Mutation (D472Y) in the Type 3 Repeat Domain of Cartilage Oligomeric Matrix Protein Affects Its Early Vesicle Trafficking in Endoplasmic Reticulum and Induces Apoptosis
2003; Elsevier BV; Volume: 163; Issue: 1 Linguagem: Inglês
10.1016/s0002-9440(10)63634-6
ISSN1525-2191
AutoresYusuke Hashimoto, Takami Tomiyama, Yoshiki Yamano, Hiroshi Mori,
Tópico(s)Cell Adhesion Molecules Research
ResumoCartilage oligomeric matrix protein (COMP) is a large pentameric extracellular glycoprotein found in cartilage, tendon, and synovium, and plays structural roles in cartilage as the fifth member of the thrombospondin family. Familial mutations in type 3 repeats of COMP are known to cause pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (EDM1). Although such mutations induce enlarged rough endoplasmic reticulum (rER) as a morphological change, the metabolic trafficking of mutated COMP remains unclear. In transfected COS7 cells, wild-type COMP was rapidly secreted into culture medium, while the great majority of COMP with the type 3 repeats mutation (D472Y) remained in the cells and a small portion of mutated COMP was secreted. This finding was followed up with a confocal study with an antibody specific to COMP, which demonstrated mutated COMP tightly associated with abnormally enlarged rER. Phosphorylated eIF2α, an ER stress protein, was expressed as a pathological reaction in virtually all COS7 cells expressing mutated but not wild-type COMP. Moreover, COS7 cells expressing mutated COMP exhibited significantly more apoptotic reaction than those expressing wild-type COMP. Pathological accumulation of COMP in rER and apoptosis in COS7 cells that were induced by the mutation (D472Y) in COMP imply that COMP mutations play a role in the pathogenesis of PSACH. Cartilage oligomeric matrix protein (COMP) is a large pentameric extracellular glycoprotein found in cartilage, tendon, and synovium, and plays structural roles in cartilage as the fifth member of the thrombospondin family. Familial mutations in type 3 repeats of COMP are known to cause pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (EDM1). Although such mutations induce enlarged rough endoplasmic reticulum (rER) as a morphological change, the metabolic trafficking of mutated COMP remains unclear. In transfected COS7 cells, wild-type COMP was rapidly secreted into culture medium, while the great majority of COMP with the type 3 repeats mutation (D472Y) remained in the cells and a small portion of mutated COMP was secreted. This finding was followed up with a confocal study with an antibody specific to COMP, which demonstrated mutated COMP tightly associated with abnormally enlarged rER. Phosphorylated eIF2α, an ER stress protein, was expressed as a pathological reaction in virtually all COS7 cells expressing mutated but not wild-type COMP. Moreover, COS7 cells expressing mutated COMP exhibited significantly more apoptotic reaction than those expressing wild-type COMP. Pathological accumulation of COMP in rER and apoptosis in COS7 cells that were induced by the mutation (D472Y) in COMP imply that COMP mutations play a role in the pathogenesis of PSACH. Pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (EDM1) are closely related to each other and autosomal dominant skeletal dysplasia. PSACH patients clinically exhibit disproportionately short stature, joint laxity, and early-onset osteoarthritis,1McKeand J Rotta J Hecht JT Natural history study of pseudoachondroplasia.Am J Med Genet. 1996; 63: 406-410Crossref PubMed Scopus (76) Google Scholar, 2Ikegawa S Ohashi H Nishimura G Kim KC Sannohe A Kimizuka M Fukushima Y Nagai T Nakamura Y Novel and recurrent COMP (cartilage oligomeric matrix protein) mutations in pseudoachondroplasia and multiple epiphyseal dysplasia.Hum Genet. 