Fgfr4 Is Required for Effective Muscle Regeneration in Vivo
2005; Elsevier BV; Volume: 281; Issue: 1 Linguagem: Inglês
10.1074/jbc.m507440200
ISSN1083-351X
AutoresPo Zhao, Giuseppina Caretti, Stephanie Mitchell, Wallace L. McKeehan, Adele L. Boskey, Lauren M. Pachman, Vittorio Sartorelli, Eric P. Hoffman,
Tópico(s)Connective tissue disorders research
ResumoFgfr4 has been shown to be important for appropriate muscle development in chick limb buds; however, Fgfr4 null mice show no phenotype. Here, we show that staged induction of muscle regeneration in Fgfr4 null mice becomes highly abnormal at the time point when Fgfr4 is normally expressed. By 7 days of regeneration, differentiation of myotubes became poorly coordinated and delayed by both histology and embryonic myosin heavy chain staining. By 14 days much of the muscle was replaced by fat and calcifications. To begin to dissect the molecular pathways involving Fgfr4, we queried the promoter sequences for transcriptional factor binding sites and tested candidate regulators in a 27-time point regeneration series. The Fgfr4 promoter region contained a Tead protein binding site (M-CAT 5′-CATTCCT-3′), and Tead2 showed induction during regeneration commensurate with Fgfr4 regulation. Co-transfection of Tead2 and Fgfr4 promoter reporter constructs into C2C12 myotubes showed Tead2 to activate Fgfr4, and mutation of the M-CAT motif in the Fgfr4 promoter abolished these effects. Immunostaining for Tead2 showed timed expression in myotube nuclei consistent with the mRNA data. Query of the expression timing and genomic sequences of Tead2 suggested direct regulation by MyoD, and consistent with this, MyoD directly bound to two strong E-boxes in the first intron of Tead2 by chromatin immunoprecipitation assay. Moreover, co-transfection of MyoD and Tead2 intron reporter constructs into 10T1/2 cells activated reporter activity in a dose-dependent manner. This activation was greatly reduced when the two E-boxes were mutated. Our data suggest a novel MyoD-Tead2-Fgfr4 pathway important for effective muscle regeneration. Fgfr4 has been shown to be important for appropriate muscle development in chick limb buds; however, Fgfr4 null mice show no phenotype. Here, we show that staged induction of muscle regeneration in Fgfr4 null mice becomes highly abnormal at the time point when Fgfr4 is normally expressed. By 7 days of regeneration, differentiation of myotubes became poorly coordinated and delayed by both histology and embryonic myosin heavy chain staining. By 14 days much of the muscle was replaced by fat and calcifications. To begin to dissect the molecular pathways involving Fgfr4, we queried the promoter sequences for transcriptional factor binding sites and tested candidate regulators in a 27-time point regeneration series. The Fgfr4 promoter region contained a Tead protein binding site (M-CAT 5′-CATTCCT-3′), and Tead2 showed induction during regeneration commensurate with Fgfr4 regulation. Co-transfection of Tead2 and Fgfr4 promoter reporter constructs into C2C12 myotubes showed Tead2 to activate Fgfr4, and mutation of the M-CAT motif in the Fgfr4 promoter abolished these effects. Immunostaining for Tead2 showed timed expression in myotube nuclei consistent with the mRNA data. Query of the expression timing and genomic sequences of Tead2 suggested direct regulation by MyoD, and consistent with this, MyoD directly bound to two strong E-boxes in the first intron of Tead2 by chromatin immunoprecipitation assay. Moreover, co-transfection of MyoD and Tead2 intron reporter constructs into 10T1/2 cells activated reporter activity in a dose-dependent manner. This activation was greatly reduced when the two E-boxes were mutated. Our data suggest a novel MyoD-Tead2-Fgfr4 pathway