Protonation of a Neutral (S)-β-Bisabolene Intermediate Is Involved in (S)-β-Macrocarpene Formation by the Maize Sesquiterpene Synthases TPS6 and TPS11
2008; Elsevier BV; Volume: 283; Issue: 30 Linguagem: Inglês
10.1074/jbc.m802682200
ISSN1083-351X
AutoresTobias G. Köllner, Christiane Schnee, Sheng‐Hong Li, Aleš Svatoš, Bernd Schneider, Jonathan Gershenzon, Jörg Degenhardt,
Tópico(s)Microbial Natural Products and Biosynthesis
ResumoTerpene synthases are responsible for the large diversity of terpene carbon skeletons found in plants. The unique, carbocationic reaction mechanism of these enzymes can form multiple products from a single prenyl diphosphate substrate. Two maize genes were isolated that encode very similar sesquiterpene synthases, TPS6 and TPS11, which both produce β-bisabolene, a common monocyclic sesquiterpene, and β-macrocarpene, an uncommon bicyclic olefin. Investigation of the reaction mechanism showed that the formation of β-macrocarpene proceeds via a neutral β-bisabolene intermediate and requires reprotonation by a proton that may ultimately be abstracted from water. This reprotonation is dependent on the pH and the presence of a Mg2+ cofactor. Mutational analysis of the enzyme demonstrated that a highly conserved tyrosine residue in the active center of the enzymes is important for the protonation process. TPS6 and TPS11 are transcribed both in leaves and roots of maize, but the respective terpene products were only detected in roots. The expression in roots was up-regulated by herbivore damage to the leaves, suggesting a long distance signal transduction cascade between leaves and roots. Terpene synthases are responsible for the large diversity of terpene carbon skeletons found in plants. The unique, carbocationic reaction mechanism of these enzymes can form multiple products from a single prenyl diphosphate substrate. Two maize genes were isolated that encode very similar sesquiterpene synthases, TPS6 and TPS11, which both produce β-bisabolene, a common monocyclic sesquiterpene, and β-macrocarpene, an uncommon bicyclic olefin. Investigation of the reaction mechanism showed that the formation of β-macrocarpene proceeds via a neutral β-bisabolene intermediate and requires reprotonation by a proton that may ultimately be abstracted from water. This reprotonation is dependent on the pH and the presence of a Mg2+ cofactor. Mutational analysis of the enzyme demonstrated that a highly conserved tyrosine residue in the active center of the enzymes is important for the protonation process. TPS6 and TPS11 are transcribed both in leaves and roots of maize, but the respective terpene products were only detected in roots. The expression in roots was up-regulated by herbivore damage to the leaves, suggesting a long distance signal transduction cascade between leaves and roots. Terpenes form the largest group of plant secondary metabolites and are known to have a plethora of different functions both within the plant and in communication with other organisms. Most of the structural diversity among terpenes can be attributed to the terpene synthases, a large enzyme class that catalyzes the conversion of the ubiquitous prenyldiphosphates geranyldiphosphate (GPP), 2The abbreviations used are: GPP, geranyldiphosphate; FPP, farnesyldiphosphate; GGPP, geranylgeranyldiphosphate; TEAS, 5-epi-aristolochene synthase; GC, gas chromatography; MS, mass spectrometry; ORF, open reading frame. farnesyldiphosphate (FPP), or geranylgeranyldiphosphate (GGPP) into a large number of basic terpene skeletons (1Gershenzon J. Kreis W. Biochemistry of Plant Secondary Metabolism: Annual Plant Reviews. 