1998; 103: 633-638Crossref PubMed Scopus (63) Google Scholar, 3Beighton P Giedion ZA Gorlin R Hall J Horton B Kozlowski K Lachman R Langer LO Maroteaux P Poznanski A International Working Group on Constitutional Diseases of Bone. International classification of osteochondrodysplasias.Am J Med Genet. 1992; 44: 223-229Crossref PubMed Scopus (71) Google Scholar while EDM1 patients exhibit mildly short stature and joint pain, particularly in the hips, in addition to early-onset osteoarthritis.2Ikegawa S Ohashi H Nishimura G Kim KC Sannohe A Kimizuka M Fukushima Y Nagai T Nakamura Y Novel and recurrent COMP (cartilage oligomeric matrix protein) mutations in pseudoachondroplasia and multiple epiphyseal dysplasia.Hum Genet. 1998; 103: 633-638Crossref PubMed Scopus (63) Google Scholar, 3Beighton P Giedion ZA Gorlin R Hall J Horton B Kozlowski K Lachman R Langer LO Maroteaux P Poznanski A International Working Group on Constitutional Diseases of Bone. International classification of osteochondrodysplasias.Am J Med Genet. 1992; 44: 223-229Crossref PubMed Scopus (71) Google Scholar, 4Berg PK Dysplasia epiphysialis multiplex: a case report and review of the literature.Am J Roentgenol. 1966; 97: 31-38Crossref Google Scholar Brigg et al5Briggs MD Hoffman SMG King LM Olsen AS Mohrenweiser H Rimoin DL Gaines ES Cekleriak JA Knowlton RG Cohn DH A mutation in the calcium binding domain of the cartilage oligomeric matrix protein (COMP) results in pseudoachondroplasia.Nat Genet. 1995; 10: 330-336Crossref PubMed Scopus (419) Google Scholar and Hecht et al6Hecht JT Nelson LD Crowder E Wang Y Elder FFB Harrison WR Harrison WR Francomano CA Prange CK Lennon GG Deere M Lawler J Mutations in exon 17B of cartilage oligomeric matrix protein (COMP) cause pseudoachondroplasia.Nat Genet. 1995; 10: 325-329Crossref PubMed Scopus (311) Google Scholar examined these two types of human skeletal dysplasia and independently found mutations in the COMP gene on chromosome 19p12–13.1. Cartilage oligomeric matrix protein (COMP) was initially termed the high-molecular-weight cartilage matrix glycoprotein that was isolated from articular cartilage7Fife RS Brandt KD Identification of a high-molecular-weight (greater than 400,000) protein in hyaline cartilage.Biochim Biophys Acta. 1984; 802: 506-514Crossref PubMed Scopus (43) Google Scholar, 8Franzen A Heinegård D Solursh M Evidence for sequential appearance of cartilage matrix proteins in developing mouse limbs and in cultures of mouse mesenchymal cells.Differentiation. 1987; 36: 199-210Crossref PubMed Scopus (59) Google Scholar and characterized later as a territorial homopentameric matrix protein with a subunit size of 100 to 110 kd.9Hedbom E Antonsson P Hjerpe A Aeschlimann D Paulsson M Rosa-Pimentel E Sommarin Y Wendel M Oldberg Å Heinegard D Cartilage oligomeric matrix protein: an acidic oligomeric protein (COMP) detected only in cartilage.J Biol Chem. 1992; 267: 6132-6136Abstract Full Text PDF PubMed Google Scholar Interestingly, COMP proved to be the fifth member of the thrombospondin family, members of which have a coiled-coil region responsible for multimerization and interchain disulfide bonds,10Efimov VP Lustig A Engel J The thrombospondin-like chains of cartilage oligomeric matrix protein are assembled by a five-stranded α-helical bundle between residues 20 and 83.FEBS Lett. 1994; 341: 54-58Abstract Full Text PDF PubMed Scopus (69) Google Scholar four epidermal growth factor-like type 2 repeats, seven highly conserved type 3 repeats that consist of 13 calcium-binding loops, and a COOH-terminal globular domain.11Oldberg Å Antonsson P Lindblom K Heinegård D COMP (cartilage oligomeric matrix protein) is structurally related to the thrombospondins.J Biol Chem. 1992; 267: 22346-22350Abstract Full Text PDF PubMed Google Scholar, 12DiCesare PE Mörgelin M Mann K Paulsson M Cartilage oligomeric matrix protein and thrombospondin 1: purification from articular cartilage, electron microscopic structure, and chondrocyte binding.Eur J Biochem. 