Paracoccus denitrificans possesses two BioR homologs having a role in regulation of biotin metabolism
2015; Wiley; Volume: 4; Issue: 4 Linguagem: Inglês
10.1002/mbo3.270
ISSN2045-8827
AutoresYoujun Feng, Ritesh Kumar, Dmitry A. Ravcheev, Huimin Zhang,
Tópico(s)Advanced biosensing and bioanalysis techniques
ResumoMicrobiologyOpenVolume 4, Issue 4 p. 644-659 Original ResearchOpen Access Paracoccus denitrificans possesses two BioR homologs having a role in regulation of biotin metabolism Youjun Feng, Corresponding Author Youjun Feng Department of Medical Microbiology & Parasitology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 China Correspondence Youjun Feng, Department of Medical Microbiology & Parasitology, Zhejiang University School of Medicine (Zi-Jin-Gang Campus), No. 866, Yu-Hang-Tang Rd., Hangzhou City, Zhejiang 310058, China. Tel/Fax: +86 571 88208524; E-mail: fengyj@zju.edu.cn.Search for more papers by this authorRitesh Kumar, Ritesh Kumar Institute of Biosciences and Technology, Texas A&M Health Science Center, Houston, Texas, 77030Search for more papers by this authorDmitry A. Ravcheev, Dmitry A. Ravcheev Luxembourg Centre for Systems Biomedicine, University of Luxembourg, 2, avenue de l'Université, L-4365, Esch-sur-Alzette, LuxembourgSearch for more papers by this authorHuimin Zhang, Huimin Zhang Department of Medical Microbiology & Parasitology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 ChinaSearch for more papers by this author Youjun Feng, Corresponding Author Youjun Feng Department of Medical Microbiology & Parasitology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 China Correspondence Youjun Feng, Department of Medical Microbiology & Parasitology, Zhejiang University School of Medicine (Zi-Jin-Gang Campus), No. 866, Yu-Hang-Tang Rd., Hangzhou City, Zhejiang 310058, China. Tel/Fax: +86 571 88208524; E-mail: fengyj@zju.edu.cn.Search for more papers by this authorRitesh Kumar, Ritesh Kumar Institute of Biosciences and Technology, Texas A&M Health Science Center, Houston, Texas, 77030Search for more papers by this authorDmitry A. Ravcheev, Dmitry A. Ravcheev Luxembourg Centre for Systems Biomedicine, University of Luxembourg, 2, avenue de l'Université, L-4365, Esch-sur-Alzette, LuxembourgSearch for more papers by this authorHuimin Zhang, Huimin Zhang Department of Medical Microbiology & Parasitology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 ChinaSearch for more papers by this author https://doi.org/10.1002/mbo3.270Citations: 18AboutSectionsPDF ToolsExport citationAdd to favoritesTrack citationReprints ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat Graphical Abstract Recently, we determined that BioR, the GntR family of transcription factor, acts as a repressor for biotin metabolism exclusively distributed in certain species of α-proteobacteria including the zoonotic agent Brucella melitensis and the plant pathogen Agrobacterium tumefaciens. However, the scenario is quite unusual in Paracoccus denitrificans, the closely-related bacterium featuring with denitrification within the same phylum α-proteobacteria. Given the fact that P. denitrificans encodes two BioR homologues Pden_1431 and Pden_2922 (designated as BioR1 and BioR2, respectively), and has six predictive BioR-recognizable sites (the two bioR homologue each has one site, whereas the two bio operons (bioBFDAGC and bioYB) each contains two tandem BioR boxes), it raised the possibility that unexpected complexity is present in BioR-mediated biotin regulation. By using the integrative approaches, we defined a complex regulatory network for biotin metabolism in P. denitrificans by two BioR proteins. Abstract