Portal de Periódicos da CAPES

Safety and Pharmacokinetics of Naked Plasmid DNA in the Skin: Studies on Dissemination and Ectopic Expression11Presented in part at the 28th Annual Meeting of the European Society for Dermatological Research, Montpellier, France, September 22–25, 1999.

2001; Elsevier BV; Volume: 116; Issue: 6 Linguagem: Inglês

10.1046/j.1523-1747.2001.01341.x

1523-1747

Ulrich R. Hengge, Björn Dexling, Alireza Mirmohammadsadegh,

RNA Interference and Gene Delivery

Gene therapy using naked DNA injected into muscle and skin is increasingly being used for vaccination and treatment purposes. Favorably, naked plasmid DNA does not exhibit the various limitations inherent to viral vectors, such as the elicitation of adverse immune responses and the risk of insertional mutagenesis. In order to assess the distribution and safety of naked plasmid DNA in a relevant animal model, we analyzed if intracutaneously injected plasmid DNA was transported to other organs and if ectopic expression occurred. When a “superdose” of a marker plasmid was injected intradermally, most organs were found transiently to contain the plasmid DNA for several days, whereas integration into the host genome was not detected. With the exception of ovary, however, mRNA expression only occurred in the skin, regional lymph nodes, and muscular tissues. From a safety standpoint, skin gene therapy with naked plasmid DNA can be considered safe due to the rapid biodegradation of plasmid DNA and the exclusive and transient expression of foreign genes in tissues known to take up DNA. Gene therapy using naked DNA injected into muscle and skin is increasingly being used for vaccination and treatment purposes. Favorably, naked plasmid DNA does not exhibit the various limitations inherent to viral vectors, such as the elicitation of adverse immune responses and the risk of insertional mutagenesis. In order to assess the distribution and safety of naked plasmid DNA in a relevant animal model, we analyzed if intracutaneously injected plasmid DNA was transported to other organs and if ectopic expression occurred. When a “superdose” of a marker plasmid was injected intradermally, most organs were found transiently to contain the plasmid DNA for several days, whereas integration into the host genome was not detected. With the exception of ovary, however, mRNA expression only occurred in the skin, regional lymph nodes, and muscular tissues. From a safety standpoint, skin gene therapy with naked plasmid DNA can be considered safe due to the rapid biodegradation of plasmid DNA and the exclusive and transient expression of foreign genes in tissues known to take up DNA. β-galactosidase Gene therapy is a new field of biotechnology attempting to treat diseases with DNA. Naked, i.e., uncoated plasmid DNA, is a large, highly negatively charged molecule that usually occurs in the nucleus or mitochondria. The direct injection of naked plasmid DNA has been established for muscle and skin eliminating the need for expensive technical devices (Wolff et al., 1990Wolff J.A. Malone R.W. Williams P. Chong W. Acsadi G. Jani A. Felgner P.L. Direct gene transfer into mouse muscle in vivo.Science. 1990; 247: 1465-1468Crossref PubMed Scopus (2957) Google Scholar;Hengge et al., 1995Hengge U.R. Chan E.F. Foster R.A. Walker P.S. Vogel J.C. Cytokine gene expression in epidermis with biological effects following injection of naked DNA.Nat Genet. 1995; 10: 161-166Crossref PubMed Scopus (217) Google Scholar,Hengge et al., 1996Hengge U.R. Walker P.S. Vogel J.C. Expression of naked DNA in human, pig and mouse skin.J Clin Invest. 1996; 97: 2911-2916Crossref PubMed Scopus (172) Google Scholar,Hengge et al., 1998Hengge U.R. Pfützner W. Williams M. Goos M. Vogel J.C. Efficient expression of naked plasmid DNA in mucosal epithelium: prospective for the treatment of skin lesions.J Invest Dermatol. 