Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Crystal Structures of Fission Yeast Histone Chaperone Asf1 Complexed with the Hip1 B-domain or the Cac2 C Terminus

2008; Elsevier BV; Volume: 283; Issue: 20 Linguagem: Inglês

10.1074/jbc.m800594200

ISSN

1083-351X

Autores

Ali D. Malay, Takashi Umehara, Kazuko Matsubara-Malay, Balasundaram Padmanabhan, Shigeyuki Yokoyama,

Tópico(s)

RNA and protein synthesis mechanisms

Resumo

The assembly of core histones onto eukaryotic DNA is modulated by several histone chaperone complexes, including Asf1, CAF-1, and HIRA. Asf1 is a unique histone chaperone that participates in both the replication-dependent and replication-independent pathways. Here we report the crystal structures of the apo-form of fission yeast Asf1/Cia1 (SpAsf1N; residues 1-161) as well as its complexes with the B-domain of the fission yeast HIRA orthologue Hip1 (Hip1B) and the C-terminal region of the Cac2 subunit of CAF-1 (Cac2C). The mode of the fission yeast Asf1N-Hip1B recognition is similar to that of the human Asf1-HIRA recognition, suggesting that Asf1N recognition of Hip1B/HIRA is conserved from yeast to mammals. Interestingly, Hip1B and Cac2C show remarkably similar interaction modes with Asf1. The binding between Asf1N and Hip1B was almost completely abolished by the D37A and L60A/V62A mutations in Asf1N, indicating the critical role of salt bridge and van der Waals contacts in the complex formation. Consistently, both of the aforementioned Asf1 mutations also drastically reduced the binding to Cac2C. These results provide a structural basis for a mutually exclusive Asf1-binding model of CAF-1 and HIRA/Hip1, in which Asf1 and CAF-1 assemble histones H3/H4 (H3.1/H4 in vertebrates) in a replication-dependent pathway, whereas Asf1 and HIRA/Hip1 assemble histones H3/H4 (H3.3/H4 in vertebrates) in a replication-independent pathway. The assembly of core histones onto eukaryotic DNA is modulated by several histone chaperone complexes, including Asf1, CAF-1, and HIRA. Asf1 is a unique histone chaperone that participates in both the replication-dependent and replication-independent pathways. Here we report the crystal structures of the apo-form of fission yeast Asf1/Cia1 (SpAsf1N; residues 1-161) as well as its complexes with the B-domain of the fission yeast HIRA orthologue Hip1 (Hip1B) and the C-terminal region of the Cac2 subunit of CAF-1 (Cac2C). The mode of the fission yeast Asf1N-Hip1B recognition is similar to that of the human Asf1-HIRA recognition, suggesting that Asf1N recognition of Hip1B/HIRA is conserved from yeast to mammals. Interestingly, Hip1B and Cac2C show remarkably similar interaction modes with Asf1. The binding between Asf1N and Hip1B was almost completely abolished by the D37A and L60A/V62A mutations in Asf1N, indicating the critical role of salt bridge and van der Waals contacts in the complex formation. Consistently, both of the aforementioned Asf1 mutations also drastically reduced the binding to Cac2C. These results provide a structural basis for a mutually exclusive Asf1-binding model of CAF-1 and HIRA/Hip1, in which Asf1 and CAF-1 assemble histones H3/H4 (H3.1/H4 in vertebrates) in a replication-dependent pathway, whereas Asf1 and HIRA/Hip1 assemble histones H3/H4 (H3.3/H4 in vertebrates) in a replication-independent pathway. Eukaryotic genomic DNA forms hierarchical nucleoprotein complex structures in the nucleus. The nucleosome core particle is the basal repeating unit of the complex, which is composed of ∼147 bp of DNA wrapped around a core histone particle, comprising a tetramer of H3 and H4 and two dimers of H2A and H2B (1Luger K. Mader A.W. Richmond R.K. Sargent D.F. Richmond T.J. Nature. 