hINADl/PATJ, a Homolog of Discs Lost, Interacts with Crumbs and Localizes to Tight Junctions in Human Epithelial Cells
2002; Elsevier BV; Volume: 277; Issue: 28 Linguagem: Inglês
10.1074/jbc.m202196200
ISSN1083-351X
AutoresCéline Lemmers, Emmanuelle Médina, Marie-Hélène Delgrossi, Michel Didier, Jean‐Pierre Arsanto, André Le Bivic,
Tópico(s)Wnt/β-catenin signaling in development and cancer
ResumodCrumbs is an apical organizer crucial for the maintenance of epithelial polarity in Drosophila(1Knust E. Curr. Opin. Genet. Dev. 2000; 10: 471-475Crossref PubMed Scopus (49) Google Scholar). It is known that dCrumbs interacts with Discs lost (Dlt), a protein with four PDZ (PSD95/Discs Large/ZO-1) domains (2Bhat M.A. Izaddoost S., Lu, Y. Cho K.O. Choi K.W. Bellen H.J. Cell. 1999; 96: 833-845Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar), and Stardust (Sdt), a protein of the MAGUK (membrane-associated guanylate kinase) family (3Hong Y. Stronach B. Perrimon N. Jan L.Y. Jan Y.N. Nature. 2001; 414: 634-638Crossref PubMed Scopus (202) Google Scholar, 4Bachmann A. Schneider M. Theilenberg E. Grawe F. Knust E. Nature. 2001; 414: 638-643Crossref PubMed Scopus (235) Google Scholar). We have searched for potential homologs of Dlt in human epithelial cells and characterized one of them in intestinal epithelial cells. Human INAD-like (hINADl) contains 8 PDZ domains, is concentrated in tight junctions, and is also found at the apical plasma membrane. Overexpression of hINADl disrupted the tight junctions localization of ZO-1 and 3. We also identified a partial cDNA coding the transmembrane and cytoplasmic domains of a new human crumbs (CRB3) expressed in Caco-2 cells. This CRB3 was able to interact through its C-terminal end with the N-terminal domain of hINADl. Taken together, the data indicate that hINADl is likely to represent a Dlt homolog in mammalian epithelial cells and might be involved in regulating the integrity of tight junctions. We thus propose to rename hINADl PATJ for proteinassociated to tight junctions. dCrumbs is an apical organizer crucial for the maintenance of epithelial polarity in Drosophila(1Knust E. Curr. Opin. Genet. Dev. 2000; 10: 471-475Crossref PubMed Scopus (49) Google Scholar). It is known that dCrumbs interacts with Discs lost (Dlt), a protein with four PDZ (PSD95/Discs Large/ZO-1) domains (2Bhat M.A. Izaddoost S., Lu, Y. Cho K.O. Choi K.W. Bellen H.J. Cell. 1999; 96: 833-845Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar), and Stardust (Sdt), a protein of the MAGUK (membrane-associated guanylate kinase) family (3Hong Y. Stronach B. Perrimon N. Jan L.Y. Jan Y.N. Nature. 2001; 414: 634-638Crossref PubMed Scopus (202) Google Scholar, 4Bachmann A. Schneider M. Theilenberg E. Grawe F. Knust E. Nature. 2001; 414: 638-643Crossref PubMed Scopus (235) Google Scholar). We have searched for potential homologs of Dlt in human epithelial cells and characterized one of them in intestinal epithelial cells. Human INAD-like (hINADl) contains 8 PDZ domains, is concentrated in tight junctions, and is also found at the apical plasma membrane. Overexpression of hINADl disrupted the tight junctions localization of ZO-1 and 3. We also identified a partial cDNA coding the transmembrane and cytoplasmic domains of a new human crumbs (CRB3) expressed in Caco-2 cells. This CRB3 was able to interact through its C-terminal end with the N-terminal domain of hINADl. Taken together, the data indicate that hINADl is likely to represent a Dlt homolog in mammalian epithelial cells and might be involved in regulating the integrity of tight junctions. We thus propose to rename hINADl PATJ for proteinassociated to tight junctions. zonula adherens Madin-Darby canine kidney human inactivation no after potential D-like zonula occludens