1998; 111: 605-608https://doi.org/10.1046/j.1523-1747.1998.00353.xCrossref PubMed Scopus (21) Google Scholar). Favorably, naked plasmid DNA does not exhibit the various limitations inherent to viral vectors such as the elicitation of adverse immune responses, promotor shutdown and insertional mutagenesis. On the other hand, expression is generally transient in the range of a couple of days. Genetic immunization uses antigens encoded by the respective DNA to elicit immune responses against infectious and cancerous antigens. To date, clinical trials of naked DNA have been performed against influenza, malaria, and human immunodeficiency virus without significant side-effects except occasional erythema and tenderness at the injection site (Donnelly et al, 1995;Calarota et al., 1998Calarota S. Bratt G. Nordlund S. Hinkula J. Leandersson A.C. Sandstrom E. Wahren B. Cellular cytotoxic response induced by DNA vaccination in HIV-1-infected patients.Lancet. 1998; 351: 1320-1325https://doi.org/10.1016/s0140-6736(97)09440-3Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar;Wang et al., 1998Wang R. Doolan D.L. Le T.P. et al.Induction of antigen-specific cytotoxic T lymphocytes in humans by a malaria DNA vaccine.Science. 1998; 282: 476-480Crossref PubMed Scopus (669) Google Scholar). With regard to cancer various clinical trials employing naked DNA have been performed against colon carcinoma (Conry et al., 1995Conry R. LoBuglio A. Loechel F. et al.A carcinoembryonic antigen polynucleotide vaccine for human clinical use.Cancer Gene Ther. 1995; 2: 33-38PubMed Google Scholar), head and neck squamous cell cancer (Wollenberg et al., 1999Wollenberg B. Kastenbauer Mundl H. Schaumberg J. et al.Gene therapy—phase I trial for primary untreated head and neck squamous cell cancer (HNSCC) UICC stage II-IV with a single intratumoral injection of hIL-2 plasmids formulated in DOTMA/Chol.Hum Gene Ther. 1999; 10: 141-147https://doi.org/10.1089/10430349950019273Crossref PubMed Scopus (26) Google Scholar), and against B cell lymphoma (Syrengelas et al., 1996Syrengelas A.D. Chen T.T. Levy R. DNA immunization induces protective immunity against B-cell lymphoma.Nat Med. 1996; 2: 1038-1041Crossref PubMed Scopus (229) Google Scholar). For therapeutic purposes, higher doses of plasmid DNA up to 4 mg have been injected intramuscularly in patients with thrombangitis obliterans and myocardial ischemia without significant side-effects (Isner et al., 1998Isner J.M. Baumgartner I. Rauh G. et al.Treatment of thromboangiitis obliterans (Buerger's disease) by intramuscular gene transfer of vascular endothelial growth factor: preliminary clinical results.J Vasc Surg. 1998; 28: 964-973Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar;Losordo et al., 1998Losordo D.W. Vale P.R. Symes J.F. et al.Gene therapy for myocardial angiogenesis: initial clinical results with direct myocardial injection of phVEGF165 as sole therapy for myocardial ischemia.Circulation. 1998; 98: 2800-2804Crossref PubMed Scopus (886) Google Scholar). Whereas several studies have characterized the pharmacokinetics of naked plasmid DNA upon intravenous and intramuscular injection, the dissemination of naked plasmid DNA has not been evaluated following intradermal injection. Intradermally applied plasmid DNA can be easily monitored for adverse events or expression due to the accessibility of the skin. In order to assess the distribution and safety of naked plasmid DNA in an animal model relevant for skin gene therapy, we analyzed if intracutaneously injected plasmid DNA was transported to other organs and if ectopic expression occurred. Marker plasmid DNA (pCMV:β-gal; Clontech, Palo Alto, CA) containing the β-galactosidase indicator gene was injected intradermally at a dose of 2 mg into the right hind leg above the posterolateral muscle of four 20 kg pigs. The miniature swine were anesthetized with ketamine, xylazine, butorphan, and atropine (1:1:1:1). The plasmid was applied in phosphate-buffered saline at a concentration of 4 µg per µl. A total volume of 500 µl were injected with a