1997; 389: 251-260Crossref PubMed Scopus (6841) Google Scholar, 2Kornberg R.D. Lorch Y. Cell. 1999; 98: 285-294Abstract Full Text Full Text PDF PubMed Scopus (1427) Google Scholar). The precise and regular arraying of nucleosomes is supposed to be a key determinant for the formation of upper hierarchical structures, such as the 30-nm fibers and chromatin fibers. The assembly of the nucleosome is regulated by several groups of chromatin-associated factors involving histone chaperones, chromatin remodeling factors, and histone modification enzymes, which are tightly linked to the regulation of DNA metabolism (2Kornberg R.D. Lorch Y. Cell. 1999; 98: 285-294Abstract Full Text Full Text PDF PubMed Scopus (1427) Google Scholar). Histone chaperones are factors that bind to core histones and facilitate their deposition onto nucleosomes (3Loyola A. Almouzni G. Biochim. Biophys. Acta. 2004; 1677: 3-11Crossref PubMed Scopus (273) Google Scholar). Among the variety of histone chaperones, Asf1 4The abbreviations used are: Asf1, anti-silencing function-1; CAF-1, chromatin assembly factor-1; HIRA, histone regulatory homolog A; Hip1, HIRA-like protein-1; r.m.s.d., root mean square deviation; GST, glutathione S-transferase; WT, wild type. 4The abbreviations used are: Asf1, anti-silencing function-1; CAF-1, chromatin assembly factor-1; HIRA, histone regulatory homolog A; Hip1, HIRA-like protein-1; r.m.s.d., root mean square deviation; GST, glutathione S-transferase; WT, wild type. is the most evolutionarily conserved in its primary structure (4Le S. Davis C. Konopka J.B. Sternglanz R. Yeast. 1997; 13: 1029-1042Crossref PubMed Scopus (184) Google Scholar, 5Tyler J.K. Adams C.R. Chen S.R. Kobayashi R. Kamakaka R.T. Kadonaga J.T. Nature. 1999; 402: 555-560Crossref PubMed Scopus (443) Google Scholar, 6Munakata T. Adachi N. Yokoyama N. Kuzuhara T. Horikoshi M. Genes Cells. 2000; 5: 221-233Crossref PubMed Scopus (113) Google Scholar, 7Sillje H.H. Nigg E.A. Curr. Biol. 2001; 11: 1068-1073Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar, 8Umehara T. Horikoshi M. J. Biol. Chem. 2003; 278: 35660-35667Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar), and its function as a histone chaperone is conserved throughout the eukaryotes (5Tyler J.K. Adams C.R. Chen S.R. Kobayashi R. Kamakaka R.T. Kadonaga J.T. Nature. 1999; 402: 555-560Crossref PubMed Scopus (443) Google Scholar, 6Munakata T. Adachi N. Yokoyama N. Kuzuhara T. Horikoshi M. Genes Cells. 2000; 5: 221-233Crossref PubMed Scopus (113) Google Scholar, 9Umehara T. Chimura T. Ichikawa N. Horikoshi M. Genes Cells. 2002; 7: 59-73Crossref PubMed Scopus (56) Google Scholar, 10Daganzo S.M. Erzberger J.P. Lam W.M. Skordalakes E. Zhang R. Franco A.A. Brill S.J. Adams P.D. Berger J.M. Kaufman P.D. Curr. Biol. 2003; 13: 2148-2158Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 11Tamburini B.A. Carson J.J. Adkins M.W. Tyler J.K. Eukaryot. Cell. 2005; 4: 1583-1590Crossref PubMed Scopus (33) Google Scholar). Asf1 associates with a variety of chromatin-associated factors, including the histone chaperones CAF-1 (12Tyler J.K. Collins K.A. Prasad-Sinha J. Amiott E. Bulger M. Harte P.J. Kobayashi R. Kadonaga J.T. Mol. Cell. Biol. 2001; 21: 6574-6584Crossref PubMed Scopus (175) Google Scholar, 13Mello J.A. Sillje H.H. Roche D.M. Kirschner D.B. Nigg E.A. Almouzni G. EMBO Rep. 2002; 3: 329-334Crossref PubMed Scopus (227) Google Scholar) and HIR (10Daganzo S.M. Erzberger J.P. Lam W.M. Skordalakes E. Zhang R. Franco A.A. Brill S.J. Adams P.D. Berger J.M. Kaufman P.D. Curr. Biol. 2003; 13: 2148-2158Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 14Sharp J.A. Fouts E.T. Krawitz D.C. Kaufman P.D. Curr. Biol. 2001; 11: 463-473Abstract Full Text Full Text PDF PubMed Scopus (209) Google Scholar, 15Sutton A. Bucaria J. Osley M.A. Sternglanz R. Genetics. 