Recently, we determined that BioR, the GntR family of transcription factor, acts as a repressor for biotin metabolism exclusively distributed in certain species of α-proteobacteria, including the zoonotic agent Brucella melitensis and the plant pathogen Agrobacterium tumefaciens. However, the scenario is unusual in Paracoccus denitrificans, another closely related member of the same phylum α-proteobacteria featuring with denitrification. Not only does it encode two BioR homologs Pden_1431 and Pden_2922 (designated as BioR1 and BioR2, respectively), but also has six predictive BioR-recognizable sites (the two bioR homolog each has one site, whereas the two bio operons (bioBFDAGC and bioYB) each contains two tandem BioR boxes). It raised the possibility that unexpected complexity is present in BioR-mediated biotin regulation. Here we report that this is the case. The identity of the purified BioR proteins (BioR1 and BioR2) was confirmed with LC-QToF-MS. Phylogenetic analyses combined with GC percentage raised a possibility that the bioR2 gene might be acquired by horizontal gene transfer. Gel shift assays revealed that the predicted BioR-binding sites are functional for the two BioR homologs, in much similarity to the scenario seen with the BioR site of A. tumefaciens bioBFDAZ. Using the A. tumefaciens reporter system carrying a plasmid-borne LacZ fusion, we revealed that the two homologs of P. denitrificans BioR are functional repressors for biotin metabolism. As anticipated, not only does the addition of exogenous biotin stimulate efficiently the expression of bioYB operon encoding biotin transport/uptake system BioY, but also inhibits the transcription of the bioBFDAGC operon resembling the de novo biotin synthetic pathway. EMSA-based screening failed to demonstrate that the biotin-related metabolite is involved in BioR-DNA interplay, which is consistent with our former observation with Brucella BioR. Our finding defined a complex regulatory network for biotin metabolism in P. denitrificans by two BioR proteins. Introduction Biotin (vitamin H), a sulfur-containing fatty acid derivative, functions as the covalently bound enzyme cofactor that is required by three domains of life (Beckett 2007). The representative biotin-requiring enzyme refers to the AccB subunit (i.e., biotin carboxyl carrier protein, BCCP) of acetyl-CoA carboxylase (ACC), catalyzing the first committed step of fatty acid biosynthesis (Chakravartty and Cronan 2012). To account for such kinds of metabolic requirement for the biotin cofactor, bacteria seemed to have developed two different strategies, one of which is BioY transporter-based scavenging route (Rodionov et al. 2002; Guillen-Navarro et al. 2005; Hebbeln et al. 2007), and the other is de novo synthesis pathway dependent of a full enzyme kit (BioF, BioA, BioD, and BioB) (Fig. 1A) (Beckett 2007, 2009). Given the fact that biotin is an energetically expensive molecule in that its de novo biosynthesis requires 20 ATP equivalents, it is reasonable that different organisms have evolved diversified mechanisms to tightly negotiate its production and/or utilization (Streit and Entcheva 2003; Guillen-Navarro et al. 2005; Beckett 2007). Figure 1Open in figure viewerPowerPoint A working model proposed for biotin metabolism and BioR-mediated regulation in Paracoccus denitrificans. (A) Schematic diagram for the two bacterial biotin-acquiring strategies (biotin biosynthetic pathway and biotin transport/uptake route). (B) Two half-reactions of BirA-proceeded AccB biotinylation. (C) BioR represses biotin biosynthesis pathway in Agrobacterium tumefaciens. (D) Negative autoregulation of BioR