tuberculin syringe and 30-g needle. The plasmid preparation was purified by double cesium chloride purification and the endotoxin levels were determined using the limulus amebocyte assay (BioWhittaker, Walkersville, MD). Endotoxin levels were typically less than 0.005 ng per µg plasmid DNA. At the indicated time points (days 1, 3, and 11) pigs were killed with an overdose of intravenous phenobarbital. Two to four specimens per organ were sampled on autopsy under sterile conditions with a fresh pair of tweezers and scalpel being used for every sample. Around the injection site, skin specimens were taken at a distance of 3 and 10 cm. The regional lymph node in the right inguinal area was extirpated. Tissue sample preparation, polymerase chain reaction (PCR) reaction set-up, PCR amplification, and PCR analysis were performed in separate laboratories. To minimize the risk of cross-sample contamination, each tissue was processed in the tube in which it was frozen. Total cellular DNA was prepared from the various organs using proteinase K and the guanidinium isothiocyanate/cesium chloride method (Hirt, 1967Hirt B. Selective extraction of polyoma DNA from infected mouse cell cultures.J Mol Biol. 1967; 26: 365-369Crossref PubMed Scopus (3312) Google Scholar). RNA was obtained from organ specimens using the guanidinium isothiocyanate/cesium chloride method as described (Hirt, 1967Hirt B. Selective extraction of polyoma DNA from infected mouse cell cultures.J Mol Biol. 1967; 26: 365-369Crossref PubMed Scopus (3312) Google Scholar). To remove contaminating plasmid DNA, RNA samples were incubated with 20 U per ml RNAse-free DNAse (Boehringer, Mannheim, Roche Diagnostics GmbH, Mannheim, Germany) for 2 h at 37°C followed by phenol/chloroform extraction and ethanol precipitation. Following DNA and RNA extraction, PCR analysis (40 cycles, cycling at 94°C for 1 min, 60°C for 1 min, and 72°C for 1.5 min) was performed on 100 ng DNA to detect injected marker plasmid using the following primers (upstream: GCTGATGCGGTGCTGATTACGACC and downstream: GTTTAC CCGCTCTGCTACCTGCG), yielding at 200 bp fragment. PCR products were separated by 2% agarose gel and visualized with ethidium bromide (Hengge et al., 1995Hengge U.R. Chan E.F. Foster R.A. Walker P.S. Vogel J.C. Cytokine gene expression in epidermis with biological effects following injection of naked DNA.Nat Genet. 1995; 10: 161-166Crossref PubMed Scopus (217) Google Scholar). In addition, expression was analyzed with reverse transcriptase on 10–200 ng total RNA, upon DNAse treatment as described above. As a control for the DNA and RNA quality, parallel reactions were run for β-actin. A fixed aliquot of total DNA extracts from each organ was digested with EcoR1 that cuts the pCMV:β-gal once followed by Southern blotting with a random-primed β-Gal probe from the CMV:β-gal plasmid as described (Hirt, 1967Hirt B. Selective extraction of polyoma DNA from infected mouse cell cultures.J Mol Biol. 1967; 26: 365-369Crossref PubMed Scopus (3312) Google Scholar;Hengge et al., 1995Hengge U.R. Chan E.F. Foster R.A. Walker P.S. Vogel J.C. Cytokine gene expression in epidermis with biological effects following injection of naked DNA.Nat Genet. 1995; 10: 161-166Crossref PubMed Scopus (217) Google Scholar). Two to 8 mo old inbred miniature swine (20 kg) from the NIH herd (Poolsville, MD) were maintained in accordance with NIH Guide, USDA and Animal Welfare Act guidelines and housed in AALAC accredited housing. For ethical and logistic reasons, a small number of animals was used and several specimens were processed to control for reproducibility. Following euthanasia at several time points [day 1 (n = 1), day 3 (n = 2), and day 11 (n = 1)] various organs were analyzed for the presence of DNA and their potential expression using PCR amplification. When individual samples (each two to four per organ) from a variety of porcine organs were analyzed for detectable plasmid DNA at day 3, DNA could be recovered from all