2001; 158: 587-596Crossref PubMed Google Scholar), and stimulates both the assembly and disassembly of chromatin (5Tyler J.K. Adams C.R. Chen S.R. Kobayashi R. Kamakaka R.T. Kadonaga J.T. Nature. 1999; 402: 555-560Crossref PubMed Scopus (443) Google Scholar, 6Munakata T. Adachi N. Yokoyama N. Kuzuhara T. Horikoshi M. Genes Cells. 2000; 5: 221-233Crossref PubMed Scopus (113) Google Scholar, 9Umehara T. Chimura T. Ichikawa N. Horikoshi M. Genes Cells. 2002; 7: 59-73Crossref PubMed Scopus (56) Google Scholar, 16Adkins M.W. Howar S.R. Tyler J.K. Mol. Cell. 2004; 14: 657-666Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 17Adkins M.W. Tyler J.K. J. Biol. Chem. 2004; 279: 52069-52074Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Consequently, Asf1 affects most DNA-mediated events, including gene expression (15Sutton A. Bucaria J. Osley M.A. Sternglanz R. Genetics. 2001; 158: 587-596Crossref PubMed Google Scholar, 16Adkins M.W. Howar S.R. Tyler J.K. Mol. Cell. 2004; 14: 657-666Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 18Chimura T. Kuzuhara T. Horikoshi M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9334-9339Crossref PubMed Scopus (53) Google Scholar, 19Zabaronick S.R. Tyler J.K. Mol. Cell. Biol. 2005; 25: 652-660Crossref PubMed Scopus (45) Google Scholar) and silencing (4Le S. Davis C. Konopka J.B. Sternglanz R. Yeast. 1997; 13: 1029-1042Crossref PubMed Scopus (184) Google Scholar, 20Singer M.S. Kahana A. Wolf A.J. Meisinger L.L. Peterson S.E. Goggin C. Mahowald M. Gottschling D.E. Genetics. 1998; 150: 613-632Crossref PubMed Google Scholar, 21Osada S. Sutton A. Muster N. Brown C.E. Yates III, J.R. Sternglanz R. Workman J.L. Genes Dev. 2001; 15: 3155-3168Crossref PubMed Scopus (104) Google Scholar, 22Meijsing S.H. Ehrenhofer-Murray A.E. Genes Dev. 2001; 15: 3169-3182Crossref PubMed Scopus (127) Google Scholar) as well as DNA repair (5Tyler J.K. Adams C.R. Chen S.R. Kobayashi R. Kamakaka R.T. Kadonaga J.T. Nature. 1999; 402: 555-560Crossref PubMed Scopus (443) Google Scholar, 13Mello J.A. Sillje H.H. Roche D.M. Kirschner D.B. Nigg E.A. Almouzni G. EMBO Rep. 2002; 3: 329-334Crossref PubMed Scopus (227) Google Scholar, 23Emili A. Schieltz D.M. Yates III, J.R. Hartwell L.H. Mol. Cell. 2001; 7: 13-20Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 24Hu F. Alcasabas A.A. Elledge S.J. Genes Dev. 2001; 15: 1061-1066Crossref PubMed Scopus (133) Google Scholar), replication (5Tyler J.K. Adams C.R. Chen S.R. Kobayashi R. Kamakaka R.T. Kadonaga J.T. Nature. 1999; 402: 555-560Crossref PubMed Scopus (443) Google Scholar) and recombination (25Prado F. Cortes-Ledesma F. Aguilera A. EMBO Rep. 2004; 5: 497-502Crossref PubMed Scopus (85) Google Scholar). Asf1 interacts with a heterodimer of histones H3/H4 through the C-terminal region of H3 (26English C.M. Adkins M.W. Carson J.J. Churchill M.E.A. Tyler J.K. Cell. 2006; 127: 495-508Abstract Full Text Full Text PDF PubMed Scopus (340) Google Scholar, 27Natsume R. Eitoku M. Akai Y. Sano N. Horikoshi M. Senda T. Nature. 2007; 446: 338-341Crossref PubMed Scopus (235) Google Scholar). Importantly, two human family members of Asf1 (ASF1A and ASF1B) are involved in both the major S-phase histone H3.1- and histone variant H3.3 complexes, whereas the Asf1-interactive histone chaperones CAF-1 and HIRA are detected only in the histone H3.1 and H3.3 complexes, respectively (28Tagami H. Ray-Gallet D. Almouzni G. Nakatani Y. Cell. 2004; 116: 51-61Abstract Full Text Full Text PDF PubMed Scopus (973) Google Scholar). Consistently, Asf1 facilitates both DNA replication-dependent and -independent histone depositions cooperatively with the CAF-1 and HIR complexes, respectively (5Tyler J.K. Adams C.R. Chen S.R. Kobayashi R. Kamakaka R.T. Kadonaga J.T. Nature. 