important for effective muscle regeneration. Fibroblast growth factors (FGFs) 2The abbreviations used are: FGFfibroblast growth factorFGFRFGF receptorM-CATmuscle CATMCKmuscle creatine kinaseTeadTEA domainTEFtranscription enhancer factorVglvestigial-likeCmascytidine monophospho-N-acetylneuraminic acid synthetaseRapsnreceptor-associated protein of the synapseSV40simian virus 40GMgrowth mediumDMdifferentiation mediumChIPchromatin immunoprecipitationQMFquantitative multiplex fluorescentRTreverse transcriptionBis-Tris2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diolGAPDHglyceraldehyde-3-phosphate dehydrogenaseNIPInuclear import protein I.2The abbreviations used are: FGFfibroblast growth factorFGFRFGF receptorM-CATmuscle CATMCKmuscle creatine kinaseTeadTEA domainTEFtranscription enhancer factorVglvestigial-likeCmascytidine monophospho-N-acetylneuraminic acid synthetaseRapsnreceptor-associated protein of the synapseSV40simian virus 40GMgrowth mediumDMdifferentiation mediumChIPchromatin immunoprecipitationQMFquantitative multiplex fluorescentRTreverse transcriptionBis-Tris2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diolGAPDHglyceraldehyde-3-phosphate dehydrogenaseNIPInuclear import protein I. and their receptors (FGFRs) are critical for the development of most cell types. There are at least 22 distinct FGF ligands and 4 receptors (FGFR1–4), and different ligand/receptor pairs regulate cell growth in either a positive or negative manner depending on the cell type and stage of development (1Dailey L. Ambrosetti D. Mansukhani A. Basilico C. Cytokine Growth Factor Rev. 2005; 16: 233-247Crossref PubMed Scopus (530) Google Scholar, 2Eswarakumar V.P. Lax I. Schlessinger J. Cytokine Growth Factor Rev. 2005; 16: 139-149Crossref PubMed Scopus (1495) Google Scholar). Gain-of-function mutations of FGFR1, FGFR2, and FGFR3 cause a series of important human disorders of bone development, most notably achondroplasia (dwarfism) (FGFR3) and different types of craniosynostosis (FGFR1, FGFR2, FGFR3) (3Muenke M. Schell U. Hehr A. Robin N.H. Losken H.W. Schinzel A. Pulleyn L.J. Rutland P. Reardon W. Malcolm S. Winter R.M. Nat. Genet. 1994; 8: 269-274Crossref PubMed Scopus (538) Google Scholar, 4Reardon W. Winter R.M. Rutland P. Pulleyn L.J. Jones B.M. Malcolm S. Nat. Genet. 1994; 8: 98-103Crossref PubMed Scopus (611) Google Scholar, 5Rousseau F. Bonaventure J. Legeai-Mallet L. Pelet A. Rozet J.M. Maroteaux P. Le Merrer M. Munnich A. Nature. 1994; 371: 252-254Crossref PubMed Scopus (744) Google Scholar, 6Shiang R. Thompson L.M. Zhu Y.Z. Church D.M. Fielder T.J. Bocian M. Winokur S.T. Wasmuth J.J. Cell. 1994; 78: 335-342Abstract Full Text PDF PubMed Scopus (1092) Google Scholar, 7Rutland P. Pulleyn L.J. Reardon W. Baraitser M. Hayward R. Jones B. Malcolm S. Winter R.M. Oldridge M. Slaney S.F. Poole M.D. Wilkie A.O.M Nat. Genet. 1995; 9: 173-176Crossref PubMed Scopus (387) Google Scholar). fibroblast growth factor FGF receptor muscle CAT muscle creatine kinase TEA domain transcription enhancer factor vestigial-like cytidine monophospho-N-acetylneuraminic acid synthetase receptor-associated protein of the synapse simian virus 40 growth medium differentiation medium chromatin immunoprecipitation quantitative multiplex fluorescent reverse transcription 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol glyceraldehyde-3-phosphate dehydrogenase nuclear import protein I. fibroblast growth factor FGF receptor muscle CAT muscle creatine kinase TEA domain transcription enhancer factor vestigial-like cytidine monophospho-N-acetylneuraminic acid synthetase receptor-associated protein of the synapse simian virus 40 growth medium differentiation medium chromatin immunoprecipitation quantitative multiplex fluorescent reverse transcription 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol glyceraldehyde-3-phosphate dehydrogenase nuclear import protein I. We and others have shown that the major receptor expressed in muscle is FGFR4, whereas the major ligand is FGF6 (8deLapeyriere O. Ollendorff V. Planche J. Ott M.O. Pizette S. Coulier F. Birnbaum D. Development. 