organs except spinal cord and bone marrow (Table I). In general, the band intensity was high as seen in the regional lymph node, uterus, and diaphragm (Figure 1, lanes 2–4). In contrast, the ovary contained a faint band in four of five specimens analyzed (Figure 1, lane 1).Table IDistribution of β-Gal plasmid DNA following intradermal injectionaThe organs are listed with respect to the detectability of marker DNA. Three to five independent samples were analyzed per time point and tissue.TissueDay 1Day 3Day 11Injection site+ND+3 cm away+++10 cm away+ND+Regional+++lymph nodeMuscleND++OvaryND+–HeartND++ThyroidND++BrainND+–KidneyND+–LiverND+–IntestineND+–StomachND+–SpleenND+–LungND+–UterusND+–DiaphragmND+–Spinal cordND––Bone marrowND––a The organs are listed with respect to the detectability of marker DNA. Three to five independent samples were analyzed per time point and tissue. Open table in a new tab When the presence of plasmid DNA was analyzed at later times (day 11), several tissues no longer contained detectable amounts of marker DNA. In particular, ovary, kidney, liver, spleen, lung, and the gastrointestinal tract were always negative at this time point. Interestingly, skin around the injection site and the regional lymph node were consistently positive. In addition, tissues such as muscle and thyroid – known to take up and express naked plasmid DNA – were found to contain marker DNA for extended periods of time. On day 11, β-Gal DNA was still detectable – albeit at low levels – in muscular tissues (Figure 2, lanes 1, 3, and 4), regional lymph node (Figure 2, lane 5), and 3 cm around the skin injection site (Figure 2, lane 2). We next analyzed, whether plasmid DNA was detectable by Southern blot and whether it had potentially integrated into the cellular DNA in day 3 samples using a 32P-labeled β-Gal probe at a sensitivity limit in the range of about 1 pg per 10 µg DNA. As seen in Figure 3, the presence of β-Gal-DNA could be confirmed in several tissues, such as uterus, ovary, and lung. Importantly, no additional bands were seen suggesting that integration of the plasmid DNA into the chromosomal DNA did not occur at this level of sensitivity (Figure 3). Finally, we analyzed the tissues that contained plasmid DNA for mRNA expression following digestion with DNase (Table II). β-Gal-RNA was found in the skin, regional lymph node, muscle, and ovary on day 3, whereas on day 11, injected skin and perilesional skin were the only tissues that contained β-Gal mRNA transcripts (Figure 4).Table IIEctopic expression of marker RNA in various tissues following intradermal DNA injectionaA summary of various organs with respect to the detectability of marker RNA is depicted. Three to five independent samples were analyzed per time point and tissue.TissueDay 1Day 3Day 11Injection site+ND+3 cm away+++10 cm away+ND+Regional++–lymph nodeMuscleND+–OvaryND+–HeartND––BrainND––ThyroidND–NDKidneyND–NDLiverND–NDIntestineND––StomachND––SpleenND––LungND––UterusND––DiaphragmND––Spinal cordND––Bone marrowND––a A summary of various organs with respect to the detectability of marker RNA is depicted. Three to five independent samples were analyzed per time point and tissue. Open table in a new tab This study revealed the transient presence of plasmid DNA upon intradermal injection in a variety of different organs. It was shown that even in larger animals having skin that morphologically resembles the human integument, plasmid DNA is distributed throughout the body. Within several days, DNA was lost from most tissues probably due to degradation (endonucleases), as has recently been shown (Barry et al., 1999Barry M.E. Pinto-Gonzalez D. Orson F.M. McKenzie G.J. Petry G.R. Barry M.A. Role of endogenous endonucleases and tissue site in transfection and CpG-mediated immune activation after naked DNA injection.Hum Gene Ther. 1999; 10: 2461-2480https://doi.org/10.1089/10430349950016816Crossref PubMed Scopus (144) Google Scholar). Around the injection site, in the corresponding lymph node and in muscular tissues, plasmid DNA could still be amplified at day 11, whereas most other tissues were negative. One potential explanation is, that plasmid DNA in the skin may be compartmentalized and retained in the connective tissue, thereby decreasing the rate of clearance. Skin, muscle, and thyroid are known readily to take up and transiently express naked plasmid DNA (Wolff et al., 1990Wolff J.A. Malone R.W. Williams P. Chong W. Acsadi G. Jani A. Felgner P.L. Direct gene transfer into mouse muscle in vivo.Science. 