2. Sheffield Academic Press, Sheffield, UK1999: 222-299Google Scholar). A unique feature of terpene synthases is their capability to produce multiple products with different carbon skeletons from a single prenyldiphosphate substrate (2Croteau R. Chem. Rev. 1987; 87: 929-954Crossref Scopus (487) Google Scholar, 3Cane D.E. Chem. Rev. 1990; 90: 1089-1103Crossref Scopus (422) Google Scholar). For example, δ-selinene synthase and γ-humulene synthase from Abies grandis synthesize 34 and 52 different sesquiterpenes from their farnesyl diphosphate substrate, respectively (4Steele C.L. Crock J. Bohlmann J. Croteau R. J. Biol. Chem. 1998; 273: 2078-2089Abstract Full Text Full Text PDF PubMed Scopus (351) Google Scholar). This unusual behavior is due to an electrophilic reaction mechanism common to all terpene synthases, which is initiated by elimination of the allylic diphosphate from the prenyl diphosphate substrate. The resulting highly reactive carbocationic intermediate undergoes a series of cyclizations, hydride shifts, and other rearrangements until the reaction is terminated by proton loss or the addition of a nucleophile (5Cane D.E. Comprehensive Natural Products Chemistry. 2. Elsevier, Amsterdam1999: 155-200Google Scholar). In addition to highly active, carbocationic intermediates, sesquiterpene synthases like 5-epi-aristolochene synthase (TEAS) from tobacco were also shown to produce stable, enzyme-bound intermediates (6Cane D.E. Prabhakaran P.C. Oliver J.S. McIlwaine D.B. J. Am. Chem. Soc. 1990; 112: 3209-3210Crossref Scopus (69) Google Scholar, 7Facchini P.J. Chappell J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 11088-11092Crossref PubMed Scopus (217) Google Scholar). The structural elucidation of this sesquiterpene synthase provided insight into the reaction mechanism and structure-function relationships in the active center (8Starks C.M. Back K.W. Chappell J. Noel J.P. Science. 1997; 277: 1815-1820Crossref PubMed Scopus (588) Google Scholar). The reaction starts with the dephosphorylation and ionization of the (E,E)-FPP substrate to form a farnesyl cation, which undergoes a 1,10-cyclization to form a stable, enzyme-bound germacrene A intermediate (3Cane D.E. Chem. Rev. 1990; 90: 1089-1103Crossref Scopus (422) Google Scholar). Based on the crystal structure of TEAS, a catalytic triad consisting of a central tyrosine residue (Tyr520) and two aspartate residues (Asp444 and Asp525) was proposed to be involved in the protonation of the germacrene A intermediate (8Starks C.M. Back K.W. Chappell J. Noel J.P. Science. 1997; 277: 1815-1820Crossref PubMed Scopus (588) Google Scholar). In this model, a proton, which is abstracted from carbon atom 13 of the germacrenyl cation to form the neutral intermediate germacrene A, is transferred via the carboxyl group of aspartate 525 and hydroxyl group of tyrosine 520 back to a different position (C6) on the same carbon skeleton to form a second germacrenyl cation (8Starks C.M. Back K.W. Chappell J. Noel J.P. Science. 1997; 277: 1815-1820Crossref PubMed Scopus (588) Google Scholar). An electrophilic attack on C2 results in a second cyclization and a Wagner-Meerwein rearrangement of a methyl group to form the eudesmane-type skeleton. Mutagenesis of tyrosine 520 to phenylalanine resulted in an enzyme that released only germacrene A (9Rising K.A. Starks C.M. Noel J.P. Chappell J. J. Am. Chem. Soc. 2000; 122: 1861-1866Crossref Scopus (107) Google Scholar). A similar protonation of an intermediate was postulated for the 5-epi-aristolochene synthase from Capsicum annuum (10Back K. Chappell J. J. Biol. Chem. 1995; 270: 7375-7381Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar), a valencene synthase from Citrus sinensis (11Sharon-Asa L. Shalit M. Frydman A. Bar E. Holland D. Or E. Lavi U. Lewinsohn E. Eyal Y. Plant J. 2003; 36: 664-674Crossref PubMed Scopus (178) Google Scholar), and a β-selinene synthase from Ocimum basilicum (12Iijima Y. Davidovich-Rikanati R. Fridman E. Gang D.R. Bar E. Lewinsohn E. Pichersky E. Plant Physiol. 