tight junctions septate junctions Discs lost multi-PDZ-domain protein atypical protein kinase C dipeptidyl peptidase IV vesicular stomatitis virus protein G protein associated to tight junctions reverse transcriptase new human crumbs membrane-associated guanylate kinase Stardust Drosophila The polarized organization of epithelial cells is a fundamental process in animal development and the use of genetics inDrosophila has made a significant contribution to the understanding of some of the mechanisms involved in epithelial polarity (for recent reviews, see Refs. 1Knust E. Curr. Opin. Genet. Dev. 2000; 10: 471-475Crossref PubMed Scopus (49) Google Scholar, 5Knoblich J.A. Curr. Biol. 2000; 10: R791-R794Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar, and 6Kramer H. J. Cell Biol. 2000; 151: F15-F18Crossref PubMed Scopus (5) Google Scholar). This approach has led to the identification of Armadillo (7Peifer M. McCrea P.D. Green K.J. Wieschaus E. Gumbiner B.M. J. Cell Biol. 1992; 118: 681-691Crossref PubMed Scopus (306) Google Scholar), Discs Large(8Woods D.F. Hough C. Peel D. Callaini G. Bryant P.J. J. Cell Biol. 1996; 134: 1469-1482Crossref PubMed Scopus (351) Google Scholar), and Scribble (9Bilder D. Perrimon N. Nature. 2000; 403: 676-680Crossref PubMed Scopus (551) Google Scholar), to name a few of the genes regulating epithelial cell shape and polarity. Among the protein complexes that have been identified as playing a major role in creating or maintaining epithelial cell polarity in Drosophila, the dCrumbs (Crumbs) complex remains the only one localized on the apical side of the epidermal cells (10Tepass U. Theres C. Knust E. Cell. 1990; 61: 787-799Abstract Full Text PDF PubMed Scopus (547) Google Scholar). Embryos mutant for crumbs die after gastrulation with severe defects in epidermal cell polarity (11Wodarz A. Hinz U. Engelbert M. Knust E. Cell. 1995; 82: 67-76Abstract Full Text PDF PubMed Scopus (547) Google Scholar) because of a failure to assemble a zonula adherens (ZA)1 from spot adherens junctions (12Tepass U. Dev. Biol. 1996; 177: 217-225Crossref PubMed Scopus (201) Google Scholar, 13Grawe F. Wodarz A. Lee B. Knust E. Skaer H. Development. 1996; 122: 951-959PubMed Google Scholar). Thus, dCrumbs, which is localized on the apical side of the ZA, controls its assembly and positioning during gastrulation. Its cytoplasmic domain, which contains 37 amino acids, mediates this important function. In fact one of the loss-of-function alleles of crumbs (8F105) is a stop mutation that prevents the translation of the last 23 amino acids (10Tepass U. Theres C. Knust E. Cell. 1990; 61: 787-799Abstract Full Text PDF PubMed Scopus (547) Google Scholar). Recently, a gene named Discs lost (dlt) was shown to have a crucial role in epithelial polarization (2Bhat M.A. Izaddoost S., Lu, Y. Cho K.O. Choi K.W. Bellen H.J. Cell. 1999; 96: 833-845Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar), and the protein Dlt is also localized to the subapical region where dCrumbs is concentrated. Indeed, Dlt interacts by the first of its four PDZ (PSD95/Discs Large/ZO-1) domains (2Bhat M.A. Izaddoost S., Lu, Y. Cho K.O. Choi K.W. Bellen H.J. Cell. 1999; 96: 833-845Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar) with the C-terminal four amino acids ERLI of the dCrumbs cytoplasmic domain (14Klebes A. Knust E. Curr. Biol. 2000; 10: 76-85Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar). Thus, the dCrumbs-Dlt complex is a key component regulating cell polarity probably by controlling the assembly and positioning of the ZA in Drosophila epidermal cells. The presence of four PDZ domains in Dlt enables it to build a protein complex serving as a scaffold whose ultimate function would be to direct the assembly of E-cadherin