1990; 247: 1465-1468Crossref PubMed Scopus (2957) Google Scholar;Sikes et al., 1994Sikes M.L. O'Malley Jr, Bw Finegold M.J. Ledley F.D. In vivo gene transfer into rabbit thyroid follicular cells by direct DNA injection.Hum Gene Ther. 1994; 5: 837-844Crossref PubMed Scopus (120) Google Scholar;Hengge et al., 1995Hengge U.R. Chan E.F. Foster R.A. Walker P.S. Vogel J.C. Cytokine gene expression in epidermis with biological effects following injection of naked DNA.Nat Genet. 1995; 10: 161-166Crossref PubMed Scopus (217) Google Scholar). In agreement with other studies performed in mice and rabbits, porcine brain also maintained marker DNA for at least 11 d (Lew et al., 1995Lew D. Parker S.E. Latimer T. et al.Cancer gene therapy using plasmid DNA. pharmacokinetic study of DNA following injection in mice.Gene Ther. 1995; 6: 553-564Crossref Scopus (199) Google Scholar;Osaka et al., 1996Osaka G. Carey K. Cuthbertson A. et al.Pharmacokinetics, tissue distribution, and expression efficiency of plasmid [33P] DNA following intravenous administration of DNA/cationic lipid complexes in mice: use of a novel radionuclide approach.J Pharm Sci. 1996; 85: 612-618Crossref PubMed Scopus (96) Google Scholar), which was not expressed. This might be due to the abundance of blood vessels and the lower content of endonucleases (Barry et al., 1999Barry M.E. Pinto-Gonzalez D. Orson F.M. McKenzie G.J. Petry G.R. Barry M.A. Role of endogenous endonucleases and tissue site in transfection and CpG-mediated immune activation after naked DNA injection.Hum Gene Ther. 1999; 10: 2461-2480https://doi.org/10.1089/10430349950016816Crossref PubMed Scopus (144) Google Scholar). A receptor-mediated DNA uptake mechanism has been suggested to occur in these tissues 2Tschakarjan E, Trappmann K, Immler D, Meyer HE, Mirmohammadsadegh A, Hengge UR: Keratinocytes take-up naked plasmid DNA: evidence for DNA binding proteins in keratinocyte membranes. J Invest Dermatol 113:434, 1999 (Budker et al., 2000Budker V. Budker T. Zhang G. Subbotin V. Loomis A. Wolff J.A. Hypothesis: naked plasmid DNA is taken up by cells in vivo by a receptor-mediated process.J Gene Med. 2000; 2: 76-88Crossref PubMed Scopus (186) Google Scholar). Our results extend earlier studies byUdvardi et al., 1999Udvardi A. Kufferath I. Grutsch H. Zatloukal K. Volc-Platzer B. Uptake of exogenous DNA via the skin.J Mol Med. 1999; 77: 744-750Crossref PubMed Scopus (30) Google Scholar who investigated the presence and expression of naked plasmid DNA after epicutaneous and intracutaneous application. Following epicutaneous application to intact mouse skin, DNA could be detected for up to 1 wk; however, the plasmid DNA was only expressed after intracutaneous injection or particle-mediated gene transfer, but not after epicutaneous administration (Udvardi et al., 1999Udvardi A. Kufferath I. Grutsch H. Zatloukal K. Volc-Platzer B. Uptake of exogenous DNA via the skin.J Mol Med. 1999; 77: 744-750Crossref PubMed Scopus (30) Google Scholar). When different application routes (intravenous, intramuscular, and intradermal) of plasmid DNA were compared with regard to safety, significant clinical or histologic toxicity has not been observed (Wolff et al., 1992Wolff J.A. Ludtke J.J. Acsadi G. Williams P. Jani A. Long-term persistence of plasmid DNA and foreign gene expression in mouse muscle.Hum Mol Genet. 