1994; 223: 927-937Crossref PubMed Scopus (122) Google Scholar, 13Newton G Weremowicz S Morton CC Copeland NG Gilbert DJ Jenkin NA Lawler J Characterization of human and mouse cartilage oligomeric matrix protein.Genomics. 1994; 24: 435-439Crossref PubMed Scopus (136) Google Scholar Most mutations identified in the COMP gene are located within the exons encoding the calcium-binding type 3 repeats2Ikegawa S Ohashi H Nishimura G Kim KC Sannohe A Kimizuka M Fukushima Y Nagai T Nakamura Y Novel and recurrent COMP (cartilage oligomeric matrix protein) mutations in pseudoachondroplasia and multiple epiphyseal dysplasia.Hum Genet. 1998; 103: 633-638Crossref PubMed Scopus (63) Google Scholar, 14Susic S McGrory J Cole WG Multiple epiphyseal dysplasia and pseudoachondroplasia due to novel mutations in the calmodulin-like repeats of cartilage oligomeric matrix protein.Clin Genet. 1997; 51: 219-224PubMed Google Scholar, 15Briggs MD Mortier GR Cole WG King LM Golik SS Bonaventure J Nuytinck L De Paepe A Leroy JG Biesecker L Lipson M Wilcox WR Lachman RS Rimoin DL Knowlton RG Cohn DH Diverse mutations in the gene for cartilage oligomeric matrix protein in the pseudoachondroplasia-multiple epiphyseal dysplasia disease spectrum.Am J Hum Genet. 1998; 62: 311-319Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar and are postulated to cause qualitative defects in the protein, induce COMP conformational change, and reduce calcium-binding activity.16Chen H Deere M Hecht DJ Lawler J Cartilage oligomeric matrix protein, and a mutation in its type 3 repeats causes conformational changes.J Biol Chem. 2000; 275: 26538-26544Crossref PubMed Scopus (92) Google Scholar, 17Maddox BK Mokashi A Keene DR Bächinger HP A cartilage oligomeric matrix protein mutation associated with pseudoachondroplasia changes the structural and functional properties of the type 3 domain.J Biol Chem. 2000; 275: 11412-11417Crossref PubMed Scopus (59) Google Scholar, 18Thur J Rosenberg K Nitsche DP Pihlajamaa T Ala-Kokko L Heinegård D Paulsson M Maurer P Mutation in cartilage oligomeric matrix protein causing pseudoachondroplasia and multiple epiphyseal dysplasia affect binding of calcium and collagen 1, 2, 9.J Biol Chem. 2001; 276: 6083-6092Crossref PubMed Scopus (182) Google Scholar COMP is primarily synthesized in cells and then secreted as an extracellular territorial matrix around chondrocytes9Hedbom E Antonsson P Hjerpe A Aeschlimann D Paulsson M Rosa-Pimentel E Sommarin Y Wendel M Oldberg Å Heinegard D Cartilage oligomeric matrix protein: an acidic oligomeric protein (COMP) detected only in cartilage.J Biol Chem. 1992; 267: 6132-6136Abstract Full Text PDF PubMed Google Scholar and can also be found in synovium, tendons, and dermal fibroblasts.19DiCesare PE Hauser N Lehman D Pasumarti S Paulsson M Cartilage oligomeric matrix protein (COMP) is an abundant component of tendon.FEBS Lett. 1994; 354: 237-240Abstract Full Text PDF PubMed Scopus (215) Google Scholar, 20DiCesare PE Carlson CS Stollerman ES Chen FS Leslie M Perris R Expression of cartilage oligomeric matrix protein by human synovium.FEBS Lett. 1997; 412: 249-252Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 21Smith RK Zunino L Webbon PM Heinegård D The distribution of cartilage oligomeric matrix protein (COMP) in tendon and its variation with tendon site, age, and load.Matrix Biol. 1997; 16: 255-271Crossref PubMed Scopus (175) Google Scholar, 22Dodge GR Hawkins D Boesler E Sakai L Jimenez SA Production of cartilage oligomeric matrix protein (COMP) by cultured human dermal and synovial fibroblasts.Osteoarthritis Cartilage. 