and other components to their correct positions in the membrane. Although the identification of the dCrumbs complex inDrosophila has shed light on epithelial organization, very little is known about the conservation of such a complex in vertebrates. First, the organization of the junctional complexes is different between arthropods and vertebrates because the latter possesses tight junctions (TJs) localized just apical to the ZA, whereas the former establish septate junctions (SJs) basolateral to the ZA (1Knust E. Curr. Opin. Genet. Dev. 2000; 10: 471-475Crossref PubMed Scopus (49) Google Scholar). Tight junctions are made of transmembrane proteins such as claudins and occludins and septate junctions contain neurexin IV. SJs recruit cytoplasmic proteins like Discs Large, Coracle, and Scribble, whereas TJs have ZO-1, -2, -3, and cingulin as peripheral proteins (for a recent review, see Ref. 15Zahraoui A. Louvard D. Galli T. J. Cell Biol. 2000; 151: F31-F36Crossref PubMed Scopus (161) Google Scholar). Thus, while performing the sealing of the epithelial monolayer SJs and TJs can be considered as distinct molecular entities. It has been proposed that the subapical region (or marginal zone) of epithelial cells in Drosophila can be compared to some extent to TJs of vertebrates (1Knust E. Curr. Opin. Genet. Dev. 2000; 10: 471-475Crossref PubMed Scopus (49) Google Scholar). In fact, some of the proteins found in this subapical region like Par-3 (Bazooka) and an atypical protein kinase C (aPKC) are also localized at the TJs (16Wodarz A. Ramrath A. Grimm A. Knust E. J. Cell Biol. 2000; 150: 1361-1374Crossref PubMed Scopus (376) Google Scholar,17Izumi Y. Hirose T. Tamai Y. Hirai S. Nagashima Y. Fujimoto T. Tabuse Y. Kemphues K.J. Ohno S. J. Cell Biol. 1998; 143: 95-106Crossref PubMed Scopus (439) Google Scholar). If this hypothesis is true, a protein complex homolog to the dCrumbs complex should also be localized to the TJs in mammalian epithelial cells. Interestingly, a human homolog of Crumbs, called CRB1, was cloned from patients suffering from retinitis pigmentosa 12, but the isolated cDNA lacked a transmembrane and cytoplasmic domain (18den Hollander A.I. ten Brink J.B. de Kok Y.J. van Soest S. van den Born L.I. van Driel M.A. van de Pol D.J. Payne A.M. Bhattacharya S.S. Kellner U. Hoyng C.B. Westerveld A. Brunner H.G. Bleeker- Wagemakers E.M. Deutman A.F. Heckenlively J.R. Cremers F.P. Bergen A.A. Nat. Genet. 1999; 23: 217-221Crossref PubMed Scopus (384) Google Scholar). No homolog of Dlt has yet been described and therefore the existence of a conserved complex in vertebrates is unknown. To answer this question, we have searched for putative homologs of Dlt in human epithelial cells using the first PDZ domain of Dlt, which was suggested to bind the cytoplasmic tail of dCrumbs (2Bhat M.A. Izaddoost S., Lu, Y. Cho K.O. Choi K.W. Bellen H.J. Cell. 1999; 96: 833-845Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar). We have identified two human proteins with a highly conserved PDZ domain, Mupp1 (19Ullmer C. Schmuck K. Figge A. Lubbert H. FEBS Lett. 1998; 424: 63-68Crossref PubMed Scopus (148) Google Scholar) and hINADl (20Philipp S. Flockerzi V. FEBS Lett. 1997; 413: 243-248Crossref PubMed Scopus (54) Google Scholar) and have characterized one of these, hINADl. hINADl was localized to the apical membrane and was highly concentrated at the level of the TJs both in Caco-2 and MDCK epithelial cells. Overexpression of hINADl in MDCK cells disrupted the localization of TJs markers (ZO-1 and ZO-3). In addition, hINADl co-immunoprecipitated with a new human Crumbs expressed in epithelial cells, CRB3, in which the extracellular domain was replaced by a vesicular stomatitis virus protein G (VSV-G) epitope (Crumbs-VSV-G). This