1992; 1: 363-369Crossref PubMed Scopus (651) Google Scholar;Parker et al., 1995Parker S.E. Vahlsing H.L. Serfilippi L.M. et al.Cancer gene therapy using plasmid DNA. safety evaluation in rodents and non-human primates.Hum Gene Ther. 1995; 6: 575-590Crossref PubMed Scopus (93) Google Scholar;Hartikka et al., 1996Hartikka J. Sawdey M. Cornefert-Jensen F. et al.An improved plasmid DNA expression vector for direct injection into skeletal muscle.Hum Gene Ther. 1996; 7: 1205-1217Crossref PubMed Scopus (277) Google Scholar;Winegar et al., 1996Winegar R.A. Monforte J.A. Suing K.D. O'Loughlin K.G. Rudd C.J. MacGregor J.T. Determination of tissue distribution of an intramuscular plasmid vaccine using PCR and in situ DNA hybridization.Hum Gene Ther. 1996; 7: 2185-2194Crossref PubMed Scopus (51) Google Scholar;Torres et al., 1997Torres C.A. Iwasaki A. Barber B.H. Robinson H.L. Differential dependence on target site tissue for gene gun and intramuscular DNA immunizations.J Immunol. 1997; 158: 4529-4532PubMed Google Scholar); however,Davis et al., 1997Davis H.L. Millan C.L. Watkins S.C. Immune-mediated destruction of transfected muscle fibers after direct gene transfer with antigen-expressing plasmid DNA.Gene Ther. 1997; 4: 181-188Crossref PubMed Scopus (131) Google Scholar detected some degree of muscle fiber degeneration and regeneration following the intramuscular application of reporter gene- and hepatitis B surface antigen-expressing plasmids, whereas the integrity and function were not compromised. Of note, plasmid DNA could be detected for more than 1 y (Wolff et al., 1992Wolff J.A. Ludtke J.J. Acsadi G. Williams P. Jani A. Long-term persistence of plasmid DNA and foreign gene expression in mouse muscle.Hum Mol Genet. 1992; 1: 363-369Crossref PubMed Scopus (651) Google Scholar;Davis et al., 1997Davis H.L. Millan C.L. Watkins S.C. Immune-mediated destruction of transfected muscle fibers after direct gene transfer with antigen-expressing plasmid DNA.Gene Ther. 1997; 4: 181-188Crossref PubMed Scopus (131) Google Scholar). The differences in the detectability of plasmid DNA across various studies using intramuscular injection may be due to the coadministration and timing of bupivacaine that leads to muscle fiber destruction and may alter plasmid distribution and/or persistence (Wells, 1993Wells D. Improved gene transfer by direct plasmid injection associated with regeneration in mouse skeletal muscle.FEBS Lett. 1993; 332: 179-182Abstract Full Text PDF PubMed Scopus (109) Google Scholar). In addition, species-related effects must be considered. The widespread presence of plasmid DNA has also been described in rabbits and mice by quantitative PCR following the injection of either 100 µg or 400 µg of plasmid DNA into the posterolateral muscle of the hind leg (Winegar et al., 1996Winegar R.A. Monforte J.A. Suing K.D. O'Loughlin K.G. Rudd C.J. MacGregor J.T. Determination of tissue distribution of an intramuscular plasmid vaccine using PCR and in situ DNA hybridization.Hum Gene Ther. 1996; 7: 2185-2194Crossref PubMed Scopus (51) Google Scholar). Interestingly, plasmid DNA was mainly found in the skin above the injected muscle besides the injected muscle itself (Winegar et al., 1996Winegar R.A. Monforte J.A. Suing K.D. O'Loughlin K.G. Rudd C.J. MacGregor J.T. Determination of tissue distribution of an intramuscular plasmid vaccine using PCR and in situ DNA hybridization.Hum Gene Ther. 1996; 7: 2185-2194Crossref PubMed Scopus (51) Google Scholar). For example, 4 h after the injection of 400 µg, the plasmid was detected at the injection site at a mean copy number of 106 in muscle and 4 × 104 in skin per µg tissue; however, it was undetectable by PCR in most of the tissues and fluids examined, such as spleen, liver, jejunum, lymph nodes, and gonads given a detection limit of 10 copies per µg tissue, which may be explained by the containing effect of the muscle fascia. When plasmid DNA copies were quantified using PCR-based methods at 30 and 60 d following intramuscular injections in mice, about 1500 