1999; 402: 555-560Crossref PubMed Scopus (443) Google Scholar, 28Tagami H. Ray-Gallet D. Almouzni G. Nakatani Y. Cell. 2004; 116: 51-61Abstract Full Text Full Text PDF PubMed Scopus (973) Google Scholar, 29Green E.M. Antczak A.J. Bailey A.O. Franco A.A. Wu K.J. Yates III, J.R. Kaufman P.D. Curr. Biol. 2005; 15: 2044-2049Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar), indicating the central role of Asf1 in controlling the state of histone deposition in the nucleus. Recently, the complex structure of human Asf1 with the B-domain of HIRA was reported (30Tang Y. Poustovoitov M.V. Zhao K. Garfinker M. Canutescu A. Dunbrack R. Adams P.D. Marmorstein R. Nat. Struct. Mol. Biol. 2006; 13: 921-929Crossref PubMed Scopus (132) Google Scholar). In addition, biochemical studies suggested that human Cac2, the second largest subunit of CAF-1, interacts with Asf1 at the HIRA-binding region of Asf1 through its B-domain-like motif at the C terminus (30Tang Y. Poustovoitov M.V. Zhao K. Garfinker M. Canutescu A. Dunbrack R. Adams P.D. Marmorstein R. Nat. Struct. Mol. Biol. 2006; 13: 921-929Crossref PubMed Scopus (132) Google Scholar). Hence, human Asf1 is thought to interact mutually exclusively with the histone chaperones HIRA and CAF-1. However, structural evidence for the interaction between Asf1 and CAF-1 has yet to be obtained. In addition, it is not clear how Asf1 recognizes HIRA and CAF-1 for histone assembly in yeast. In this study, we report the crystal structures of the apo-form of fission yeast Asf1/Cia1 (SpAsf1N; residues 1-161) and its complexes with the B-domain of the fission yeast HIRA orthologue Hip1 (Hip1B) and the C-terminal region of fission yeast Cac2 (Cac2C) (Fig. 1A). Cac2C shows remarkably similar modes of interaction toward Asf1 as compared with those of Hip1B and HIRA. Based on structural and biochemical analyses of the three histone chaperones, we discuss a mutually exclusive binding model of Asf1 to CAF-1 and Hip1/HIRA. Peptides—All peptides used in co-crystallization and for in vitro binding experiments were purchased from Invitrogen. Plasmids and Site-directed Mutagenesis—The structural domain of Asf1 from Schizosaccharomyces pombe (SpAsf1N; residues 1-161) was subcloned into the pET15b vector (Novagen) such that the construct consisted of an N-terminal hexahistidine tag followed by a thrombin cleavage site upstream of the expressed protein. For the GST fusion proteins used in the in vitro binding experiments, the SpAsf1N structural domain sequence was subcloned into the pGEX-2T vector (GE Healthcare). Point mutants of Asf1 were generated by subjecting the pGEX-2T-SpAsf1N constructs to mutagenesis using the QuikChange II site-directed mutagenesis system (Stratagene). The following mutagenic oligomers were used (forward primers are shown with mutation codons in bold-face, 5′ to 3′): D37A-forward, GTCTGGAGCCGTTAAAAAGCGCCCTGGAATGGAAGTTGACA; E39A-forward, CCGTTAAAAAGCGACCTGGCATGGAAGTTGACATATG; D58A-forward, AAGTTACGACCAAATTTTGGCCACGCTACTAGTGGGACCTA; L60A/V62A-forward, ACGACCAAATTTTGGACACGGCACTAGCGGGACCTATACCAATCGGG; E75A-forward, GGATTAATAAATTCGTTTTTGCAGCTGATCCTCCTAATATCG; D77A-forward, AATTCGTTTTTGAAGCTGCTCCTCCTAATATCGATCTT; V95A-forward, GATGTTTTGGGTGTCACAGCTATTTTACTCTCTTGTGC; D104A-forward, CTCTCTTGTGCATATGAGGCTAATGAGTTTGTTCGAGTAGG. All of the mutants were confirmed by DNA sequencing. Protein Expression and Purification—pET15-SpAsf1N was transformed into BL21(DE3) Escherichia coli (Novagen). The cells were grown to late log phase at 37 °C and were then induced overnight with 0.4 mm isopropyl 1-thio-β-d-galactopyranoside at 25 °C. The cells were lysed by sonication in 20 mm sodium phosphate, pH 7.4, 