1993; 118: 601-611Crossref PubMed Google Scholar, 9Coulier F. Pizette S. Ollendorff V. deLapeyriere O. Birnbaum D. Prog. Growth Factor Res. 1994; 5: 1-14Abstract Full Text PDF PubMed Scopus (21) Google Scholar, 10Shaoul E. Reich-Slotky R. Berman B. Ron D. Oncogene. 1995; 10: 1553-1561PubMed Google Scholar, 11Pizette S. Coulier F. Birnbaum D. deLapeyriere O. Exp. Cell Res. 1996; 224: 143-151Crossref PubMed Scopus (43) Google Scholar, 12Sheehan S.M. Allen R.E. J. Cell. Physiol. 1999; 181: 499-506Crossref PubMed Scopus (133) Google Scholar, 13Dusterhoft S. Pette D. Differentiation. 1999; 65: 161-169Crossref PubMed Google Scholar, 14Kastner S. Elias M.C. Rivera A.J. Yablonka-Reuveni Z. J. Histochem. Cytochem. 2000; 48: 1079-1096Crossref PubMed Scopus (155) Google Scholar, 15Cool S.M. Sayer R.E. van Heumen W.R. Pickles J.O. Nurcombe V. Histochem. J. 2002; 34: 291-297Crossref PubMed Scopus (16) Google Scholar, 16Armand A.S. Launay T. Pariset C. Della Gaspera B. Charbonnier F. Chanoine C. Biochim. Biophys. Acta. 2003; 1642: 97-105Crossref PubMed Scopus (33) Google Scholar, 17Zhao P. Hoffman E.P. Dev. Dyn. 2004; 229: 380-392Crossref PubMed Scopus (155) Google Scholar). Consistent with an important role for FGFR4 in muscle development, previous studies have shown that inhibition of FGFR4 leads to the arrest of muscle progenitor differentiation in chick embryo, with reduced expression of Myf5, MyoD, and embryonic myosin heavy chain and dramatic loss of limb muscles (18Marics I. Padilla F. Guillemot J.F. Scaal M. Marcelle C. Development. 2002; 129: 4559-4569Crossref PubMed Google Scholar). This effect is independent of myoblast proliferation (18Marics I. Padilla F. Guillemot J.F. Scaal M. Marcelle C. Development. 2002; 129: 4559-4569Crossref PubMed Google Scholar). Sp1 is shown as one of the factors to control the transcription of FGFR4 in skeletal muscle cells (19Yu S.J. Zheng L. Ladanyi M. Asa S.L. Ezzat S. Clin. Cancer Res. 2004; 10: 6750-6758Crossref PubMed Scopus (15) Google Scholar, 20Yu S. Zheng L. Trinh D.K. Asa S.L. Ezzat S. Lab. Investig. 2004; 84: 1571-1580Crossref PubMed Scopus (13) Google Scholar). Despite the well documented importance of Fgfr4 in muscle development in the chick, Fgfr4 null mice develop normally, with no evident muscle defects (21Weinstein M. Xu X. Ohyama K. Deng C.X. Development. 1998; 125: 3615-3623Crossref PubMed Google Scholar). The only phenotype shown to date for Fgfr4 null mice is increased liver injury and fibrosis induced by carbon tetrachloride and increased cholesterol metabolism and bile acid synthesis (22Yu C. Wang F. Kan M. Jin C. Jones R.B. Weinstein M. Deng C.X. McKeehan W.L. J. Biol. Chem. 2000; 275: 15482-15489Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar, 23Yu C. Wang F. Jin C. Wu X. Chan W.K. McKeehan W.L. Am. J. Pathol. 2002; 161: 2003-2010Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 24Yu C. Wang F. Jin C. Huang X. McKeehan W.L. J. Biol. Chem. 2005; 280: 17707-17714Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). In our studies of staged muscle regeneration in vivo (17Zhao P. Hoffman E.P. Dev. Dyn. 2004; 229: 380-392Crossref PubMed Scopus (155) Google Scholar, 25Zhao P. Iezzi S. Carver E. Dressman D. Gridley T. Sartorelli V. Hoffman E.P. J. Biol. Chem. 2002; 277: 30091-30101Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 26Zhao P. Seo J. Wang Z. Wang Y. Shneiderman B. Hoffman E.P. C. R. Biol. 2003; 