and its repression of both biotin biosynthesis pathway and biotin transport system in Brucella. (E) Complex regulation network of biotin metabolism by two BioR proteins in P. denitrificans. KAPA, 7-keto-8-aminopelargonic acid; DAPA, 7, 8-diaminopelargonic acid; DTB, dethiobiotin; AMTOB, S-adenosyl-2-oxo-4-methylthiobutyric acid; SAM, S-adenosyl methionine. BioF, 7-keto-8-amino pelargonic acid synthase; BioA, 7,8-diaminopelargonic acid aminotransferase; BioD, dethiobiotin synthase; BioB, biotin synthase; BirA, biotin protein ligase. To the best of our knowledge, no less than three types of regulatory factors have been attributed to biotin metabolism (Beckett 2007, 2009; Brune et al. 2012; Feng et al. 2013a,b; Tang et al. 2014). First, the prototypical regulatory mechanism for bacterial biotin synthesis is derived from extensive studies with Escherichia coli (Beckett 2007; Chakravartty and Cronan 2012), in which the central player is the bi-functional BirA protein. The E. coli birA protein product is unusual, in that it not only functions as a repressor for biotin synthesis route (Barker and Campbell 1981b; Brown et al. 2004; Beckett 2007, 2009), but also acts as the enzymatic activity of biotin protein ligase (BPL) (Fig. 1B) (Barker and Campbell 1981a; Cronan 1989; Brown et al. 2004). Given the fact whether the BPL enzyme has the N-terminal DNA-binding domain or not, two groups have been categorized (Rodionov et al. 2002). Unlike Group II BPL retaining DNA-binding activity (generally referred to BirA), Group I BPL acts solely as biotin attachment enzymes due to the lacking of the N-terminal winged helix-turn-helix DNA-binding motif (Chapman-Smith and Cronan 1999; Henke and Cronan 2014). As the paradigm group II BPL, the E. coli BirA thus has the ability to physiologically sense the intracellular levels of both biotin and unbiotinylated biotin accepting protein BCCP (Cronan 1989; Beckett 2005, 2007). Moreover, the regulatory role of E. coli BirA depends on the presence of ligand biotinoyl-5′-AMP (biotinyl-adenylate), the product of the first ligase half reaction that is the intermediate of the BirA-catalyzed ligation (Fig. 1B) (Ke et al. 2012). Unlike the scenarios seen in E. coli carrying the bi-functional BirA regulatory protein, some organisms (e.g., α-proteobacteria) only encode Group I BPL with sole ligase activity, suggesting that an alternative transcription factor might exist to compensate the loss of regulatory function for the mono-functional BPL enzyme (Rodionov et al. 2002). This hypothesis was furthered by Rodionov and Gelfand (2006), using the approach of computational prediction. In 2013, we provided integrative experimental evidence that BioR, the GntR family of transcription factor, represses expression of bio operon relevant to biotin metabolism in both the plant pathogen Agrobacterium tumefaciens (Feng et al. 2013b) (Fig. 1C) and the zoonotic agent Brucella melitensis (Feng et al. 2013a) (Fig. 1D). Relative to the paradigm BirA mechanism that is a single protein model, our findings suggested a new biotin sensing machinery: the two-protein paradigm of BirA and BioR. Very recently, we and others established the second two-protein paradigm for bacterial biotin sensing, in which a new TetR-type transcription factor, referred to BioQ, is recruited in Mycobacterium smegmatis (Tang et al. 2014) and Corynebacterium glutamicum (Brune et al. 2012). Surprisingly, no direct evidence was found in supporting that DNA binding of BioR (and/or BioQ) requires the participation of biotin metabolites (Feng et al. 2013a,b; Tang et al. 2014), which is far different from scenarios seen with BirA proteins of E. coli (Brown et al. 2004; Chakravartty and Cronan 2012) and Bacillus (Henke and Cronan 2014). Paracoccus is taxonomically referred to a genus of the Rhodobacteraceae, and comprises a diversified set of species, one of which is Paracoccus denitrificans (http://en.wikipedia.org/wiki/Paracoccus) (Ludwig et al. 1993; Rainey et al. 1999). As a nonmotile coccoid soil organism from α-subdivision of the phylum proteobacteria, P. denitrificans is well known in its unusual ability of denitrification (reducing nitrate to dinitrogen), and growth under the condition of hyper gravity (Baker et al. 1998). The announcement of genomic sequences for P. denitrificans such as strain PD1222 (http://genome.jgi-psf.org/parde/parde.home.html) (Siddavattam et al. 2011) greatly facilitated the development of being a model organism for extensive investigations of molecular mechanism (endosymbiotic theory) implicated into denitrifications and possible ancestors for the eukaryotic mitochondrion (http://en.wikipedia.org/wiki/Paracoccus_denitrificans) (John and Whatley 1975). In views of genomic contents, we noted that P. denitrificans is unusual in that the gene duplication and/or redundancy (especially two BioR orthologs) is prevalent in the context of biotin metabolism, unlike the scenarios observed with its close relatives A. tumefaciens and B. melitensis (Fig. 2). Also, totally six putative BioR-recognizable palindromes were predicted (http://regprecise.lbl.gov/RegPrecise/regulon.jsp?regulon_id=53141) (Rodionov and Gelfand 2006; Feng et al. 2013a; Novichkov et al. 2013), implying unexpected complexity in BioR-mediated regulation of biotin metabolism in P. denitrificans. The question we raised is why P. denitrificans evolves such kind of complicated network for biotin metabolism and regulation. Is there any physiological/ecological requirement for this regulatory system in adaptation to its growing/inhabiting niches? Figure 2Open in figure viewerPowerPoint Genetic loci of bio operons and BioR signals. (A) Genomic organization of bio operon in plant pathogen Agrobacterium tumefaciens. (B) Genomic organization of bio operon in zoonotic pathogen Brucella melitensis. (C) Genomic organization of bio operon in Paracoccus denitrificans. (D) Sequence logo for the BioR-binidng sites. The sequence logo is generated using WebLogo (http://weblogo.berkeley.edu/logo.cgi). In this paper, we are attempting to address the above questions. We report that (1) extraordinary copies of biotin metabolism-related genes in P. denitrificans are acquired through possible events of horizontal gene transfer (HGT); (2) two BioR homologs are functional in biotin regulation/sensing; (3) unprecedent complexity is present in the BioR-mediated regulatory network for biotin metabolism (Fig. 1E). Experimental Procedures Bacterial strains and growth conditions In addition to PD1222, the wild type of P. denitrificans, all of the bacterial strains used here were E. coli K-12 derivatives (Table 1). The media are separately LB medium (10 g of tryptone, 5 g of yeast extract and 10 g of NaCl per liter), and rich broth (RBO medium; 10 g of tryptone, 1 g of yeast extract, and 5 g of NaCl per liter). Antibiotics were supplemented as follows (in mg/L): sodium ampicillin, 100; kanamycin sulfate, 50; tetracycline HCl, 15; and chloramphenicol, 20. Table 1. Strains and plasmids in this study Strains or plasmids Relevant characteristics References or origins Strains Topo10 A cloning Escherichia coli host (F−, ΔlacX74) Invitrogen BL21(DE3) An expression E. coli host Lab stock FYJ179 Agrobacterium tumefaciens NTL4 Feng et al. (2013b) FYJ284 NTL4, ΔbioR::Km, ΔbioBFDA Feng et al. (2013a,b) FYJ291 