1998; 6: 435-440Abstract Full Text PDF PubMed Scopus (52) Google Scholar In ultrastructural studies, chondrocytes from PSACH and EDM1 patients have been found to be characterized by enormous vesicles formed from rough endoplasmic reticulum (rER) that have a unique lamellar appearance with alternating electron-lucent and electron-dense layers.23Cooper RR Ponsetti IV Maynard JA Pseudoachondroplastic dwarfism: a rough-surfaced endoplasmic recticulum storge disorder.J Bone Joint Surg Am. 1973; 55: 475-484PubMed Google Scholar, 24Pedrini-Mille A Maynard JA Pedrini VA Pseudoachondroplasia: biochemical and histochemical studies of cartilage.J Bone Joint Surg Am. 1984; 66: 1408-1414PubMed Google Scholar, 25Stanescu R Stanescu V Muriel MP Maroteaux P Multiple epiphyseal dysplasia, Fairbank type: morphogic and biochemical study of cartilage.Am J Med Genet. 1993; 45: 501-507Crossref PubMed Scopus (65) Google Scholar Extracellular matrix components, including aggrecan and type IX collagen, have been shown to be retained in these enlarged vesicles.25Stanescu R Stanescu V Muriel MP Maroteaux P Multiple epiphyseal dysplasia, Fairbank type: morphogic and biochemical study of cartilage.Am J Med Genet. 1993; 45: 501-507Crossref PubMed Scopus (65) Google Scholar, 26Rimoin DL Rasmussen IM Briggs MD Roughley PJ Gruber HE Warman ML Olsen BR Hsia YE Yuen J Reinker K Garber AP Grover J Lachman RS Cohn DH A large family with features of pseudoachondroplasia and multiple epiphyseal dysplasia: exclusion of seven candidate gene loci that encode proteins of the cartilage extracellular matrix.Hum Genet. 1994; 93: 236-242Crossref PubMed Scopus (37) Google Scholar, 27Maddox BK Keene DR Sakai LY Charbonneau NL Morris NP Ridgway CC Boswell BA Sussman MD Horton WA Bächinger HP Hecht JT The fate of cartilage oligomeric matrix protein is determined by cell type in the case of a novel mutation in pseudoachondroplasia.J Biol Chem. 1997; 272: 30993-30997Crossref PubMed Scopus (89) Google Scholar, 28Delot E Brodie SG King LM Wilcox WR Cohn DH Physiological and pathological secretion of cartilage oligomeric matrix protein by cells in culture.J Biol Chem. 1998; 273: 26692-26697Crossref PubMed Scopus (59) Google Scholar, 29Vranka J Mokashi A Keene DR Tufa Sara Corson G Sussman M Horton WA Maddox K Sakai L Bächinger HP Selective intracellular retention of extracellular matrix proteins and chaperones associated with pseudoachondroplasia.Matrix Biol. 2001; 20: 439-450Crossref PubMed Scopus (72) Google Scholar The retention appeared to be cell type-specific since COMP is secreted normally from patient tendon and ligament in vitro and patient chondrocytes cultured in monolayers.27Maddox BK Keene DR Sakai LY Charbonneau NL Morris NP Ridgway CC Boswell BA Sussman MD Horton WA Bächinger HP Hecht JT The fate of cartilage oligomeric matrix protein is determined by cell type in the case of a novel mutation in pseudoachondroplasia.J Biol Chem. 1997; 272: 30993-30997Crossref PubMed Scopus (89) Google Scholar, 28Delot E Brodie SG King LM Wilcox WR Cohn DH Physiological and pathological secretion of cartilage oligomeric matrix protein by cells in culture.J Biol Chem. 1998; 273: 26692-26697Crossref PubMed Scopus (59) Google Scholar, 30Hecht JT Deere M Putnam E Cole W Vertel B Chen H Lawler J Characterization of cartilage oligomeric matrix protein (COMP) in human normal and pseudoachondroplasia musculoskeletal tissues.Matrix Biol. 1998; 17: 269-278Crossref PubMed Scopus (93) Google Scholar However, it is still unclear how these mutations affect COMP trafficking and its pathway of secretion to cause disease phenotypes. In this study, we examined the effect of a mutation (D472Y) in the calcium-binding domain previously identified for severe PSACH6Hecht JT Nelson LD Crowder E Wang Y Elder FFB Harrison WR Harrison WR Francomano CA Prange CK Lennon GG Deere M Lawler J Mutations in exon 17B of cartilage oligomeric matrix protein (COMP) cause pseudoachondroplasia.Nat Genet. 