326: 1049-1065Crossref PubMed Scopus (33) Google Scholar), we had observed that Fgfr4 was strongly yet transiently induced at a key day-3 time point post-injection in muscle regeneration. This time point is commensurate with the myoblast-myotube transition, where proliferating myoblasts leave the cell cycle, fuse with neighboring cells, and terminally differentiate into multi-nucleated myotubes. We hypothesized that Fgfr4 may be required for effective muscle regeneration and tested this using staged degeneration/regeneration in Fgfr4 null mice. Regeneration in Fgfr4 was highly abnormal, with poorly differentiated myotubes at day 7 and extensive replacement of muscle by fat and calcifications by day 14. We then built a transcriptional pathway upstream of Fgfr4. We show that one of the TEA domain transcriptional factors, Tead2, is induced at day 3 during regeneration, whereupon it regulates the Fgfr4 promoter through the M-CAT motif (CATTCCT). Moreover, we show that MyoD directly binds to and activates the Tead2 first intron. Thus, our data define a MyoD-Tead2-Fgfr4 pathway important for effective muscle regeneration. Staged Muscle Regeneration and Expression Profiling—Fgfr4 null mice were originally generated by Dr. Chu-Xia Deng (NIDDK, National Institutes of Health (21Weinstein M. Xu X. Ohyama K. Deng C.X. Development. 1998; 125: 3615-3623Crossref PubMed Google Scholar)) and maintained by Dr. Wallace McKeehan at Texas A&M University. Staged muscle degeneration/regeneration was done in both 8-week-old wild-type and Fgfr4 null mice by intramuscular injection of 100 μlof 10 μm cardiotoxin using a 10-needle manifold, as we have previously described (25Zhao P. Iezzi S. Carver E. Dressman D. Gridley T. Sartorelli V. Hoffman E.P. J. Biol. Chem. 2002; 277: 30091-30101Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 26Zhao P. Seo J. Wang Z. Wang Y. Shneiderman B. Hoffman E.P. C. R. Biol. 2003; 326: 1049-1065Crossref PubMed Scopus (33) Google Scholar). Both gastrocnemii of three mice per time point were injected and studied. Hematoxylin and Eosin Staining—Each muscle was examined histologically in the belly (center) of the gastrocnemius muscle. Cryosections (8 μm) were cut using an IEC Minotome® cryostat, collected on Superfrost Plus slides (Fisher), and stained with hematoxylin and eosin or used for immunostaining and immunolocalizations. Quantitative Multiplex Fluorescent PCR—Quantitative multiplex fluorescent PCR (QMF-PCR) was done as previously described using a LI-COR DNA analyzer (25Zhao P. Iezzi S. Carver E. Dressman D. Gridley T. Sartorelli V. Hoffman E.P. J. Biol. Chem. 2002; 277: 30091-30101Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 27Zhou J.H. Hoffman E.P. J. Biol. Chem. 1994; 269: 18563-18571Abstract Full Text PDF PubMed Google Scholar). Briefly, 1 μg of total RNA was used to synthesize cDNA using oligo(dT) primer (Roche Applied Science) in a 20-μl reaction. 0.5 μl of cDNA was then used for RT-PCR in a 12.5-μl reaction. PCR was done at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s for 18–20 cycles and then a 72 °C extension for 10 min. Primers used for RT-PCR are Tead2 (NM_011565) forward (5′-ggagtgagcagccagtatgagag-3′) and Tead2 reverse (5′-tacacaaagcgcccgtcctc-3′). Primers for control genes (NIPI-like protein, cytidine monophospho-N-acetylneuraminic acid synthetase) are NIPI-like protein (U67328) forward (5′-aacagggaacctatggtggc-3′), reverse (5′-ctgtccacagggtgactgaag-3′), cytidine monophospho-N-acetylneuraminic acid synthetase (Cmas, AJ006215) forward (5′-gacctagtcttgctccgacctc-3′), and reverse (5′-caggggtgtcttaccagactc-3′). Forward primers were labeled with an infrared fluorescent dye (IRDye 700, LI-COR). PCR products are 135 bp (Tead2), 142 bp (NIPI-like protein), and 128 bp (Cmas). PCR products were quantitated using Gene ImagIR 3.56 (LI-COR). Expression of tested gene was normalized to that of NIPI-like protein (control 1) and Cmas (control 2) by using the formula (test/control 1 + test/control 2)/2. Real Time RT-PCR—Real time RT-PCR was done using ABI Prism 7900HT sequence detection system. Tead2 and Cmas primers are the same as these used in QMF-PCR. Primers for Vgl2 (NM_153786.1) are forward (5′-tcggtctggctgggtggtacag-3′) and reverse (5′-ccattcatcctagccacacaccg-3′). 