0.5 m NaCl, 20 mm imidazole, plus a complete protease inhibitor mixture tablet (Roche Applied Science). The supernatant fraction was loaded onto a HisTrap HP column (GE Healthcare), which was washed with the lysis buffer and then eluted with a linear imidazole gradient using 20 mm sodium phosphate, pH 7.4, 0.5 m NaCl, and 0.5 m imidazole as the elution buffer. The fractions of interest were pooled and further purified by gel filtration on a Superdex 75 16/60 column (GE Healthcare) with 20 mm Tris-HCl, pH 8.0, 0.15 m NaCl, and 1 mm dithiothreitol as the buffer. The N-terminal hexahistidine tag was cleaved by overnight digestion with thrombin (Sigma), and the free tag and the uncleaved proteins were removed by a second passage through the HisTrap HP column. Finally, another round of purification on the Superdex 75 16/60 column was performed. For GST-SpAsf1N expression, the constructs were transformed into BL21(DE3), grown to late log phase at 37 °C and then induced overnight with 0.4 mm isopropyl 1-thio-β-d-galactopyranoside at 25 °C. The fusion proteins were each bound to glutathione-Sepharose 4B columns (GE Healthcare), which were washed with 1× phosphate-buffered saline, pH 7.4, and 1 mm dithiothreitol and eluted with 10 mm reduced glutathione in 50 mm Tris-HCl, pH 8.0. Further purification was performed by gel filtration on a Superdex 75 10/30 column (GE Healthcare). Preparation of the SpAsf1N-Hip1B Peptide Complex and Its Crystallization—The expression, purification, and crystallization of the functional domain of SpAsf1-N (residues 1-161) were reported recently (31Umehara T. Otta Y. Tsuganezawa K. Matsumoto T. Tanaka A. Horikoshi M. Padmanabhan B. Yokoyama S. Acta Crystallogr. Sect. F Struct. Biol. Crystalliz. Commun. 2005; 61: 971-973Crossref PubMed Scopus (2) Google Scholar). The Asf1-Hip1B complex was formed by mixing 1 μg of freshly purified SpAsf1N with a 5-fold molar excess of the S. pombe Hip1 B-domain peptide (residues 469-497; IPTKFVQKVTITKEGKKRVAPQLLTTLSA) and incubating the mixture for 1 h at room temperature. The complex was then purified as a single peak by size exclusion chromatography on Superdex 75 resin. The purified complex was successfully crystallized in a 96-well plate by the sitting drop vapor diffusion method under 25% polyethylene glycol 3350 and 170 mm NH4F at a concentration of 4 mg/ml protein at 20 °C. The crystals were cryoprotected by briefly soaking them in the mother liquor solution containing 10% glycerol prior to flash-cooling in a cold stream of nitrogen gas. Preparation of the SpAsf1N-Cac2C Peptide Complex and Its Crystallization—The Asf1-Cac2C complex was formed by mixing purified SpAsf1N, at a 4 mg/ml final concentration, with a 5-fold molar excess of the S. pombe Cac2 homolog SPAC26H5.03 C-terminal sequence (residues 493-512; RKVESSKVSKKRIAPTPVYP) and incubating the mixture for 1 h at room temperature. Crystals of the complex were obtained by the sitting drop vapor diffusion method in 24-well plates in 1.8 m Na+/K+-PO4-2, pH 8.0, at 20 °C. The crystals were cryoprotected by carefully dragging them through a drop of paratone-N oil prior to flash-cooling in a cold stream of nitrogen gas. Data Collection and Structure Determination—Diffraction data were collected at the beamline BL26B1 (SPring-8, Hyogo, Japan) for the native SpAsf1N and on the RAXIS IV++ in-house facilities for the two complexes (Hip1B and Cac2C). All of the data were collected under cryogenic conditions. The data were processed and scaled using the HKL2000 package (32Otwinowski Z. Minor W. Carter Jr., C.W. Sweet R.M. Methods in Enzymology. 