interaction involved the N-terminal region of hINADl and the C-terminal region of the CRB3 cytoplasmic domain. Thus a complex similar to the one found in Drosophila can regulate the function of TJs in mammalian epithelial cells outside the retina where CRB1 is expressed. Protein A-Sepharose was fromAmersham Biosciences. Polyclonal antibodies against ZO-1 and ZO-3 were a kind gift from Dr. K. Matter (London, UK), and polyclonal antibodies against villin were from Dr. D. Louvard (Paris, France). Monoclonal antibody against dipeptidyl peptidase IV (DPPIV) was a gift from Dr. A. Quaroni (Ithaca, NY), and monoclonal antibody against Ag525 has been characterized previously (21Le Bivic A. Bosc-Biern I. Reggio H. Eur. J. Cell Biol. 1988; 46: 113-120PubMed Google Scholar). Polyclonal anti-placental alkaline phosphatase was from Accurate Chemical and Scientific Corp. (Westbury, NY). Monoclonal antibody against occludin was from Zymed Laboratories Inc. (San Francisco, CA), and 9E10 monoclonal antibody against Myc was from Santa Cruz (La Jolla, CA). A mouse monoclonal anti-VSV-G antibody P5D4 (Sigma) was used at a dilution of 1:500 and 1:300 for immunoprecipitation and immunofluorescence, respectively. Polyclonal antibodies against hINADl (fragments 10–130 and 800–1000) and Mupp1 (fragment 787–989) were produced by the injection of purified histidine-tagged fragments into rabbits (50 μg per boost; a boost every 3 weeks). His-tagged hINADl and Mupp1 were also coupled to CNBr-activated Sepharose beads to purify the respective polyclonal antibodies. His-tagged hINADl and Mupp1 were obtained by subcloning the 10–130 or 800–1000 fragments of hINADl and the 787–989 fragment of Mupp1 in pQE-30 vector from Quiagen (Chestwort, CA) and expression in M15 Escherichia coli, according to the manufacturer's instructions. Caco-2 cells were obtained from Dr. A. Zweibaum (Villejuif, France) and grown as described (22Garcia M. Mirre C. Quaroni A. Reggio H. Le Bivic A. J. Cell Sci. 1993; 104: 1281-1290Crossref PubMed Google Scholar) with neomycin (0.25 mg/ml) when transfected. Caco-2 and HeLa cells were transfected using FuGENE 6 (Roche Diagnostics), and positive clones were isolated using 1 mg/ml of G418 and tested for expression by immunofluorescence after sodium butyrate induction (10 mm, 16 h). The same protocol of transfection was used for transient expression in MDCK cells without sodium butyrate treatment. hINADl (locus 47) and Mupp1 cDNAs were cloned by RT-PCR using the Superscript kit (Invitrogen) and Caco-2 and HeLa total RNAs, respectively. PCR amplification was performed with the High Fidelity Polymerase (Roche Diagnostics). hINADl constructs tagged with a Myc epitope were obtained by PCR, subcloned in bicistronic pIRES1-neo (CLONTECH Laboratories, Palo Alto, CA), and re-sequenced entirely. The chimera construct dCrumbs-VSV-G was obtained by amplifying a C-terminal dCrumbs fragment containing the stalk region, transmembrane domain, and cytoplasmic domain of dCrumbs (amino acids 2074–2146) and cloning it into the pUC19 vector containing the VSV-G tag (a gift from Dr. P. Boquet, Nice, France). This fusion construct was subsequently subcloned into theEcoRI-BamHI sites of pIRES1neo vector (CLONTECH Laboratories, Inc.). Human Crumbs cytoplasmic domains were amplified with the High Fidelity polymerase (Roche Diagnostics) using the following primers: ATTGTTGCTTCTGTTGTCACCT (forward) and CTAAATCAGTCTCTCCATTGC (reverse) for CRB1, CTCCTTTCAGGGATCCTGGCAG (forward) and CTAGATGAGTCTCTCCTCCGGT (reverse) for CRB2, GCTGTGGGGCTGGCACTGTTGGTG (forward) and TCAGATGAGCCGCTCTTCCGGC (reverse) for CRB3. PCR products were sequenced to verify the identity of the amplified products. Cells were grown on glass coverslips and processed as described (23Breuza L. Fransen J. Le Bivic A. Am. J. Physiol. Cell Physiol. 