FYJ284 (NTL4, ΔbioR::Km, ΔbioBFDA) carrying pRG-PbioBat Feng et al. (2013a,b) PD1222 The wild-type strain of Paracoccus denitrificans ATCC FYJ347 Topo carrying pET28-bioRpd1 This work FYJ350 Topo carrying pET28-bioRpd2 This work FYJ351 BL21 (DE3) carrying pET28-bioRpd1 This work FYJ354 BL21 (DE3) carrying pET28-bioRpd2 This work FYJ376 FYJ291 carrying pSRKGm-bioRpd1 This work FYJ377 FYJ291 carrying pSRKGm-bioRpd2 This work Plasmids pET28(a) Commercial T7-driven expression vector, KmR Novagen pET28- bioRpd1 pET28(a) carrying P. denitrificans bioRpd1 gene, KmR This work pET28- bioRpd2 pET28(a) carrying P. denitrificans bioRpd2 gene, KmR This work pSRKGm Broad host range expression vector with the tightly regulated promoter Feng et al. (2013b) pSRK-bioRpd1 pSRKGm encoding P. denitrificans bioRpd1 gene, GmR This work pSRK-bioRpd2 pSRKGm encoding P. denitrificans bioRpd2 gene, GmR This work pRG970 Low copy transcriptional promoter-less lacZ/Gus bi-directional fusion vector, SpcR Van den Eede et al. (1992); van Dillewijn et al. (2001) pRG-PbioBat pRG970 encoding the A. tumefaciens bioBFDAZ promoter region Feng et al. (2013a,b) ATCC, American Type Culture Collection. Paracoccus denitrificans (Table 1) was grown in minimal medium containing (per liter) 6.0 g of K2HPO4, 4.0 g of KH2PO4, 0.15 g of sodium molybdate, 0.2 g of MgSO4·7H2O, 0.04 g of CaCl2, 0.001 g of MnSO4·2H2O, and 1.1 g of FeSO4·7H2O with 1.6 g of NH4Cl as the nitrogen source (Zhao et al. 2013; Kumar et al. 2014). Cultures were grown aerobically at 30°C with or without Biotin (100 mmol/L) in mineral medium supplemented with glucose (20 mmol/L) as the carbon source. Plasmids and genetic manipulations The two bioR genes (pden_1431 and pden_2922) of P. denitrificans were amplified with PCR and cloned into the expression vector pET28(a), giving the recombinant plasmids pET28-bioRpd1 and pET28-bioRpd2, respectively (Table 1). To prepare the appropriate BioR proteins, the corresponding expression plasmids (pET28-bioRpd1 and pET28-bioRpd2) were transformed into the strain BL21(DE3) (Feng and Cronan 2009b). To examine the role of bioR in vivo, the two genes were inserted into pSRKGm, the broad host range expression vector, generating the chimeric plasmids pSRKG-bioR1 and pSRKG-bioR2, respectively (Table 1). The recipient strain is a reporter strain FYJ291 we recently developed (Feng et al. 2013b), which is the ΔbioR::Km mutant of A. tumefaciens carrying pRG-PbioBat, a plasmid-borne LacZ transcriptional fusion (Table 1). All the acquired plasmids were confirmed by both PCR detection and direct DNA sequencing. Expression and purification of BioR protein Both BioR1 and BioR2 of P. denitriifcans were overexpressed using prokaryotic expression system with induction of 0.3 mmol/L isopropyl β-d-1-thiogalactopyranoside (IPTG) at 30°C for 3 h. The clarified supernatant of bacterial lysates was loaded onto a nickel-ion affinity column (Qiagen, Hilden, Germany). After removal of the contaminant proteins with wash buffer containing 50 mmol/L imidazole, the 6x His-tagged protein of interest was eluted in elution buffer containing 150 mmol/L imidazole. The purified proteins were exchanged into 1X PBS buffer (pH 7.4) containing 10% glycerol, and visualized by 15% SDS-PAGE followed by staining with Coomassie Brilliant Blue R250 (Sigma, St. Louis, MO). Of note, the BioR1 is somewhat a weird protein, in that it easily precipitates during the process of purification, which is almost similar to scenarios seen with FabR proteins (Feng and Cronan 2011). Liquid chromatography quadrupole time-of-flight mass spectrometry The identity of two versions of P. denitrificans BioR proteins (BioR1 and BioR2) was verified using A Waters Q-Tof API-US Quad-ToF mass spectrometer connected to a Waters nano Acquity UPLC (Feng and Cronan 2011). As we described before (Feng and Cronan 2011), the protein band of interest was digested with Trypsin (G-Biosciences St. Louis, MO), and the resultant peptides were loaded on a Waters Atlantis C-18 column (0.03 mm particle, 0.075 × 150 mm). The dependently acquired data were further subjected to the ms/ms analyses. Electrophoretic mobility shift assays To test the functions of the predicted BioR-binding sites of P. denitrifican, gel shift assays were adopted as we described earlier (Feng and Cronan 2009b, 2010, 2011). In addition to the known probe bioBFDAZ_ at six more sets of DNA probes were prepared by annealing two complementary oligonucleotides (Table 2). These probes included bioR1_pd probe, bioR2_pd probe, bioYB_pd1 probe, bioYB_pd2 probe, bioBFDAGC_pd1 probe, and bioBFDAGC_pd2 probe, respectively (Table 2). In the gel shift experiments, the digoxigenin-labeled DNA probes (~0.2 pmol) were incubated with the purified BioR protein (note: crude extract used for BioR1) in the binding buffer (Roche, Indianapolis, IN, USA) for 15 min at room temperature. When required, the cold probe (and/or biotin metabolites) was supplemented into the gel shift assays. The DNA–protein mixtures were separated with the native 7% PAGE, and transferred onto the nylon membrane via the direct contact gel transfer. Finally, the chemical-luminescence signals were captured through the exposure of the membrane to ECL films (Amersham, GE Healthcare, Piscataway, NJ, USA). Table 2. Primers used in this study Primers Sequences (5′-3′) bioR1pd-F (BamHI) CG GGATCC ATG AAA CAC GCC CCT GAA GAG bioR1pd-R (XhoI) CCG CTCGAG TTA TCC GGG AAT CTC GTA AGT C bioR2pd-F (BamHI) CG GGATCC ATG AGC GCA GGT TCC GAA GAA bioR2pd-R (SalI) CCG GTCGAC TTA GCC GTG GAT GGC GAA GG Pden1431rt-F GGC GAC AAT GCC AGT ACC Pden1431rt-R AGG ATG ATC CGG TGA AAA TG Pden1432rt-F GCT ATC TGG CGG GCT ATC T Pden1432rt-R GAG GCC GAG GGC ATA GAC Pden1433rt-F AGCCTGCTCAGCATCAAGAC Pden1433rt-R GGATTGCGAGCAATAGCC Pden2916rt-F CTACAACCACAATATCGACACCTC Pden2916rt-R ATCCGGTCCTGGAAGGTC Pden2917rt-F CCTGGTGGTCCATGATGC Pden2917rt-R GGCATCGTTATGGGCAAA Pden2918rt-F GGCACCTGCTCTATTTGCAG Pden2918rt-R CGACAGCAGCGAATGGTT Pden2919rt-F GGGGCATGTGGTTCTATCAC Pden2919rt-R GCGATCTCGTCGAAAATCAG Pden2922rt-F TTCGGCGCCAGCCACGTCCCGGTGC Pden2922rt-R GTGCGGCGCGGCATGGCGCAGGG Pden16Srt-F AGGCCCTAGGGTTGTAAAGC Pden16Srt-R GGGGCTTCTTCTGCTGGTA bioB_at probe-F CTC TCT TGA GGA GGC AAA AAT TAT CTA TAA TTT GCC ATT TAA CGA CCT GC bioB_at probe-R GCA GGT CGT TAA ATG GCA AAT TAT AGA TAA TTT TTG CCT CCT CAA GAG AG bioR1-probe-Fa GGT GCA GCA TGA ATT ATC TAT AAT TCA TGA AAC ACG bioR1-probe-Ra CGT GTT TCA TGA ATT ATA GAT AAT TCA TGC TGC ACC bioYB-probe1-Fa GAT TCC CGG ATA ATT ATC TAT AAA CCT AAT TGC CAG bioYB-probe1-Ra CTG GCA ATT AGG TTT ATA GAT AAT TAT CCG GGA ATC bioYB-probe2-Fa CAA AGC CTT CGT AAT TAT AGA TAG ACT CGA TAC CTA TC bioYB-probe2-Ra GAT AGG TAT CGA GTC TAT CTA TAA TTA CGA AGG CTT TG bioBFDAGC-probe-Fb GGC GCT GAC CGT TTT ATA GAT ACT TCC ACA TGA GGC bioBFDAGC-probe-Rb GCC TCA TGT GGA AGT ATC TAT AAA ACG GTC AGC GCC The underlined sequences in italics are restriction sites, and the bold letters denote the predicted BioR-binding sites. a The genetic locus of genes (bioR1 and/or bioBY) is localized on Chromosome I. b The operon of bioBFDAGC is localized on Chromosome II. β-Galactosidase assays Bacterial samples stripped out of the MacConkey agar plates were suspended in Z-buffer and subjected to direct measurement of β-galactosidase activity (Miller 1992; Feng