2004; 136: 3724-3736Crossref PubMed Scopus (204) Google Scholar), but this has not been experimentally demonstrated. Terpene production is not only dependent on the path of the terpene synthase reaction but also on the expression and evolutionary history of these enzymes within the plant. To investigate all of these aspects of terpene production, we have been isolating and characterizing a family of terpene synthases in maize, a genetically tractable organism. Maize produces complex, tissue-specific blends of terpenes that have multiple roles in defense against herbivore enemies both above and below ground (13Rasmann S. Kollner T.G. Degenhardt J. Hiltpold I. Toepfer S. Kuhlmann U. Gershenzon J. Turlings T.C.J. Nature. 2005; 434: 732-737Crossref PubMed Scopus (965) Google Scholar, 14Schnee C. Kollner T.G. Held M. Turlings T.C.J. Gershenzon J. Degenhardt J. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 1129-1134Crossref PubMed Scopus (434) Google Scholar, 15Kollner T.G. Held M. Lenk C. Hiltpold I. Turlings T.C.J. Gershenzon J. Degenhardt J. Plant Cell. 2008; 20: 482-494Crossref PubMed Scopus (358) Google Scholar). Here, we describe the very similar sesquiterpene synthases TPS6 and TPS11, which both produce β-bisabolene and β-macrocarpene. The formation of the unusual bicyclic sesquiterpene β-macrocarpene proceeds via a neutral β-bisabolene intermediate. The reprotonation requires a proton that may be ultimately abstracted from water and is transferred directly or indirectly via another proton donor to the substrate. Plant and Insect Material—Plants of the maize (Zea mays L.) variety B73 (KWS seeds, Einbeck, Germany) were grown in commercially available potting soil in a climate-controlled chamber with a 16-h photoperiod, 1 mmol (m2)–1 s–1 of photosynthetically active radiation, a temperature cycle of 22 °C/18 °C (day/night), and 65% relative humidity. 12–15-day-old plants (20–30 cm high, 4–5 expanded leaves) were used in all experiments. Eggs of Spodoptera littoralis Boisd. (Lepidoptera: Noctuidae) were obtained from Aventis (Frankfurt, Germany) and were reared on an artificial wheat germ diet (Heliothis mix; Stonefly Industries, Bryan, TX) for about 10–15 days at 22 °C under an illumination of 750 μmol (m2)–1 s–1. For the S. littoralis treatments, three third instar larvae were enclosed on the middle portion of each plant in a cage made out of two halves of a Petri dish (9-cm diameter) with a circle cut out of each side and covered with gauze to allow for ventilation (16Degenhardt J. Gershenzon J. Planta. 2000; 210: 815-822Crossref PubMed Scopus (115) Google Scholar). Isolation of the Maize Terpene Synthase cDNAs—Sequences with high similarity to plant terpene synthases were identified in BLAST searches of the Plant Genome Database PlantGDB (available on the World Wide Web). Two of these expressed sequence tags showing a high sequence similarity to each other were cloned, sequenced, and extended toward the 5′-end by the Marathon RACE procedure (Clontech) with a cDNA library from herbivore-induced leaves of the maize cultivar B73. The resulting sequences were amplified with the primers H8fwd (TATGGCTGCCCCAACACTAACTACAGA) and H10rev (GATCCTTCACATGAGTAC CGGCTTCACATAAAG) from a cDNA and introduced into the sequencing vector pCR®4-TOPO® (Invitrogen). Sequence alignments were performed with the DNASTAR suite of programs (DNASTAR, Madison, WI). The cDNA sequences contained open reading frames of 1647 bp and were deposited in GenBank™ with the accession numbers AY518315 (tps6-B73) and EU716166 (tps11-B73). cDNA RACE