1995; 10: 325-329Crossref PubMed Scopus (311) Google Scholar on the process of secretion in cultured COS7 cells with newly prepared antibodies specific for COMP. This mutation was found to affect an early stage of the membrane trafficking of COMP at the rER before the Golgi apparatus and plasma membrane. Recently, it has been shown that a variety of toxic insults, including calcium ionophores, inhibitors of glycosylation, chemical toxicants, and oxidative stress, can cause ER stress and ultimately lead to cell death.31Li LJ Li X Ferrario A Rucker N Liu ES Wong S Gomer CJ Lee AS Establishment of a Chinese hamster ovary cell line that expresses grp78 antisense transcripts and suppresses A23187 induction of both GRP78 and GRP94.J Cell Physiol. 1992; 153: 575-582Crossref PubMed Scopus (91) Google Scholar, 32Chatterjee S Cheng MF Berger SJ Berger NA Induction of M(r) 78,000 glucose-regulated stress protein in poly(adenosine diphosphate-ribose) polymerase- and nicotinamide adenine dinucleotide-deficient V79 cell lines and its relation to resistance to the topoisomerase II inhibitor etoposide.Cancer Res. 1994; 54: 4405-4411PubMed Google Scholar, 33Perez-Sala D Mollinedo F Inhibition of N-linked glycosylation induces early apoptosis in human promyelocytic HL-60 cells.J Cell Physiol. 1995; 163: 523-531Crossref PubMed Scopus (65) Google Scholar, 34Shao RG Shimizu T Pommier Y Brefeldin A is a potent inducer of apoptosis in human cancer cells independently of p53.Exp Cell Res. 1996; 227: 190-196Crossref PubMed Scopus (104) Google Scholar, 35McCormick TS McColl KS Distelhorst CW Mouse lymphoma cells destined to undergo apoptosis in response to thapsigargin treatment fail to generate a calcium-mediated grp78/grp94 stress response.J Biol Chem. 1997; 272: 6087-6092Crossref PubMed Scopus (88) Google Scholar, 36Guo H Tittle TV Allen H Maziarz RT Brefeldin A-mediated apoptosis requires the activation of caspases and is inhibited by Bcl-2.Exp Cell Res. 1998; 245: 57-68Crossref PubMed Scopus (63) Google Scholar, 37Liu H Miller E van de Water B Stevens JL Endoplasmic reticulum stress proteins block oxidant-induced Ca2+ increases and cell death.J Biol Chem. 1998; 273: 12858-12862Crossref PubMed Scopus (183) Google Scholar, 38Lee J Bruce-Keller AJ Kruman Y Chan SL Mattson MP 2-Deoxy-D-glucose protects hippocampal neurons against excitotoxic and oxidative injury: evidence for the involvement of stress proteins.J Neurosci Res. 1999; 57: 48-61Crossref PubMed Scopus (158) Google Scholar, 39Yu Z Luo H Fu W Mattson MP The endoplasmic reticulum stress-responsive protein GRP78 protects neurons against excitotoxicity and apoptosis: suppression of oxidative stress and stabilization of calcium homeostasis.Exp Neurol. 1999; 155: 302-314Crossref PubMed Scopus (402) Google Scholar We found that significant ER stress and resultant apoptosis occurred in cells expressing mutated COMP compared with wild-type COMP and discuss the significance of this in PSACH. We isolated periosterial cells from five normal subjects without any clinical disorders related to PSACH or EDM1 at surgical operation and used them for isolation of cDNA to encode COMP under informed consent. Cells were grown with 10 ng/ml TGF-β, 10% fetal calf serum, and Dulbecco's modified Eagle's medium (DMEM). Total RNA was extracted from cultured human synovial cells and used as the template for amplification of full-length COMP cDNA according to standard protocols with Pyrobest DNA Polymerase (Takara Bio Inc., Kyoto, Japan). The full-length COMP cDNA amplified with