copies per 150,000 genomes (10 fg per µg genomic DNA) were detected (Martin et al., 1999Martin T. Parker S.E. Hedstrom R. et al.Plasmid DNA malaria vaccine: the potential for genomic integration after intramuscular injection.Hum Gene Ther. 1999; 10: 759-768https://doi.org/10.1089/10430349950018517Crossref PubMed Scopus (135) Google Scholar). Interestingly, the time after injection (i.e., 30 or 60 d) was no predictor of the plasmid copy number being associated with the genomic DNA. Even in the worst case scenario, if all detectable copies were integrated, the calculated rate of mutations would still be 3000 times less than the spontaneous mutation rate for mammalian genomes (Ledley and Ledley, 1994Ledley T.S. Ledley F.D. Multicompartment, numerical model of cellular events in the pharmacokinetics of gene therapies.Hum Gene Ther. 1994; 5: 679-691Crossref PubMed Scopus (59) Google Scholar;Martin et al., 1999Martin T. Parker S.E. Hedstrom R. et al.Plasmid DNA malaria vaccine: the potential for genomic integration after intramuscular injection.Hum Gene Ther. 1999; 10: 759-768https://doi.org/10.1089/10430349950018517Crossref PubMed Scopus (135) Google Scholar). Thus, from a safety standpoint, naked DNA can be considered to not pose a significant risk for genomic alteration. Following the injection or ingestion of foreign DNA, the gastrointestinal and bronchoalveolar mucosa of mice and dogs take up the available DNA (Meyer et al., 1995Meyer K.B. Thompson M.M. Levy M.Y. Barron L.G. Szoka Jr, Fc Intratracheal gene delivery to the mouse airway: characterization of plasmid DNA expression and pharmacokinetics.Gene Ther. 1995; 2: 450-460PubMed Google Scholar;Takehara et al., 1996Takehara T. Hayashi N. Yamamoto M. Miyamoto Y. Fusamoto H. Kamada T. In vivo gene transfer and expression in rat stomach by submucosal injection of plasmid DNA.Hum Gene Ther. 1996; 7: 589-593Crossref PubMed Scopus (23) Google Scholar;Schubbert et al., 1997Schubbert R. Renz D. Schmitz B. Doerfler W. Foreign (M13) DNA ingested by mice reaches peripheral leukocytes, spleen, and liver via the intestinal wall mucosa and can be covalently linked to mouse DNA.Proc Natl Acad Sci USA USA. 1997; 94: 961-966Crossref PubMed Scopus (234) Google Scholar;Hengge et al., 1999Hengge U.R. Taichman L.B. Kaur P. et al.How realistic is cutaneous gene therapy?.Exp Dermatol. 1999; 8: 419-431Crossref PubMed Scopus (20) Google Scholar). Unprotected (“naked”) phage M13 DNA was not completely degraded upon passage through the gastrointestinal tract, but sequences of up to 900 bases in length were detectable as early as 2–4 h after feeding in about 1 of 1000 peripheral leukocytes (Schubbert et al., 1997Schubbert R. Renz D. Schmitz B. Doerfler W. Foreign (M13) DNA ingested by mice reaches peripheral leukocytes, spleen, and liver via the intestinal wall mucosa and can be covalently linked to mouse DNA.Proc Natl Acad Sci USA USA. 1997; 94: 961-966Crossref PubMed Scopus (234) Google Scholar). Chromosomal integration was not detected (Schubbert et al., 1997Schubbert R. Renz D. Schmitz B. Doerfler W. Foreign (M13) DNA ingested by mice reaches peripheral leukocytes, spleen, and liver via the intestinal wall mucosa and can be covalently linked to mouse DNA.Proc Natl Acad Sci USA USA. 1997; 94: 961-966Crossref PubMed Scopus (234) Google Scholar;Martin et al., 1999Martin T. Parker S.E. Hedstrom R. et al.Plasmid DNA malaria vaccine: the potential for genomic integration after intramuscular injection.Hum Gene Ther. 1999; 10: 759-768https://doi.org/10.1089/10430349950018517Crossref PubMed Scopus (135) Google Scholar). Despite certain advantages for gene therapy with naked DNA, there are intrinsic fundamental problems associated with the unprotected character of plasmid DNA. In particular, the reduction of genome equivalents will translate into a rapid loss of gene expression. In that regard, 99% of intravenously injected naked DNA were degraded within 90 min yielding a half-life of about 10 min (Kawabata et al, 1995;Barry et al., 1999Barry M.E. Pinto-Gonzalez D. Orson F.M. McKenzie G.J. Petry G.R. Barry M.A. Role of endogenous endonucleases and tissue site in transfection and CpG-mediated immune activation after naked DNA injection.Hum Gene Ther. 1999; 10: 2461-2480https://doi.org/10.1089/10430349950016816Crossref PubMed Scopus (144) Google Scholar). Despite the massive destruction, tissue nuclease levels did not determine the transfection efficiency of skin and muscle. Rather, cell- and tissue-specific uptake and expression and perhaps more subtle nuclease effects may act in concert (Barry et al., 1999Barry M.E. Pinto-Gonzalez D. Orson F.M. McKenzie G.J. Petry G.R. Barry M.A. Role of endogenous endonucleases and tissue site in transfection and CpG-mediated immune activation after naked DNA injection.Hum Gene Ther. 1999; 10: 2461-2480https://doi.org/10.1089/10430349950016816Crossref PubMed Scopus (144) Google Scholar;Budker et al., 2000Budker V. Budker T. Zhang G. Subbotin V. Loomis A. Wolff J.A. Hypothesis: naked plasmid DNA is taken up by cells in vivo by a receptor-mediated process.J Gene Med. 2000; 2: 76-88Crossref PubMed Scopus (186) Google Scholar). Another reason for the transient presence of DNA is the lack of integration into epidermal stem cells. When DNA is endocytosed into keratinocytes, most of it generally remains episomal (extrachromosomal and outside the nucleus). It will not only be degraded but also diluted, when cells divide (Hengge et al., 1999Hengge U.R. Taichman L.B. Kaur P. et al.How realistic is cutaneous gene therapy?.Exp Dermatol. 1999; 8: 419-431Crossref PubMed Scopus (20) Google Scholar). Eventually, plasmid DNA is lost from the epidermis when epithelial cells slough off. In keeping with earlier reports by us and colleagues we did not find evidence for cellular integration into various tissues that contained high amounts of episomal DNA (Wolff et al., 1990Wolff J.A. Malone R.W. Williams P. Chong W. Acsadi G. Jani A. Felgner P.L. Direct gene transfer into mouse muscle in vivo.Science. 1990; 247: 1465-1468Crossref PubMed Scopus (2957) Google Scholar,Wolff et al., 1992Wolff J.A. Ludtke J.J. Acsadi G. Williams P. Jani A. Long-term persistence of plasmid DNA and foreign gene expression in mouse muscle.Hum Mol Genet. 1992; 1: 363-369Crossref PubMed Scopus (651) Google Scholar;Hengge et al., 1995Hengge U.R. Chan E.F. Foster R.A. Walker P.S. Vogel J.C. Cytokine gene expression in epidermis with biological effects following injection of naked DNA.Nat Genet. 1995; 10: 161-166Crossref PubMed Scopus (217) Google Scholar). Taken together, these results contribute to the understanding of DNA dissemination and longevity of expression in a relevant large animal model with skin similar to humans. The mechanisms for plasmid distribution are not entirely clear, but transport via dendritic cells, blood, and lymph is suspected. As expected, naked plasmid DNA is almost entirely degraded over time; however, the relatively short time frame of uptake and expression is sufficient to elicit important biologic responses, such as seen in genetic vaccination (Walker et al., 1998Walker P.S. Scharton-Kersten T. Rowton E. Hengge U.R. Bouloc A. Udey M.C. Vogel J.C. Genetic immunization with gp63 cDNA results in a Th1 type immune response and protection in a murine model of leishmaniasis.Hum Gene Ther. 1998; 9: 1899-1907Crossref PubMed Scopus (84) Google Scholar). From a safety standpoint, skin gene therapy with naked plasmid DNA can be considered safe due to the rapid biodegradation of plasmid DNA and the exclusive and transient expression of foreign genes in tissues known to take up DNA. The support of Dr. Jonathan Vogel, Dermatology Branch, NIH is gratefully acknowledged. In addition, the expert veterinarian treatment from Dr. Victoria Hamshire and Melissa Williams were invaluable throughout the entire study. We are grateful to Nicole-C. Bartosch for typing the manuscript and Hagen Apel for his photographical skills.