Library Construction—10-day-old maize plants of the cultivar Delprim were subjected to herbivory by S. littoralis for 4 h. 1 g of leaf material was ground in a mortar to a fine powder in liquid nitrogen and added to 10 ml of Trizol reagent (Invitrogen). The mixture was treated with a Polytron homogenizer (Kinematika AG, Switzerland) for 1 min and incubated for 3 min on ice. Total RNA was isolated according to the manufacturer's instructions. From about 80 μg of total RNA, the mRNA was isolated utilizing poly(T)-coated ferromagnetic beads (Dynal, Sweden). The mRNA was transcribed into cDNA while constructing a Marathon RACE library according to the manufacturer's instructions (Clontech). Mapping of Terpene Synthase Genes—The method of Burr and Burr (17Burr B. Burr F.A. Trends Genet. 1991; 7: 55-60Abstract Full Text PDF PubMed Scopus (207) Google Scholar) was utilized to map the genes tps6 and tps11 in a population of 48 CM37xT232 and 41 Tx303xCO159 recombinant inbred lines kindly provided by R. Burr. Genomic Southern blots from all individuals of the population were probed with a 1200-bp fragment of tps6-B73 that cross-reacted with tps11 (for a detailed description of the probe, see the Northern blotting procedure below). Protein Overexpression and Enzyme Assay—For expression in Eschericha coli, the open reading frames (ORFs) of tps6 and tps11 were amplified with the primers H24fwd (ATGGTAACCTGCA TTAGCGCATGGCTGCCCCAACACTAACTA) and H25rev (ATGGTAACCTGCATTATATCACATGAGTACCGGCTTCACATAAAG) and cloned as BspMI fragments into the expression vector pASK-IBA7 (IBA GmbH, Göttingen, Germany). The constructs were introduced into the E. coli strain TOP10 (Invitrogen) and fully sequenced to avoid errors introduced by DNA amplification. Liquid cultures of the bacteria harboring the expression constructs were grown at 37 °C to an A600 of 0.6. Expression was induced by the addition of anhydrotetracycline (IBA GmbH) to a final concentration of 200 μg/liter. After a 20-h incubation at 18 °C, the cells were collected by centrifugation and disrupted by a 4 × 30-s treatment with a sonicator (Bandelin UW2070, Berlin, Germany) in chilled extraction buffer (50 mm Mops, pH 7.0, with 5 mm MgCl2, 5 mm sodium ascorbate, 0.5 mm phenylmethylsulfonyl fluoride, 5 mm dithiothreitol, and 10% (v/v) glycerol). The cell fragments were removed by centrifugation at 14,000 × g, and the supernatant was desalted into assay buffer (10 mm Mops, pH 7.0, 1 mm dithiothreitol, 10% (v/v) glycerol) by passage through a Econopac 10DG column (Bio-Rad). To determine the catalytic activity of the recombinant proteins, enzyme assays containing 20 μl of the bacterial extract and 80 μl of assay buffer with 10 μm substrate (either GPP, (E,E)-FPP, (Z,E)-FPP, or GGPP), 10 mm MgCl2, 0.2 mm NaWO4, and 0.1 mm NaF in a Teflon-sealed, screw-capped 1-ml GC glass vial were performed. A SPME (solid phase microextraction) fiber consisting of 100 μm polydimethylsiloxane (SUPELCO, Belafonte, PA) was placed into the headspace of the vial for 30 min of incubation at 30 °C. For analysis of the adsorbed reaction products, the SPME fiber was directly inserted into the injector of the gas chromatograph. For product identification by NMR, four assays each containing 300 μl of bacterial extract, 218 μg of (E,E)-FPP, 10 mm MgCl2, 0.2 mm NaWO4, and 0.1 mm NaF in a total volume of 600 μl of assay buffer were overlaid with 500 μl of n-pentane and incubated for 5 h at 25°C. The reaction products were extracted three times by mixing with each 500 μl of n-pentane. The n-pentane phases were merged and passed through a silica column to remove traces of farnesol and other oxygenated extraction products. For the determination of substrate Km values, an assay containing 10 μm [1-3H]geranyl or [1-3H](E,E)-farnesyl diphosphate (37 GBq mol–1; American Radiolabeled Chemicals, St. Louis, MO), 10 mm MgCl2, and 0.05 mm MnCl2 in 100 μl of assay buffer was used. The assay was overlaid with 1 ml of n-pentane to trap volatile products and incubated for 15 min at 30 °C. The reaction was stopped by mixing, and 0.5 ml of the n-pentane layer was taken for measurement of radioactivity by liquid scintillation counting in 2 ml of Lipoluma mixture (Packard Bioscience, Groningen, The Netherlands) using a Packard Tricarb 2300TR liquid scintillation counter (3H efficiency = 61%). The Km values for the cofactors Mg2+ and Mn2+ and the influence of different metal ion cofactors on enzyme activity were measured with 10 μm (E,E)-FPP. The Km values were determined using seven substrate concentrations with four repetitions each. Assay results are reported as the mean of three independent replicate assays, and each experiment was repeated 2–3 times with similar results. The enzyme activity was linear for at least 30 min and stable for at least 1 year when stored at –80 °C. To analyze the protonation reaction, 100-μl aliquots of E. coli extract containing recombinant TPS6 were desalted in assay buffer, lyophilized, and dissolved in 100 μl of D2O (Merck) or 100 μl of H2O, respectively. The freshly dissolved protein samples were immediately analyzed in enzyme assays containing 100 μl of extract, 10 μm (E,E)-FPP, and 10 mm MgCl2. The assays were incubated for 15 min at 30 °C. The reaction products were collected by SPME and analyzed by GC-MS. Gas Chromatography—A Hewlett-Packard model 6890 gas chromatograph was employed with the carrier gas helium at 1 ml min–1, splitless injection (injector temperature 220 °C, injection volume 1 μl), a DB-WAX column (polyethylene glycol, 30 m × 0.25 mm inner diameter × 0.25 μm film thickness; J & W, Folsom, CA) or a Chrompack CP-SIL-5 CB-MS column ((5% phenyl)-methylpolysiloxane, 25 m × 0.25 mm inner diameter × 0.25 μm film thickness; Varian), and a temperature program from 40 °C (3-min hold) at 5 °C min–1 to 240 °C (3-min hold). The coupled mass spectrometer was a Hewlett-Packard model 5973 with a quadrupole mass selective detector, transfer line temperature 230 °C, source temperature 230 °C, quadrupole temperature 150 °C, ionization potential 70 eV, and a scan range of 40–350 atomic mass units. Products were identified by comparison of retention times and mass spectra with authentic reference compounds as described by Köllner et al. (18Kollner T.G. Schnee C. Gershenzon J. Degenhardt J. Plant Cell. 2004; 16: 1115-1131Crossref PubMed Scopus (193) Google Scholar). Quantification was performed with the trace of a flame ionization detector operated at 250 °C. A nonyl acetate internal standard was utilized to determine the average and S.E. of 3–6 independent samples. The enantiomers of β-bisabolene were separated and identified by GC-MS using a heptakis (2,3-di-O-methyl-6-O-t-butyldimethylsilyl)-β-cyclodextrin (35% in OV1701, w/w) column (30 m × 0.25 mm × 0.125-μm film; BGB Analytik, Adliswil, Switzerland) operated with helium (2 ml min–1) as carrier gas, splitless injection (220 °C, 2-μl volume), and a column temperature of 115 °C. A racemic mixture of (S)- and (R)-β-bisabolene was prepared by dehydration of racemic α-bisabolol at 140 °C with acidic aluminum oxide as catalyst (19Konig W.A. Rieck A. Hardt I. Gehrcke B. Kubeczka K.H. Muhle H. J. High Resolut. Chromatogr. 1994; 17: 315-320Crossref Scopus (71) Google Scholar). The β-bisabolene enantiomers were identified by comparison with the bergamot (Citrus bergamia) essential oil, which contains only the (S)-enantiomer. The β-macrocarpene was kindly provided as an authentic standard by L. Cool (20Cool L.G. Phytochemistry. 