primers F-NdeI (5′-cagatccatgcggccgccatggtccccgacaccgcct gcgtt-3′) and R-NdeI (5′-ggtcttcacgcggccgcctaggcttgccgcagctgatgggt-3′) was introduced into the bacterial expression vector pET3a (Invitrogen, CA) for preparation of anti-COMP antibodies. Three COMP clones were established from each of the five individuals. All of the 15 clones of wild-type COMP cDNA were sequenced at every step and confirmed with an ABI Prism 310 DNA Sequencer (Applied Biosystems, CA) and found to possess the same 11 SNPs (Accession No: AB086984 in DDBJ (DNA Data Bank of Japan) database (http://www.ddbj.nig.ac.jp/)). The full-length COMP cDNA in pET3a vector was re-amplified with primers F-NotI (5′-cagatccatgcgg ccgccatggtccccgacaccgcctgcgtt-3′) and R-NotI (5′-ggtcttcacgcggccgcctaggcttgccgcagctgatgg gt-3′) and transferred into the mammalian expression vector pCMV (Invitrogen, CA) for transfection. The point mutation (G1414A) found for a patient with severe PSACH6Hecht JT Nelson LD Crowder E Wang Y Elder FFB Harrison WR Harrison WR Francomano CA Prange CK Lennon GG Deere M Lawler J Mutations in exon 17B of cartilage oligomeric matrix protein (COMP) cause pseudoachondroplasia.Nat Genet. 1995; 10: 325-329Crossref PubMed Scopus (311) Google Scholar was introduced into the wild-type COMP cDNA by PCR. The PCR primers used for the mutagenesis were the mutagenesis primers 1414-F (5′- ggaggactcagaccacgatggccagggtgatgcctgcgacgacgactacgacaat-3′) and 1414-R (5′-attgtcgtagtcgtcgtcgcaggcatcaccctggccatcgtggtctgagtcctcc −3′), in addition to the two primers F-NotI and R-NotI. Mutated COMP cDNA was introduced into pCMV vector. It was confirmed by sequencing that the correct mutation had been introduced and that other PCR-generated errors were not incorporated. All of the COMP cDNA and its derivative clones were sequenced at every step and confirmed with an ABI Prism 310 DNA Sequencer. The antigens were the N-terminal and C-terminal fragments of COMP. Both fragments of COMP were recombinant proteins that were prepared from the truncated COMP cDNA. The two cDNAs were generated using full-sized COMP cDNA as the template by PCR with the two following primer sets. The N-terminal fragment (residue number: 89–290) primers were NF (5′-cttgccaggcatatgctccactgcgcgcccggcttctgc-3′) and NR (5′-gagtcatc gcatatgctagtccttacggcactgcggctccgg-3′), and the C-terminal fragment (residue number: 525–757) primers were CF (5′-cttgccacccatatggaagtcacgctcaccgacttcagg-3′) and CR (5′-tccggccatatgtcaccc tggtccctaggcttgccg-3′). Each COMP fragment cDNA was introduced into the bacterial expression vector pET3a and used for transformation of E. coli BL21 (DE3) (Novagen, NY). The transformed cells were homogenized with a teflon homogenizer and sonicated in 50 mmol/L Tris-HCl (pH 7.6), containing protease inhibitors and 2% 2-mercaptoethanol. After centrifugation at 15,000 × g for 20 minutes, the pellets were resuspended in the same buffer containing 1% Triton-X100. After centrifugation at 15,000 × g for 20 minutes again, the pellets were resuspended in the same buffer containing 8 mol/L urea. After centrifugation again, the resultant supernatants were applied to a Resource Q ion-exchange column (Amersham Pharmacia Biotech, NJ) pre-equilibrated with 50 mmol/L NaCl/8 mol/L urea/50 mmol/L Tris-HCl (pH 7.6). Elution was performed with a linear gradient of 50 mmol/L to 1000 mmol/L NaCl in 8 mol/L urea/50 mmol/L Tris-HCl (pH 7.6). Aliquots from fractions were analyzed by Coomassie brilliant blue R-250 dye staining following SDS-PAGE. The eluates containing COMP fragments were collected and dialyzed against 20 mmol/L ammonium bicarbonate buffer (pH 7.5), followed by lyophilization. Lyophilized material was resuspended in 50 mmol/L Tris-HCl (pH 7.6), and injected s.c. in rabbits and BALB/c mice every 2 weeks