276. Academic Press, Orlando, FL1997: 307-326Google Scholar). The structure of the native SpAsf1N structure was determined by the molecular replacement method employing the ScAsf1 structure as a search model, using the program Molrep (33Vagin A. Teplyakov A. J. Appl. Crystallogr. 1997; 30: 1022-1025Crossref Scopus (4136) Google Scholar) from the CCP4 suite (34CCP4 (Collaborative Computational Project Number 4)Acta Crystallogr. Sect. D Biol. Crystallogr. 1994; 50: 760-763Crossref PubMed Scopus (19730) Google Scholar). The structures of the complexes were solved by molecular replacement using the native SpAsf1N structure as a model. Iterative manual model building and initial refinement were performed using the programs O (35Jones T.A. Zou J.Y. Cowan S.W. Kjeldgaard M. Acta Crystallogr. Sect. A. 1991; 47: 110-119Crossref PubMed Scopus (13006) Google Scholar) and CNS (36Brunger A.T. Adams P.D. Clore G.M. DeLano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Acta Crystallogr. Sect. D Biol. Crystallogr. 1998; 54: 905-921Crossref PubMed Scopus (16947) Google Scholar), respectively. Final refinement was carried out using Refmac5, which is incorporated in CCP4. Statistics for data processing and refinement for all three structures are listed in Table 1. The stereochemistry of the structures, as assessed with PROCHECK (37Laskowski R.A. Moss D.S. Thornton J.M. J. Mol. Biol. 1993; 231: 1049-1067Crossref PubMed Scopus (1078) Google Scholar), were excellent. All of the molecular graphics figures were generated using PyMOL.FIGURE 1Sequence conservation of Hip1 and Cac2. The red and yellow boxes denote strictly and highly conserved residues, respectively. Numbers below the alignments pertain to the numbering scheme used in the text to denote conserved residue positions. A, sequence alignment of five Asf1N structural domains from S. pombe (Sp_Asf1), S. cerevisiae (Sc_Asf1), Drosophila melanogaster Asf1 (Dm_Asf1), human Asf1a (h_Asf1a), and human Asf1b (h_Asf1b). The secondary structural features from the budding yeast structure (10Daganzo S.M. Erzberger J.P. Lam W.M. Skordalakes E. Zhang R. Franco A.A. Brill S.J. Adams P.D. Berger J.M. Kaufman P.D. Curr. Biol. 2003; 13: 2148-2158Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar) and the S. pombe structure (this study) are indicated above the alignments. Blue dashed lines below the alignments indicate the flexible L1, L2, and L3 helical/loop regions on SpAsf1N. B, sequence alignment of the B-domain regions of HIRA orthologues: Hip1/HIRL from S. pombe (Hip1 Sp); Hir1 from S. cerevisiae (Hir1 Sc); HIRA from D. melanogaster (HIRA Dm), Xenopus laevis (HIRA Xl), mouse (HIRA Mm), and human (HIRA Hs); and nucleotide-binding protein from Arabidopsis thaliana (Nucb At). C, sequence alignment of B-domain-like regions from the C termini of CAF-1 Cac2/p60 orthologues: hypothetical protein SPAC26H5.03 from S. pombe (Cac2 Sp); Cac2 from S. cerevisiae (Cac2 Sc), and Candida albicans (Cac2 Ca); Fasciata2 from A. thaliana (Fas2 At); p105 from D. melanogaster (p105 Dm); and p60 from mouse (p60 Mm) and human (p60 Hs). The vertebrate p60 proteins have two overlapping B-domain-like sequences, denoted as 1 and 2. D, sequence comparison of the S. pombe Hip1 B-domain and the Cac2 orthologue C-terminal region.View Large Image Figure ViewerDownload Hi-res image Download (PPT)TABLE 1Summary of data collection and refinement statisticsData collection parametersCrystalNativeHip1B complexCac2C complexDiffraction dataSpace groupC2P21I41Unit cell parameters (Å, °)a = 78.62, b = 41.30, c = 67.21, β = 115.65a = 62.01, b = 48.09, c = 63.25, β = 99.25a = b = 151.51, c = 144.21Resolution (Å)1.802.302.6Wavelength (Å)1.001.54181.5418Measured reflections62,38751,5723,07,285Unique reflections17,83616,18850,092Rmerge (%)aNumbers in parentheses are values in the highest resolution shell.,bRmerge = ∑|Iobs - |/∑ summed