and Cronan 2009a,b). The data were recorded in triplicate more than three independent assays. Real-time quantitative polymerase chain reaction Cells were grown overnight in minimal media without biotin. This was used as an inoculum to inoculate 10 mL of fresh minimal media. Cells were grown upto 0.5 OD600 and pelleted and washed with minimal media. Cells were resuspended in 10 mL minimal media and divided into two 5 mL portions. A quantity of 100 nmol/L biotin was added into one portion. Cells were collected at 1/3 h for RNA isolation. Quantitative real-time PCR was performed as previously described (Pfaffl 2001). Cells were harvested at different OD600, and RNA was extracted using RNeasy protect kit (Qiagen) according to the manufacturer's recommendations. Total RNA was resuspended in PCR-grade nuclease-free water, and RNA quality and concentration were estimated by optical density measurement, using the Nanodrop 2000 (Thermo Fisher Scientific, San Jose, CA, USA). Each sample of 500 ng total RNA was reverse transcribed, using the First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany). Real-time PCR reactions were carried out on a LightCycler 480 (Roche) using the SYBR Green detection format. Change in the expression was calculated relative to the expression of 16S rRNA. After each PCR run, a melting curve analysis was carried out to control for production of primer dimers and/or nonspecific PCR products. Fold change in mRNA expression during treatment was calculated using the crossing point (Cp) for each sample and the efficiency (Eff) of each transcript, using the formula (Efftarget gene)ΔCp/(Effhousekeeping gene)ΔCp. The fold change was estimated relative to 16SrRNA. Bioinformatic analyses The protein sequences of BioR regulators are derived from A. tumefaciens, B. melitensis, and P. denitrificans. The BioR-binding sites were all sampled from RegPrecise database (http://regprecise.lbl.gov/RegPrecise/regulon.jsp?regulon_id=53141). The multiple alignment of protein (and/or DNA) was performed with the program of ClustalW2 (http://www.ebi.ac.uk/Tools/clustalw2/index.html), and the final output of BLAST photography was given after being processed by the program ESPript 2.2 (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi). The sequence logo of the BioR-specific sites is generated using WebLogo (http://weblogo.berkeley.edu/logo.cgi). Transcription start sites of the bio operons were predicted using the method of Neutral Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html). Orthologs of BioB, BioR, and BioY proteins were identified by a procedure based on the analysis of phylogenetic trees for protein domains in MicrobesOnline (Dehal et al. 2010). Multiple protein alignments were done using MUSCLE tool (Edgar 2004a,b). Phylogenetic trees were constructed by the maximum-likelihood method with default parameters implemented in PhyML-3.0 (Guindon et al. 2010) and visualized using Dendroscope (Huson et al. 2007). Results and Discussion Complexity in biotin metabolism of P. denitrificans The situation of genetic organization in P. denitrificans seemed to be unusual in that the gene duplication and/or redundancy is present in the context of biotin metabolism and regulation, which is far different from those of its two close-related cousins A. tumefaciens and B. melitensis (Fig. 2 A–C). In addition to the megaplasmid (~0.65 Mb), P. denitrificans also carries two chromosomes (designated as Ch-I (~2.85 Mb) and Ch-II (~1.73 Mb), Fig. 2C). The bio operons in P. denitrificans included bioYB2 on Ch-1, bioBFDAGC on Ch-II, and bioMNY2 encoded by the megaplasmid, respectively (Fig. 2C). Unlike the