPD iPSCs exhibited characteristic embryonic stem cell-like morphology (Fig. 1A). We also confirmed that they expressed embryonic stem cell gene transcripts, such as NANOG, OCT4, REX1, SOX2, and LIN28 (Fig. 1B), and pluripotent markers SSEA-4 and TRA-1-60, as determined by immunofluorescence staining (Fig. 1C). In addition, the established FPD iPSCs had the same RUNX1 heterozygous mutation as the patient's primary fibroblasts, indicating that they were truly derived from the patient with FPD/AML (Fig. 1D). Teratoma formation capacity of the iPSCs when they were injected into immunodeficient NOD/scid mice was also confirmed (Fig. 1E).FPD iPSC-derived hematopoietic cells have reduced capacity for megakaryocytic differentiationTo investigate the hematopoietic potential in the established FPD iPSCs, we first differentiated them into HPCs by co-culture with C3H10T1/2 feeder cells. FPD iPSCs yielded CD34+CD43+ HPCs comparable in frequency to normal iPSCs (Fig. 2A and B). Approximately 106 iPSCs generated several hundred thousands of CD34+CD43+ cells after differentiation culture. Although we tested a prolonged culture period 1 or 2 days longer than usual, HPC yield was not increased (data not shown). Then, the generated CD34+CD43+ HPCs were seeded into semisolid culture medium and evaluated for their colony-forming capacity. Notably, while FPD iPSC-derived HPCs exhibited no significant difference in numbers of erythroid and myeloid colonies, compared with the normal control, when seeded into MethoCult H4034 semisolid medium (Fig. 2C), they had a prominently decreased capability for megakaryocytic colony formation as determined by CD41+ CFU-Mk colonies (Fig. 2D). To further evaluate the capacity for differentiation into megakaryocytic lineages of iPSC-derived HPCs, we analyzed the generation and maturation of megakaryocytes after 9 days of culture of HPCs in differentiation medium supplemented with stem cell factor and MGDF on C3H10T1/2 feeder cells. The cytospin image of the CD41a+CD42b+ cells obtained revealed mature polyploid megakaryocytes in both normal and FPD iPSC-derived cells (Fig. 2E). Interestingly, the differentiation into mature megakaryocytes was less efficient in HPCs derived from FPD iPSCs, as assessed with flow cytometry, than in normal iPSC-derived HPCs, indicating that FPD iPSC-derived HPCs had a reduced capacity for megakaryocyte differentiation and subsequent maturation (Fig. 2F and G).Figure 2Hematopoietic differentiation capacity of induced pluripotent stem cells (iPSCs) from a patient with familial platelet disorder with propensity to acute myeloid leukemia (FPD/AML) (FPD iPSCs). (A, B) Flow cytometric analysis of CD34 and CD43 after hematopoietic differentiation of iPSCs: (A) representative plots, (B) mean percentages of hematopoietic progenitor cells (HPCs0. Experiments were repeated three times independently. Error bars indicate SD. (C) Colony-forming cell assay for myeloid and erythroid lineages of HPCs derived from FPD iPSCs and normal counterparts in MethoCult H4034 semisolid medium. (D) Colony-forming cell assay for megakaryocytic lineage of HPCs derived from FPD iPSCs, as compared with normal cells, in MegaCult-C semisolid medium. CD34+CD43+ cells were sorted and used in the colony-forming assay. Experiments were repeated three times independently. Error bars indicate SD (*p < 0.05). (E) Wright–Giemsa-stained cytospin images of CD41a+CD42 b+ megakaryocytes differentiated from normal or FPD-derived HPCs. (F, G) Flow cytometric analysis of CD41a and CD42b after megakaryocytic differentiation of HPCs: (F) representative plots, (G) mean percentages of CD41a+CD42b+ fractions. Experiments were repeated three times independently (*p < 0.05). Error bars indicate SD.