0.5 μl of cDNA was used for RT-PCR in a 25-μl reaction with SYBR® green fluorescence labeling. PCR was done at 95 °C for 15 s, 57 °C for 30 s, and 72 °C for 30 s for 40 cycles followed by a dissociation step to check the specificity of the products. Antibody Production, Western Blotting, and Immunostaining—Rabbit polyclonal antibodies were produced against Tead2 using a single peptide showing no homology with other Tead family members (WTGSEEGSEEGTGGS). Immune sera were affinity-purified using the peptide. Antibody is available from the authors by request. Whole protein extraction from muscles was quantitated with Bradford protein assay (Bio-Rad), and 10 μg of proteins for each sample were loaded onto NuPAGE® Novex Bis-Tris gels (Invitrogen). Proteins were transferred to nitrocellulose membrane and incubated with Tead2 antibodies for 2 h and then with horseradish peroxidase-bovine-anti-rabbit IgG (Santa Cruz) for 1 h. Samples were detected with ECL Western-blotting detection reagents (Amersham Biosciences) and exposed to film. Immunostaining was done as previously described (28Chen Y.W. Zhao P. Borup R. Hoffman E.P. J. Cell Biol. 2000; 151: 1321-1336Crossref PubMed Scopus (412) Google Scholar). R-phycoerythrin-conjugated rat anti-mouse CD16/CD32 monoclonal antibodies (1:40 dilution) were purchased from BD Biosciences Pharmingen. Rat anti-mouse laminin α2 monoclonal antibodies (1:50 dilution) were purchased from Alexis Biochemicals. Monoclonal antibodies against embryonic myosin heavy chain were obtained from Developmental Studies Hybridoma Bank. Secondary antibodies Cy3-conjugated donkey anti-rabbit IgG (1:500 dilution), Cy3-conjugated donkey anti-mouse IgG (1:500 dilution), and Cy2-conjugated goat anti-rat IgG (1:100 dilution) were purchased from Jackson ImmunoResearch Laboratories. Quantitation of anti-CD16/CD32 fluorescence was done using Image-Pro® Plus imaging software (Media Cybernetics). Muscle areas were measured using ImageJ (rsb.info.nih.gov/ij). Fluorescence was normalized to the area of each muscle. Mineral Analysis—Injected muscles were cryo-sectioned and either stained by the von Kossa technique to demonstrate the presence of phosphate containing mineral or placed on barium fluoride spectroscopic windows and analyzed by Fourier transform infrared imaging (29Mendelsohn R. Paschalis E.P. Boskey A.L. J. Biomed. Opt. 1999; 4: 14-21Crossref PubMed Scopus (98) Google Scholar) using a PerkinElmer Life Sciences Spotlight Imaging system. The spatial resolution was ∼7 μm. Individual spectra were extracted from the images where mineral was visible (based on the increased intensity of the phosphate band at 900–1200 wave numbers) and compared with spectra of bone. PCR Amplification of the Fgfr4 Promoter, Tead2 First Intron, Subcloning, and Mutagenesis—A 226-bp Fgfr4 genomic region containing the M-CAT site was PCR-amplified from genomic DNA isolated from C2C12 skeletal muscle cells. An MluI site was added to the forward primers, and an XhoI site was added to the reverse primers. Primer sequences are- forward (5′-cagtacgcgtaacgactgagactgggcgatcc-3′) and reverse (5′-tagtctcgagacactcacccgcccggagctc-3′). After PCR amplification, the Fgfr4 genomic products were first subcloned into pCR-II-TOPO vector (Invitrogen) and