A. tumefaciens and B. melitensis both of which encode only one BioR repressor (Fig. 2A and B), P. denitrificans has two BioR orthologs (Pden_1431 for BioR1, and Pden_2922 for BioR2) separately scattered on the two chromosomes (Fig. 2C) (Rodionov and Gelfand 2006). Additionally, P. denitrificans also has two bioB homologs (one is located in the bioBFDAGC operon, the other is encoded by the bioYB2 operon) and two bioY paralogs (one is located in the bioYB2 operon, the other is encoded by the bioMNY2 operon) (Fig. 2C) (Rodionov and Gelfand 2006). In much similarity to the scenario seen with B. melitensis bioR (Fig. 2B) (Feng et al. 2013a), the two bioR homologs of P. denitrificans each has a putative BioR-specific palindrome in front of their coding sequences (Fig. 2C and D), suggesting the possibility of autoregulation. No putative BioR-binding site was detected in the plasmid-borne bioMNY2 operon (Fig. 2C), which is in much consistency with the scenario with the A. tumefaciens bioMNY (Fig. 2A) (Feng et al. 2013b). In contrast, the other bioY-containing operon bioYB seemed likely to be controlled by the BioR regulator, in that it has two tandem BioR-recognizable sites (Fig. 2C and D). As anticipated, the bioBFDAGC operon, a major gene cluster encoding the full de novo biotin synthesis pathway also has two tandem BioR-binding sites (Fig. 2C), which is almost identical to the observation with B. melitensis bioBFDAZ (Fig. 2B) (Feng et al. 2013a), but little bit different from that of the A. tumefaciens counterpart having only one palindrome for the BioR protein (Fig. 2A) (Feng et al. 2013b). Of particular note, the bioZ gene is replaced with bioGC in this case (Fig. 2A–C). Given the fact that two BioR homologs and 6 BioR-recognizable sites (representing 4 target genes/operons) coexist, we concluded that the BioR-mediated regulatory network in P. denitrifican is of unusual complexity (Fig. 1E). Tracing origins of bio operons/genes of P. denitrificans Since the situation of bio operons/genes is pretty unusual in P. denitrificans, we are interested in tracing the origins of these genes esp. the duplicated cousins. The BLAST analyses revealed that the bio operons/genes of P. denitrificans can match no less than eight different species, including the plant pathogen Xylella fastidiosa and the marine bacteria Celeribacter indicus (Table 3). Of being noteworthy, the P. denitrificans bioG is completely identical to the X. fastidiosa counterpart at the level of nucleotide acids (Table 3). Systematic comparison of the GC contents showed that (1) bioR2 (pden_2922) with the GC percentage of 72.52% (but not bioR1 (pden_1431) with 66.36% of GC percentage) is significantly higher than that of the average GC% of the chromosome (66.7–66.8%); (2) bioY1 (pden_1431) with the 71.86% of GC percentage (but not bioY2 (pden_5033) with the GC percentage of 68.92%) is appreciably higher than that of the average GC% of the chromosome/megaplasmid (66.7–67.1%); (3) the group I BPL-encoding gene birA (pden_2230) exhibits the GC ratio of 72.6%, much higher than that of the Chromosome II (66.8%); (4) most of genes encoding the biotin synthesis pathway consistently showed higher GC% (74.37% for bioF, 74.06% for bioD, 71.18% for bioA, and 75.13% for bioC) than that of Chromosome II (66.8%), except that bioG presents 54.64%, the lowest GC% amongst the bio genes (Table 3). Obviously, the above observations might indicate the possibility for HGT in the context of biotin metabolism-related gene clusters/operons. We anticipated that the heterogeneity (heterogeneous origins) somewhat is in part (if not all) why P. denitrificans evolves such kind
Referência(s)