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Design of TALEN plasmids targeting the RUNX1 mutation siteNext, we were interested in investigating if repair of the RUNX1 gene mutation could normalize the capacity for megakaryocytic differentiation in FPD iPSC-derived hematopoietic cells. To specifically correct the RUNX1 mutation, we used TALENs targeting the region near the mutation site in conjunction with a donor plasmid containing normal RUNX1 cDNA sequences from exons 6 to 8, as illustrated in Figure 3A. After the pair of TALENs introduces the double-strand break at the target site, homologous recombination between genomic DNA and the donor plasmid replaces mutated RUNX1 with wild-type cDNA sequences of RUNX1. To select the cells with successful homologous recombination, we introduced a puromycin-resistant gene cassette into the donor plasmid. First, we validated the efficacy of our strategy using cell lines. HEK293T cells were transfected with TALEN plasmids and the donor plasmid with electroporation and subsequently cultured for 1 week with 1 μg/mL puromycin, and the genomic DNA of surviving clones was purified. We confirmed that the donor plasmid was precisely integrated at the target site by detecting PCR amplification with the specific primers (Fig. 3B). Also, the protein level of RUNX1 in puromycin-resistant cells was almost the same as that in the control cells, indicating that the inserted RUNX1 cDNA sequence was properly transcribed and translated into protein (Fig. 3C).Figure 3Transcription activator-like effector nuclease (TALEN)-mediated RUNX1 gene correction. (A) Plasmid design for TALEN-mediated correction of RUNX1 mutation. (B) Confirmation of precise integration into HEK293T cells transfected with a pair of TALENs and a donor plasmid with polymerase chain reaction analysis. (C) Immunoblot of RUNX1 in HEK293T cells with or without integration of a donor plasmid.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Correction of RUNX1 mutation in FPD iPSCs restores megakaryopoiesisAs a next step, we tried to correct the RUNX1 gene in FPD iPSCs with this strategy. A single-cell suspension of FPD iPSCs was transfected with the two TALEN-encoding plasmids and the donor template, and seeded for colony formation (Fig. 4A). After selection with puromycin, we finally obtained four puromycin-resistant clones, which had proper integration of a donor plasmid as confirmed by genomic PCR analysis. Although only preliminary assessment was performed with three lines of each set of FPD iPSCs and RUNX1-corrected iPSCs, they did not seem different in terms of cell biological properties as iPSCs (data not shown). In subsequent analysis, we used one of the RUNX1-corrected clones. First, we synthesized a cDNA from mRNA of the clone and confirmed that it possessed a wild-type RUNX1 sequence without containing a mutant one (data not shown). We differentiated the repaired FPD iPSCs into HPCs and then into megakaryocytes, and evaluated their differentiation efficiency. Consistent with our hypothesis, the HPCs from repaired clones produced significantly increased megakaryocytic colonies (Fig. 4B) and CD41a+ cells compared with the original FPD iPSC-derived HPCs (Fig. 4C and D). Furthermore, they generated more mature megakaryocytes as determined by the intensity of CD42 b within CD41a+ cells (Fig. 4E). Importantly, RUNX1-corrected FPD iPSC-derived cells had almost the same levels of RUNX1 expression as parental FPD iPSC-derived cells throughout the differentiation process (Fig. 4F). These results clearly indicate that TALEN-mediated correction of RUNX1 gene mutation restores wild-type RUNX1 expression to physiologic levels and normalizes megakaryopoiesis in hematopoietic cells derived from patients with FPD/AML, which could provide a promising therapeutic approach for fundamental treatment of those patients.Figure 4Functional analysis of RUNX1-corrected induced pluripotent stem cells (iPSCs) from a patient with familial platelet disorder with propensity to acute myeloid leukemia (FPD/AML) (FPD iPSCs). (A) Schematic illustration of generation of transcription activator-like effector nuclease (TALEN)-mediated RUNX1-corrected FPD iPSCs. (B) Megakaryocytic colony-forming cell assay in MegaCult-C semisolid medium. Experiments were repeated three times independently, and error bars indicate SD (*p < 0.05). (C–E) Flow cytometric analysis of megakaryocytic differentiation capacity in normal iPSCs, FPD iPSCs, and RUNX1-corrected FPD iPSCs: (C) representative flow cytometry plots, (D) average percentage of CD41a+CD42b+ cells, and (E) and intensity of CD42b expression in three independent experiments. Error bars indicate SD (*p < 0.05). (F) Relative levels of expression of RUNX1 in CD34+CD43+ hematopoietic progenitor cells and CD41a+ megakaryocytes differentiated from RUNX1-corrected FPD iPSCs, as compared with those from parental FPD iPSCs. Experiments were repeated three times independently, and the error bars indicate S
Referência(s)