then digested with MluI and XhoI. The Fgfr4-restricted fragments were subcloned in the pGL2 luciferase reporter vectors pGL2-Basic and pGL2-Promoter (Promega) digested with MluI and XhoI. Six consecutive point mutations were introduced in the M-CAT site (CATTCCT to CCGGAAA) of the FGFR4 promoter using the QuikChange XL site-directed mutagenesis kit (Stratagene). Both the wild-type sequence and mutations were confirmed by DNA sequencing of the Fgfr4 constructs. A 213-bp Tead2 first intron region containing two E-boxes was amplified from C2C12 cell genomic DNA. A KpnI site was added to the forward primers, and an XhoI site was added to the reverse primers. Primer sequences are 5′-tcagggtaccatgcccccttttgctgtgtcg-3′ (forward) and 5′-agtcctcgagagtgcctgaggctgtgtttgg-3′ (reverse). PCR products were digested with KpnI and XhoI and subcloned into pGL3-Promoter vector (Promega). Point mutations were introduced in the E-boxes (CAGCTGCTGCCCTTCTCTGAGCACCTG to CAGCGACTGCCCTTCTCTGAGTCCCTG) using the QuikChange XL site-directed mutagenesis kit (Stratagene). Both wild-type and mutant constructs were confirmed by DNA sequencing. Cells, Transfections, and Luciferase Assay—C2C12 skeletal muscle cells (ATCC) were cultured in growth medium (GM, Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum). To induce differentiation, cells were switched to differentiation medium (DM, Dulbecco's modified Eagle's medium supplemented with 2% horse serum and 1× insulin, transferrin, and selenium) 24 h after transfection and cultured for an additional 48 h. C3H10T1/2 mouse fibroblasts (ATCC) were cultured in GM (Dulbecco's modified Eagle's medium supplemented with 10% newborn calf serum). Twenty-four h after transfection, cells were switched to DM and allowed to differentiate for 48 h. The pcDNA-mETF expression vector encoding mouse Tead2 was kindly provided by Dr. Hiroaki Ohkubo (Kumamoto University, Japan) (30Yasunami M. Suzuki K. Houtani T. Sugimoto T. Ohkubo H. J. Biol. Chem. 1995; 270: 18649-18654Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). Transfections were performed with FuGENE 6 transfection reagent (Roche Applied Science), and luciferase activity was assayed with luciferase reporter assay kit (Promega) on the microtiter luminescence detection system (MLX, Dynex, and Centro LB 9600, Berthold). Luciferase assays were done in triplicate points and repeated three times. Transfection efficiency was determined by co-transfection of green fluorescent protein. Gel Shift Assay—Twenty-base pair double-stranded oligonucleotide probes containing potential MyoD binding sites in the first intron of Tead2 gene were used for MyoD gel shift assay. The sequences on the plus strand are Tead2 E1 (5′-tctccagcagctgctgccct 3′) and Tead2 E2 (5′-ctctgagcacctgttctttc-3′). A 21-bp MyoD binding probe from muscle creatine kinase (MCK) promoter (Geneka Biotech) was used as a control. The oligonucleotide probes were labeled with [γ-32P]ATP and purified with MicroSpin™ G25 columns (Amersham Biosciences). Gel shift assay was done using a MyoD gel shift kit (Geneka Biotech). Nuclear extracts (10 μg) from C2C12 cells were incubated with binding buffer for 20 min at 4 °C and then incubated with 5 ng of labeled oligonucleotide probes for an additional 20 min at 4 °C. For the competition test, 100 times more of unlabeled wild-type or mutant MCK probes (500 ng) were added to each reaction. The reaction mixture was subjected to 6% polyacrylamide gel electrophoresis at 90 V for 2.5 h. Gels were dried and exposed to x-ray film. Chromatin Immunoprecipitation Assay (ChIP)—Murine myoblasts (C2C12) were cultured in 15-cm plates in 10% fetal bovine serum to 75% confluency. To induce differentiation, serum was withdrawn, and cells were allowed to differentiate for 2 