over all observations and reflections.7.6 (19.8)6.9 (23.8)7.2 (48.8)Completeness (%)97.7 (87.4)97.6 (98.7)99.9 (100)Redundancy3.5 (2.4)3.2 (3.2)6.1 (6.0)Overall I/σ28.2 (5.3)19.6 (5.0)25.2 (3.9)Refinement statisticsResolution range60-1.8031-2.4032-2.70Working set16,92013,54342,342Test set (5.0%)9147362,252Total atomsProteins (Asf1 + peptide)1,274 (no peptide)2,77810,996Ligands10 (PEG)cPEG, polyethylene glycol.Water molecules248129312R-factor (%)dRcryst = ∑||Fobs| - |Fcalc||/∑|Fobs|.19.119.420.8Rfree (%)eRfree was calculated with 5% of the data omitted from refinement.22.925.426.3Mean B-factor (Å2)26.929.639.0r.m.s.d.Bond lengths (Å)0.0250.0210.022Bond angles (°)1.9661.7391.749Ramachandran plot (%)Most favored regions92.790.791.1Allowed regions6.68.98.5Generously allowed regions0.70.30.3Disallowed regions0.00.00.0a Numbers in parentheses are values in the highest resolution shell.b Rmerge = ∑|Iobs - |/∑ summed over all observations and reflections.c PEG, polyethylene glycol.d Rcryst = ∑||Fobs| - |Fcalc||/∑|Fobs|.e Rfree was calculated with 5% of the data omitted from refinement. Open table in a new tab Surface Plasmon Resonance Binding Assay—Steady-state binding analyses between GST-SpAsf1N and the Hip1B or Cac2C peptides were carried out using a Biacore-3000 apparatus. Experiments were performed at 25 °C, using a CM5 sensor chip and HBS-EP buffer (10 mm HEPES, pH 7.4, 150 mm NaCl, 3 mm EDTA, 0.005% surfactant P20). The GST-Asf1N proteins were captured at final densities of 14,000 to 16,000 resonance units. The peptides in the HBS-EP buffer were passed over the GST-SpAsf1N surfaces at a rate of 20 μl min-1. The concentrations of the wild-type peptides were 62.5, 125, 250, 500, 1000, 2000, 4000, and 8000 nm, and those of the mutant peptides were 250, 500, 1000, 2000, 4000, and 8000 nm. A saturated response value at each concentration of the peptide was used as the equilibrium response value, and the steady-state data were fit to a simple 1:1 interaction model to obtain the dissociation constants. Sequence Comparison of Hip1 and Cac2—The Asf1 protein associates with HIRA through the Asf1 binding domain of HIRA (namely, the B-domain) (38Nelson D.M. Ye X. Hall C. Santos H. Ma T. Kao G.D. Yen T.J. Harper J.W. Adams P.D. Mol. Cell. Biol. 2002; 22: 7459-7472Crossref PubMed Scopus (128) Google Scholar, 39Zhang R. Poustovoitov M.V. Ye X. Santos H.A. Chen W. Daganzo S.M. Erzberger J.P. Serebriiskii I.G. Canutescu A.A. Dunbrack R.L. Pehrson J.R. Berger J.M. Kaufman P.D. Adams P.D. Dev. Cell. 2005; 8: 19-30Abstract Full Text Full Text PDF PubMed Scopus (530) Google Scholar). The HIRA homolog from S. pombe, Hip1/HIRL, is a 932-residue protein containing eight WD40 repeat domains. The putative Hip1 B-domain lies in the region between WD40 repeats 6 and 7, within residues 450-500. A sequence alignment of the B-domains from a diverse array of organisms shows a high degree of conservation (Fig. 1B). The "consensus sequence" consists of a conserved glycine (Gly-483) at position -3 followed immediately by three positively charged residues, with a conserved arginine (Arg-486) at position 0, and a proline residue (Pro-489) occupying position +3. The Cac2/p60 subunit of the CAF-1 complex similarly binds to Asf1 (12Tyler J.K. Collins K.A. Prasad-Sinha J. Amiott E. Bulger M. Harte P.J. Kobayashi R. Kadonaga J.T. Mol. Cell. Biol. 2001; 21: 6574-6584Crossref PubMed Scopus (175) Google Scholar, 13Mello J.A. Sillje H.H. Roche D.M. Kirschner D.B. Nigg E.A. Almouzni G. EMBO Rep. 2002; 3: 329-334Crossref PubMed Scopus (227) Google Scholar, 15Sutton A. Bucaria J. Osley M.A. Sternglanz R. Genetics. 