2005; 66: 249-260Crossref PubMed Scopus (39) Google Scholar). The enantiomers of β-macrocarpene were separated and identified by GC-MS performed with a Hewlett Packard HP6890 gas chromatograph interfaced to a MasSpec 2 magnetic sector mass spectrometer (Micromass, Manchester, UK) using a heptakis (2,3-di-O-methyl-6-O-t-butyldimethylsilyl)-β-cyclodextrin (35% in OV1701, w/w) column (30 m × 0.25 mm × 0.125-μm film; BGB Analytik). Helium was used as a carrier gas (constant flow 1 ml min–1), and samples were injected split (1 ml) at 200 °C. Compounds were eluted with a temperature program: 40 °C for 2 min, heated at 3 °C/min to 200 °C with 5-min hold. Electron ionization-MS data were recorded in positive ion mode using 70 eV ionization energy. Nuclear Magnetic Resonance Spectroscopy—1H NMR, 1H,1H COSY, HMBC, and HMQC spectra were measured at 300 K on a Bruker Avance 500 NMR spectrometer (Bruker Biospin, Rheinstetten, Germany) using a cryogenically cooled 5-mm TXI 1H{13C} probe. The operating frequency was 500.13 MHz for acquisition of 1H NMR and 125.75 MHz for 13C NMR spectra. Benzene-d6 was used as a solvent, and tetramethyl siloxane was used as an internal standard. Analytical Data—(–)-β-Macrocarpene: 1H NMR (500 MHz, benzene-d6): δ 5.46 (1H, br m, H-5), 5.42 (1H, br m, H-12), 2.07 (2H, m, H-6), 2.04 (1H, m, H-1), 2.03 (2H, m, H-11), 1.97 (1H, m, H-3a), 1.88 (1H, m, H-3b), 1.73 (1H, m, H-2a), 1.69 (2H, m, H-8), 1.65 (3H, br s, H-15), 1.48 (1H, m, H-2b), 1.29 (2H, t, J = 6.8 Hz, H-10), 0.919 (3H, s, H-14), 0.915 (3H, s, H-13). 13C NMR (125 MHz, benzene-d6, data obtained from HSQC and HMBC spectra): δ 141.3 (C-7), 133.5 (C-4), 121.6 (C-5), 118.3 (C-12), 41.7 (C-1), 40.9 (C-8), 35.7 (C-10), 31.1 (C-6), 31.0 (C-3), 29.2 (C-9), 28.5 (C-14), 28.3 (C-13), 28.2 (C-2), 23.8 (C-15), 23.6 (C-11). Electron ionization-MS m/z (relative intensity): 204 (47) [M]· +189 (27) [M-CH3]+, 175 (10), 162 (9) [M-C3H6]·+, 148 (16) [M-C4H8]·+, 136 (83) [M-C5H10] +, 121 (67), 107 (53), 105 (20), 95 (25), 94 (34), 93 (100), 92 (37), 81 (16), 80 (53), 79 (49), 77 (16), 69 (14), 67 (18), 65 (9), 55 (18), 53 (13). The numbering of the β-macrocarpene carbon atoms refers to that described previously (20Cool L.G. Phytochemistry. 2005; 66: 249-260Crossref PubMed Scopus (39) Google Scholar). Site-directed Mutagenesis—For site-directed mutagenesis, the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) was used according to the manufacturer's instructions. The PCR-based mutagenesis protocol was performed with the tps11-B73 cDNA cloned into the expression vector pASK-IBA7 and primers containing the desired mutations (Y522F-fwd, CTGTAGACTACATGTTCAAGGAAGCTGATAAG; Y522F-rev, CTTATCAGCTTCCTTGAACATGTAGTCTACAG; D526N-fwd, CATGTACAAGGAAGCTAATAAGTACACTGTCTC; D526N-rev, GAGACAGTGTACTTATTAGCTTCCTTGTACATG). The mutagenized constructs were fully sequenced. RNA Hybridization—Plant RNA was prepared with the RNeasy plant minikit (Qiagen, Hilden, Germany) according the manufacturer's instructions. A 1200-bp fragment was used as a probe, generated by linear PCR with the primer 5′-CACCAGTGTACCTCCAATGCTTATGAGT-3′ and the complete ORF as a template. The probe was labeled with [32P]adenosine triphosphate using the Strip-EZ PCR procedure (Ambion, TX). Blotting on a Nytran-Plus nylon membrane (Schleicher & Schuell), hybridization, and washing were carried out following standard procedures. The blots were exposed to BioMax MS1 film (Eastman Kodak Co.) with an intensifying screen. Terpene Extraction—The plant material was harvested, frozen in liquid nitrogen, and ground to a fine powder in a mortar. 