2000; 279: C1239-C1248Crossref PubMed Google Scholar). Confocal microscopy analysis was performed using a Zeiss confocal microscope (LSM 410 invert). For immunoelectron microscopy, ultrathin frozen sections of Caco-2 cells and human colon were obtained and processed as described (24Saito H. Santoni M.J. Arsanto J.P. Jaulin-Bastard F., Le Bivic A. Marchetto S. Audebert S. Isnardon D. Adelaide J. Birnbaum D. Borg J.P. J. Biol. Chem. 2001; 276: 32051-32055Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). Northern blots were performed as previously described (25Delgrossi M.H. Breuza L. Mirre C. Chavrier P. Le Bivic A. J. Cell Sci. 1997; 110: 2207-2214Crossref PubMed Google Scholar) using human poly(A) RNA from CLONTECH, whereas total cellular RNA was extracted from Caco-2 cells using RNAzol (Bioprobe, Montreuil-sous-Bois, France). Immunoblots and immunoprecipitations were performed as previously described (26Le Bivic A. Real F.X. Rodriguez-Boulan E. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 9313-9317Crossref PubMed Scopus (148) Google Scholar). For co-immunoprecipitation, cells were lysed in 20 mm TRIS, pH 7.5, 240 mm NaCl, 50 mmKCl, 4 mm EGTA, 4 mm EDTA, 0.2 mmdithiothreitol, and 1% Triton X-100 (buffer N) at 4 °C. Immunoprecipitates were washed three times with buffer N and analyzed by SDS-PAGE and Western blotting. To find potential functional human homologs of Dlt we searched for proteins with a PDZ domain resembling the first PDZ domain of Dlt, which is involved in Drosophila Crumbs interaction (2Bhat M.A. Izaddoost S., Lu, Y. Cho K.O. Choi K.W. Bellen H.J. Cell. 1999; 96: 833-845Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar). We found two human proteins, hINADl (20Philipp S. Flockerzi V. FEBS Lett. 1997; 413: 243-248Crossref PubMed Scopus (54) Google Scholar) and Mupp1 (19Ullmer C. Schmuck K. Figge A. Lubbert H. FEBS Lett. 1998; 424: 63-68Crossref PubMed Scopus (148) Google Scholar), with a PDZ domain (PDZ2) that is highly conserved (84% similarity) (Fig.1). Both proteins only possess PDZ domains (8 and 13, respectively), suggesting that they act, similar to Dlt, as scaffold proteins with no enzymatic activities. The first five PDZ domains of hINADl and Mupp1 are aligned, whereas the PDZ domains 6, 7, and 8 of hINADl resemble PDZ domains 7, 8, and 10 of Mupp1, respectively. The tissue distribution of Mupp1 in human has been previously reported (19Ullmer C. Schmuck K. Figge A. Lubbert H. FEBS Lett. 1998; 424: 63-68Crossref PubMed Scopus (148) Google Scholar), and a 8.5-kb mRNA is present in heart, brain, placenta, liver, skeletal muscle, kidney, and pancreas. Moreover two other transcripts of 5 and 4 kb are also present in some of these tissues. We performed a similar analysis of hINADl distribution in human tissues and found that a major transcript of 7 kb was expressed in the bladder, testis, ovary, small intestine, colon, heart, skeletal muscle, and pancreas (Fig. 2). A smaller transcript of 4.1 kb was also detected in testis. In Caco-2 cells at least 3 transcripts (7, 4.1, and 3 kb) were detected, indicating that indeed several forms of hINADl were expressed in cells derived from human colon.Figure 2Tissue expression of hINADl.A, hINADl probe (base pairs 2400–3000) was labeled with [32P]dCTP by random priming. This was then used to probe human tissue Northern blot membranes (CLONTECH) and Caco-2 RNAs. B, membranes were stripped and re-probed with control probe for actin generated by the same method. Molecular mass markers are indicated on the right.