days. Cells were fixed with 1% of formaldehyde to cross-link protein and DNA. Cells were then harvested, and chromatin was extracted. Chromatin was sonicated to 200–600-bp fragments. Chromatin fragments were precleared with protein A (Invitrogen) and then incubated with MyoD antibodies (M318X, Santa Cruz Biotechnology) or rabbit IgG and rotated overnight at 4 °C. Chromatin bound by antibodies was then precipitated with protein A, washed as described previously (25Zhao P. Iezzi S. Carver E. Dressman D. Gridley T. Sartorelli V. Hoffman E.P. J. Biol. Chem. 2002; 277: 30091-30101Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar), and eluted with 50 mm NaHCO3 and 1% SDS. Protein and DNA cross-linking was reversed by incubating at 67 °C in 0.3 m NaCl for 5 h. DNA was then ethanol-precipitated, digested with proteinase K, and extracted with phenol/chloroform. Primers were designed to amplify candidate promoter sequences and were: Tead2 forward (5′-ttgtccctggatctctctgtccc-3′ and reverse (5′-atggggttgaagccacctgacc-3′); Gapdh forward (5′-cagcatagagcaggtggaccatg-3′) and reverse (5′-tcagcccactctccagaagc-3′); Rapsn (receptor-associated protein of the synapse) forward (5′-tcagaagtgtcaaaggggacacc-3′ and reverse (5′-caccctgggaacaaggctggttc-3′. Real time PCR was performed using Stratagene Mx3000P system and ABI Prism 7900HT sequence detection system. Fgfr4-/- Mice Show Abnormal Muscle Regeneration—To investigate the role of Fgfr4 in muscle regeneration, we induced staged degeneration/regeneration in gastrocnemii muscles in Fgfr4-/- mice and controls using cardiotoxin as we have previously described (17Zhao P. Hoffman E.P. Dev. Dyn. 2004; 229: 380-392Crossref PubMed Scopus (155) Google Scholar, 25Zhao P. Iezzi S. Carver E. Dressman D. Gridley T. Sartorelli V. Hoffman E.P. J. Biol. Chem. 2002; 277: 30091-30101Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 26Zhao P. Seo J. Wang Z. Wang Y. Shneiderman B. Hoffman E.P. C. R. Biol. 2003; 326: 1049-1065Crossref PubMed Scopus (33) Google Scholar). Six muscles at each time point of 0, 3, 4, 7, and 14 days post-injection were analyzed by hematoxylin and eosin for both Fgfr4 null and normal controls, with three muscles in each group selected for more detailed study. The Fgfr4 null mice have an insertion of the NEO gene in exon 6 and have been reported to lack mRNA and protein (21Weinstein M. Xu X. Ohyama K. Deng C.X. Development. 1998; 125: 3615-3623Crossref PubMed Google Scholar). RT-PCR was done at day 3 of regeneration in both wild-type and Fgfr4 null muscles, with primer sets to amplify both exons 5–7 and 5–8. Wild-type muscle showed the expected RT-PCR products, whereas the Fgfr4 null muscles showed an absence of these products (data not shown). This confirmed both the loss-of-function mutation of the Fgfr4 strains used and the expression of the Fgfr4 gene at the 3 day time point, as we have previously reported (17Zhao P. Hoffman E.P. Dev. Dyn. 2004; 229: 380-392Crossref PubMed Scopus (155) Google Scholar). Hematoxylin and eosin histopathology showed similar staining patterns in both Fgfr4-/- and controls at days 0, 3, and 4 (data not shown). However, by day 7 there were clear distinctions between Fgfr4 null and wild-type mice by immunostaining with embryonic myosin heavy chain antibodies (Fig. 1). Wild-type muscle showed maturing myofibers of relatively homogeneous size, central nuclei, and moderate staining with embryonic myosin heavy chain. Fgfr4 null mice showed considerable variability in myofiber size, with many small and intensely staining myofibers, suggesting a lag in the timing of regeneration. There were also very small fibers that stained intensely positive for embryonic myosin heavy chain, yet appeared to lack internal nuclei (Fig. 1). By 14 days, wild-type