3 g of tissue were extracted with 10 ml of n-pentane for 1 h at room temperature with constant rotation. After centrifugation at 1800 × g for 5 min to sediment the tissue, 800 ng of nonyl acetate were added to the n-pentane supernatant as an internal standard, and the solution was cleared with 25 mg of activated charcoal. The n-pentane was concentrated under a stream of nitrogen to a volume of 200 μl and stored at –20 °C overnight to remove waxes and other high molecular weight lipids by precipitation. The n-pentane phase containing the terpenes was analyzed by GC-MS and GC-flame ionization detection. Isolation of the Maize Terpene Synthase Genes tps6 and tps11—The identification and biochemical characterization of terpene synthases in maize is crucial to our understanding of terpene-based plant defense reactions in this species. We have already characterized tps1, tps4, tps5, tps10, and tps23 (14Schnee C. Kollner T.G. Held M. Turlings T.C.J. Gershenzon J. Degenhardt J. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 1129-1134Crossref PubMed Scopus (434) Google Scholar, 15Kollner T.G. Held M. Lenk C. Hiltpold I. Turlings T.C.J. Gershenzon J. Degenhardt J. Plant Cell. 2008; 20: 482-494Crossref PubMed Scopus (358) Google Scholar, 18Kollner T.G. Schnee C. Gershenzon J. Degenhardt J. Plant Cell. 2004; 16: 1115-1131Crossref PubMed Scopus (193) Google Scholar, 21Schnee C. Kollner T.G. Gershenzon J. Degenhardt J. Plant Physiol. 2002; 130: 2049-2060Crossref PubMed Scopus (208) Google Scholar). To identify additional terpene synthases, we screened the public maize sequence data base PlantGDB for sequences with similarity to these genes. Two of the identified sequences were extended by RACE PCR to obtain the complete ORFs. The resulting ORFs (1,647 nucleotides each) were amplified from cDNA of the maize inbred line B73 and designated tps6-B73 and tps11-B73. The genes have 96% nucleotide identity to each other (Fig. 1). The gene tps6-B73 also shares 99% nucleotide identity with umi2, a gene with unknown function previously isolated from the maize variety Early Golden Bantam (22Basse C.W. Plant Physiol. 2005; 138: 1774-1784Crossref PubMed Scopus (87) Google Scholar). Most likely, tps6-B73 and umi2 are alleles of each other. The deduced amino acid sequences of TPS6 and TPS11 contain the highly conserved terpene synthase sequence elements DDXXD (residues 302–306) and RXR (residues 265–267) (Fig. 1). No signal peptide was apparent in the N-terminal region of the proteins, indicating that both enzymes are located in the cytoplasm and likely to be sesquiterpene synthases (1Gershenzon J. Kreis W. Biochemistry of Plant Secondary Metabolism: Annual Plant Reviews. 2. Sheffield Academic Press, Sheffield, UK1999: 222-299Google Scholar). Mapping of tps6 and tps11 within a population of T232xCM37 and CO159xTx303 inbred lines (17Burr B. Burr F.A. Trends Genet. 1991; 7: 55-60Abstract Full Text PDF PubMed Scopus (207) Google Scholar) displayed only one segregating band in all individuals, indicating that tps6 and tps11 are in close proximity to each other. The genes were mapped to the short arm of chromosome 10 near the marker npi105A (Fig. 2A). No recombination was observed between both genes and another pair of terpene synthases, tps4 and tps5 (98% nucleotide identity to each other), which map to the same region (18Kollner T.G. Schnee C. Gershenzon J. Degenhardt J. Plant Cell. 2004; 16: 1115-1131Crossref PubMed Scopus (193) Google Scholar). Since there is about 58% sequence identity among the pairs (tps6 and tps11 versus tps4 and tps5) (Fig. 2B), there may have been at least two duplication events in this region of the chromosome.FIGURE 2The terpene synthases tps6 and tps11 are located in close proximity to tps4 and tps5 on chromosome 10. A, mapping with recombinant inbred lines shows one locus for tps6 and tps11 as well as tps4 and tps5 on maize chromosome 10. Likelihood of the odds (LOD) scores of the closest marker loci are shown. 