2001; 158: 587-596Crossref PubMed Google Scholar). A sequence alignment of the Cac2/p60 C-terminal residues from various organisms is shown in Fig. 1C. The alignment reveals that the C-terminal region of p60 exhibits significant similarity to the B-domain of HIRA (Fig. 1D). An arginine (Arg-504) at position 0 is the only strictly conserved residue in the aligned sequences; this is preceded by another basic residue at position -1 and is followed by hydrophobic residues at positions +1, +3, and +6. In vertebrate sequences, a pair of overlapping Asf1-binding sites is predicted to lie at the Cac2/p60 C termini (30Tang Y. Poustovoitov M.V. Zhao K. Garfinker M. Canutescu A. Dunbrack R. Adams P.D. Marmorstein R. Nat. Struct. Mol. Biol. 2006; 13: 921-929Crossref PubMed Scopus (132) Google Scholar). In S. pombe, the putative Cac2/p60 orthologue corresponds to SPAC26H5.03, a WD40 repeat protein that shares 34% sequence identity with Saccharomyces cerevisiae p60 along its entire length. Interestingly, in S. pombe there is greater similarity between the Hip1 B-domain and the C-terminal region of the putative Cac2 protein than in most of the other organisms examined, with the Lys-Lys-Arg (484-486) residues at positions -2 to 0 and the Ala-Pro (488-489) residues at positions +2 to +3 being conserved (Fig. 1D). The Native SpAsf1N Structure—For the structure determination, we expressed and purified the highly conserved, N-terminal structural domain of S. pombe Asf1/Cia1 (SpAsf1N; residues 1-161), which corresponds to the functionally active globular domain of S. cerevisiae Asf1. The native spAsf1 protein was crystallized in the C2 space group, with one molecule in the asymmetric unit. The structure was solved by molecular replacement, using the ScAsf1/Cia1 structure (40Padmanabhan B. Kataoka K. Umehara T. Adachi N. Yokoyama S. Horikoshi M. J. Biochem. (Tokyo). 2005; 138: 821-829Crossref PubMed Scopus (10) Google Scholar) as a model (Table 1). The native structure of SpAsf1N is similar to those of ScAsf1 (10Daganzo S.M. Erzberger J.P. Lam W.M. Skordalakes E. Zhang R. Franco A.A. Brill S.J. Adams P.D. Berger J.M. Kaufman P.D. Curr. Biol. 2003; 13: 2148-2158Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 40Padmanabhan B. Kataoka K. Umehara T. Adachi N. Yokoyama S. Horikoshi M. J. Biochem. (Tokyo). 2005; 138: 821-829Crossref PubMed Scopus (10) Google Scholar) and human Asf1 (41Mousson F. Lautrette A. Thuret J.Y. Agez M. Courbeyrette R. Amigues B. Becker E. Neumann J.M. Guerois R. Mann C. Ochsenbein F. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 5975-5980Crossref PubMed Scopus (114) Google Scholar). Briefly, the core of the spAsf1 structure consists of 10 β-strands forming an elongated β-sandwich of two anti-parallel sheets packed against each other (Fig. 2). The topology falls into the "switched" immunoglobulin class of proteins. The "front" face is composed of the strands β4, β5, β7, β8, and β10, and the "back" face is formed by the strands β1, β3, and β6. The front face forms a highly hydrophobic concave surface. In contrast to the well conserved β-strands, the three loop/helical regions connecting the β-strands (loops β4-β5, β6-β7, and β8-β9) are less conserved. These loops are positioned above the hydrophobic surface and exhibit a greater degree of flexibility (see below). Structure of the SpAsf1N-Hip1B Complex—As described under "Experimental Procedures," the SpAsf1N protein was co-purified with the Hip1 B-domain peptide (Hip1B; residues 469-497), yielding a crystal in the P21 space group containing two complexes per asymmetric unit (Table 1). The electron density for the peptide was clearly visible in the regions corresponding to residues 474-494 of one molecule (chain E in the Protein Data Bank code 2Z34) and residues 475-496 of the other molecule (chain F). The peptide adopts a

Referência(s)