muscle showed characteristic large, closely packed regenerated myofibers with central nuclei (Fig. 2A). Fgfr4 null mice showed a highly variable histopathology, with some areas showing regenerated myofibers of variable size with larger nuclei (Fig. 2B). Other areas showed extensive calcifications by the von Kossa technique (Fig. 2C) and others, adipose tissue (Fig. 2D). Calcifications and adipocytes were not seen in any area of the wild-type regenerated mice. Inflammation, calcification, and fat infiltration were quantified. Inflammation was characterized by staining of muscle sections with phycoerythrin-conjugated antibodies against CD16/CD32, which are expressed on a variety of inflammatory cells including natural killer cells, monocytes, macrophages, dendritic cells, granulocytes, mast cells, B lymphocytes, immature thymocytes, and some activated mature T lymphocytes. Fgfr4 null mice showed 2–3 times more CD16/CD32+ cells relative to the total muscle area than wild-type mice (Fig. 2E). Fgfr4 null muscle showed large numbers of calcifications (three representative fields of three Fgfr4 null mouse muscles), with an average of 60 calcified foci per 10× field (Fig. 2F). Fgfr4 null mice also showed 8–30% of the muscle area replaced by adipocytes, whereas no adipocytes were seen in wild-type muscle (Fig. 2G) The calcifications were particularly striking in size and number. Chronic degeneration/regeneration in muscle can lead to foci of calcification, presumably due to poor clearance of macrophages. However, the large number and size of the calcifications suggested that these may be bone-like. To test this, we analyzed the mineral composition of the muscle using Fourier transform infrared microspectroscopy (31Boskey A. Mendelsohn R. J. Biomed. Opt. 2005; 10: 031102Crossref PubMed Scopus (149) Google Scholar). We compared the infrared spectra from normal murine muscle (Fig. 3A), Fgfr4 null muscle 14 days after injection with cardiotoxin (Fig. 3B), and normal murine bone (Fig. 3C). The mineral peaks at ∼900–1200 cm-1 in the injected Fgfr4-/- muscle are comparable with normal bone, indicating that hydroxyapatite is present. The increased intensity of the mineral relative to the amide I peak in the injected specimen (Fig. 3B) in contrast to the bone demonstrates that the calcifications are not truly bone-like because the ratio of mineral to collagen differs (either less collagen or more mineral) but have similar components. Taken together, these data show that Fgfr4-deficient muscle regenerates abnormally, with poorly timed regeneration after day 4 (myotube formation). Activators of Fgfr4; Identification of Tead as a Candidate—To determine transcriptional activators for Fgfr4 relevant to myogenesis, we obtained mouse Fgfr4 (NM_008011) promoter sequence from Genome Browser (genome.ucsc.edu/cgi-bin/hgGateway) and queried the promoter region (600 bp) and first intron of the Fgfr4 genomic sequence for potential transcriptional factor binding sites using the Transcription Element Search System (TESS, www.cbil.upenn.edu/tess). We identified an M-CAT motif (CATTCCT) 49 bp from the transcription start site of mouse Fgfr4. This M-CAT motif is conserved in human FGFR4. The M-CAT motif has been found in promoters of muscle-specific genes and has been shown to be bound by TEA domain proteins (Tead) proteins. To determine which Tead isoform (gene) was a possible regulator of Fgfr4, we queried our previously reported 27-time point muscle regeneration expression profiling series for all Tead transcripts (17Zhao P. Hoffman E.P. Dev. Dyn. 2004; 229: 380-392Crossref PubMed Scopus (155) Google Scholar, 25Zhao P. Iezzi S. Carver E. Dressman D. Gridley T. Sartorelli V. Hoffman E.P. J. Biol. Chem. 2002; 277: 30091-30101Abs
Referência(s)