10S and 10L indicate the short and long arm of chromosome 10, respectively. B, the dendrogram represents the amino acid sequence relationships of seven terpene synthases from maize. Sequence alignment was performed by the ClustalW method with default settings in the program module MegAlign of the DNASTAR package. Bootstrap values (n = 1000) are indicated as percentages. The accession numbers of the sequences are AAO18435 (TPS1), AAS88571 (TPS4), AAS88572 (TPS5), AAX99146 (TPS10), and EU259634 (TPS23).View Large Image Figure ViewerDownload Hi-res image Download (PPT) TPS6 and TPS11 Both Produce the Bicyclic Sesquiterpene (–)-β-Macrocarpene—To determine the catalytic activity of the putative terpene synthases TPS6 and TPS11, we expressed both ORFs in E. coli. The partial purified recombinant enzymes were incubated with the potential substrates GPP, FPP, and GGPP. Although no enzymatic activity was observed in the presence of GGPP, both proteins were able to convert GPP and FPP into monoterpenes and sesquiterpenes, respectively (Fig. 3). In the presence of FPP, both TPS6 and TPS11 produced an uncommon sesquiterpene hydrocarbon as the major product along with the minor products, β-bisabolene and (E)-β-farnesene (Fig. 3A). Spectra of the major TSP6 product showed a well pronounced molecular [M]· +ion at m/z 204 with two unusual neutral losses of 56 Da (C4H8) and 68 Da (C5H8) formed by retro-Diels-Alder reactions. Catalytic hydrogenation using 10% platinum on carbon for 1 h formed a mixture of two monoenes, and extended hydrogenation for 6 h resulted in one saturated major product ([M]· +at m/z 208). The necessity of extended hydrogenation indicated two triply or quadruply substituted C=C double bonds in the TPS6 product. To fully identify this compound, a large scale enzyme assay was performed, and ∼1 mg of the reaction product was analyzed by NMR. The 1H NMR spectrum displayed characteristic signals of two geminal methyl groups (δ 0.915 and 0.919), a broad singlet (δ 1.65) of a methyl group on a double bond, and broad singlets attributable to the two olefinic protons (δ 5.46 and 5.42). Starting from these signals, 1H,1H-homocorrelation (1H,1H COSY) and 1H,13C-heterocorrelation NMR experiments (HSQC, HMBC) were used to assign the structure of the bicyclic sesquiterpene as 4′,5,5-trimethyl-1,1′-bi(cyclohexane)-1,3′-diene. A compound of this structure, named (S)-β-macrocarpene, was recently reported from Cupressus macrocarpa (20Cool L.G. Phytochemistry. 2005; 66: 249-260Crossref PubMed Scopus (39) Google Scholar). The 1H NMR data of an authentic sample of this compound matched those of our sample isolated from maize. Enantiomeric analysis of the β-macrocarpene product (Fig. 4) and the β-bisabolene product (Fig. 5) revealed that the (S)-enantiomer was almost exclusively present in both cases. In the presence of GPP, both TPS6 and TPS11 catalyzed the formation of the acyclic monoterpenes, β-myrcene and linalool, along with minor amounts of the cyclic compounds limonene, α-thujene, sabinene, and α-terpinolene (Fig. 3, B and C).FIGURE 4Stereochemical analysis of the β-macrocarpene produced by TPS6. The separation and identification of the (S)- and (R)-enantiomers of β-macrocarpene was performed by gas chromatography on a chiral column with authentic standards as described under "Experimental Procedures." A, the traces of the MS detector are shown for the product of TPS6 (dotted line) and a β-macrocarpene standard (solid line). B, mass spectra of the authentic 1′R and 1′S β-macrocarpene standards and the TPS6 enzyme product.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 5Stereochemical analysis of the β-b
Referência(s)