with Freund's incomplete adjuvant after the first immunization with Freund's complete adjuvant (Difco Laboratory, DM). From each species, two antibodies to the N-terminal and C-terminal fragments, respectively, were established. A rabbit anti-COMP polyclonal antibody to the N-terminal fragment whose immnoreactivity was stronger than the other antibodies in Western blotting was chosen for use in experiments thereafter. To evaluate the specificity of the antibody, we performed an adsorption experiment and immunohistochemistry. For the former, the primary antibody was incubated with or without 10 μg/ml recombinant N-terminal COMP fragment. The protocol is described in detail for Western blot analysis below. For immunohistochemistry, murine growth plates of the knee including chondrocytes were taken at 2 weeks after birth. Samples were fixed for 12 hours in fresh 4% paraformaldehyde in phosphate-buffered saline (PBS) at 4°C, embedded in paraffin, and serially sectioned (5-μm thick). Sections adsorbed to silanized over-dried glass slides were deparaffinized and hydrated. After incubation with a blocking buffer containing 20% calf serum in PBS for 30 minutes at room temperature, sections were incubated overnight at 4°C with the newly developed anti-COMP antibodies followed by biotinylated secondary antibodies for 30 minutes at room temperature. After washing, sections were incubated with avidin biotin-peroxidase complex (Vectastain ABC Kit, Vector Laboratories, CA) for 10 minutes at room temperature. Immnoreactivity was visualized by incubation with diaminobenzidine and 0.03% hydrogen peroxide solution for 5 minutes at room temperature. COS7 cells were cultured with DMEM containing 10% fetal calf serum, penicillin, and streptomycin. Cells were grown to approximately 70% confluence in 60-mm dishes for 24 hours before transfection. The DNA construct of mammalian expression vector pCMV (3 μg) containing either wild-type COMP, mutated COMP, or vector only was mixed with 12 μl of LipofectAMINE (Gibco BRL, MD) in 2 ml of OPTI-MEM serum-free medium (Gibco BRL, MD) and added to cells, and incubated for 3 hours. The cells were further cultured in 2.5 ml of DMEM containing 10% fetal calf serum in 5% CO2. The transfected cells were harvested, washed twice with PBS and dissolved in 0.5%SDS/1% 2-mercaptoethanol/50 mmol/L sodium acetate (pH 5.5), containing protease inhibitors. After protein content was determined, the same amount of each lysate was boiled for 10 minutes. Endoglycosidase H (Endo H) (Sigma, MO) (0.25 m unit/5 μl) in 50 mmol/L sodium acetate (pH 5.5), was added to each sample and incubated for 3 hours at 37°C. Endo H digestions were terminated by heating at 95°C. To prepare a positive control for ER stress and DNA fragmentation, COS7 cells were treated with staurosporine. When cells were grown to 80% confluence, staurosporine was added at a final concentration of 1 mmol/L to culture with DMEM containing 10% fetal calf serum, and the cells were incubated for 3 hours for ER stress and 12 hours for DNA fragmentation at 37°C in 5% CO2. The transfected cells were harvested and then washed twice with PBS at 4°C, and the pellets were dissolved in 0.5% SDS/150 mmol/L NaCl/50 mmol/L Tris-HCl (pH 7.6), containing protease inhibitors. Samples of cell lysates and conditioned media were mixed with 4% SDS/20% glycerol/160 mmol/L Tris-HCl (pH 6.8), with or without 4% 2-mercaptoethanol, boiled for 5 minutes, centrifuged, and applied to 5% polyacrylamide gel. After electrophoresis, proteins on the gel were electroblotted to PVDF membrane (Millipore, Bedford, MA). The membranes were blocked in 3% nonfat milk/1%BSA/0.05% Tween 20/150 mmol/L NaCl/50 mmol/L Tris-HCl (pH 7.6), for 2 hours and were then incubated with the primary antibody to N-terminal COMP (1:10,000). After four washes with 0.05% Tween 20/150 mmol/L NaCl/50 mmol/L Tris-HCl (pH 7.6), the membranes were incubated with a horseradish peroxidase (HRP)-linked secondary antibody (1:10,000) (Bio-Rad Lab, CA), and immunoreactivity was detected by the ECL Plus Western Blotting Detection System (Amersham Pharmacia Biotech, NJ). An anti-G3PDH antibody (Trevigen Inc., MD) was used for immunoblotting to normalize protein contents of cell lysate samples. The densities of COMP in conditioned media and cell lysates were measured using a densitometer (Bio-Rad Lab). The secreted COMP/intracellular COMP ratio was calculated for three independent experiments. In ER stress experiments, membranes were incubated with a primary antibody to eIF2α (1:1000) or Phospho-eIF2α (1:1000) (Cell Signaling Technology Inc., MA) followed by HRP-conjugated secondary antibody. COS7 cells grown on 1% gelatin-coated coverslips were transfected, as described above. After 2-day culture, cells were washed in PBS and fixed with cooled 90% methanol for 10 minutes at 4°C followed by acetone for 10 minutes at 4°C. The fixed cells were hydrated once with PBS, and washed with 0.05% Tween-containing PBS to ensure permeabilization for antibody staining. After washing again with PBS, the cells were incubated with blocking buffer containing 20% calf serum in PBS for 20 minutes at room temperature. The cells were then incubated with the primary antibodies followed by rhodamine (TRITC)- and fluorescein isothiocyanate (FITC)-conjugated secondary antibodies (Jackson Immunoresearch Labs Inc., PA). The stained specimens were mounted and examined under a confocal laser microscope (Zeiss LSM 510, Jena). The primary antibodies included the polyclonal antibody to N-terminal COMP, a monoclonal antibody to Grp78, a representative marker of endoplasmic reticulum (obtained from Stressgen Biotechnologies Corp, CA), a monoclonal antibody to Golgi 58K protein, a representative marker of the Golgi apparatus (obtained from Sigma), and a polyclonal antibody to Phospho-eIF2α, a marker of ER stress (obtained from Cell Signaling Technology Inc). COS7 cells grown on coverslips were transfected with either wild-type COMP, mutated COMP, or vector only. After 48 hours of incubation, the transfected cells were washed and fixed as described above. The cells were then washed twice with PBS and incubated with 50 μl terminal dUTP nick-end labeling (TUNEL) reaction mixture (Roche Diagnostic, IN) in a humid chamber for 60 minutes at 37°C. For subsequent double-staining, the cells were washed three times again and stained with the anti-COMP antibody as described above. The specimens were examined under a confocal microscope (Zeiss LSM 510, Jena). Six fields were randomly selected, in which total, TUNEL-positive, and COMP-positive cells were counted. The counts of the six fields were summed for each transfection. Each field contained approximately 200 cells. The TUNEL-positive cells/total cells and TUNEL- and COMP-positive cells/COMP-positive cells ratios were calculated. Transfection was performed three times. Transfected cells and staurosporine-treated cells (2 × 106) were incubated in 100 μl ice-cold lysis buffer (10 mmol/L Tris-HCl (pH 7.4), 10 mmol/L EDTA, 0.5% SDS) at 4°C for 10 minutes. The lysates were treated with 40 mg RNase A at 37°C for 1 hour, and then with 40 mg of proteinase K at 50°C for 1 hour. To precipitate genomic DNA, the mixture was incubated with 1 volume of isopropanol and 0.2 volumes of 3 mol/L sodium acetate at −20°C for 12 hours and centrifuged at 10,000 × g for 20 minutes. Pellets were air-dried and dissolved in 100 μl of Tris EDTA (TE) buffer. The DNA samples were subjected to 1.5% agarose gel electrophoresis using 40 mmol/L Tris acetate (pH 8.0)
Referência(s)