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Because nothing is known about the cellular role or distribution of hINADl, we produced antibodies against the bridge region (amino acids 800–1000) between PDZ domains 5 and 6, which is the least conserved region of this protein, and against the N-terminal domain (amino acids 10–130) (Fig. 1). Antibodies were affinity-purified using injected protein fragments and tested by Western blotting on total lysates from epithelial cell lines and human colon. Using antibodies against the 800–1000 domain, hINADl offered a complex pattern with several species both in HeLa and Caco-2 cells and also in human colon (Fig. 3, A and C). The main species were 230, 200, and 135 kDa (some of them were doublets; 230 and 135 kDa, in particular), and the 75-kDa species was detected mostly in Caco-2 cells (Fig. 3 C). The antibodies against the N-terminal region recognized the high molecular mass bands (230, 200, and 135 kDa in particular) (Fig.3 B), suggesting that the 75-kDa species has a different site for initiation of translation. All of these different molecular masses most likely represent isoforms of hINADl because we discovered in the cDNA data libraries at least six isoforms either with alternative splicing or with different initiation sites for translation (not shown). To support this hypothesis some of these transcripts are tissue-specific (27Soejima H. Kawamoto S. Akai J. Miyoshi O. Arai Y. Morohka T. Matsuo S. Niikawa N. Kimura A. Okubo K. Mukai T. Genomics. 2001; 74: 115-120Crossref PubMed Scopus (13) Google Scholar), and we detected at least three transcripts in Caco-2 cells by Northern blotting and many alternative spliced forms by RT-PCR (not shown). We cannot exclude, however, that some of the bands are natural or experimental degradation products. This hypothesis is not supported by the fact that when we expressed cells a full-length hINADl tagged with a Myc epitope in Caco-2 we only observed one band with few degradation products, using the anti-Myc antibodies (Fig. 3 B). It is worth noting that instead of migrating at a predicted molecular mass of 170 kDa the Myc-hINADl construct migrated at about 230 kDa, which could be because of a particular shape or stable association with another cellular component. Furthermore, both antibodies raised against hINADl strongly recognized the same 230-kDa band in transfected cells, indicating that our antibodies indeed recognized hINADl (shown for the N-terminal antibodies in Fig. 3 B, N-ter). Thus, there must be a complex regulation of hINADl gene products in epithelial cells, but we do not yet know its functional consequences. Subsequently we tested the membrane association of hINADl with the prediction that a potential functional homolog of Dlt should be membrane-associated because Dlt itself is found predominantly in the membrane fraction derived fromDrosophila S2 cells. 2E. Médina and A. Le Bivic, unpublished results. All isoforms of hINADl were found associated with the membrane fraction of Caco-2 and human colon cells (Fig. 3 C) with the exception of the 75-kDa form, which was also found in the cytosol. Purified antibodies were used to localize hINADl in Caco-2 cells (Fig.4 A) and in MDCK cells (Fig.4 B). When Caco-2 cells were grown in subconfluent cultures we observed that hINADl was recruited early at cell-cell contacts indicating that it might associate with cell-cell junctions (not shown). In confluent cells, hINADl co-localized with occludin, a marker of TJs in epithelial cells (28Furuse M. Hirase T. Itoh M. Nagafuchi A. Yonemura S. Tsukita S. J. Cell Biol. 1993; 123: 1777-1788Crossref PubMed Scopus (2108) Google Scholar), and with DPPIV, a marker of the apical membrane of intestinal cells (29Quaroni A. Isselbacher K.J. Dev. Biol. 1985; 111: 267-279Crossref PubMed Scopus (78) Google Scholar). No co-localization was observed with a basolateral marker, Ag525 (21Le Bivic A. Bosc-Biern I. Reggio H. Eur. J. Cell Biol. 1988; 46: 113-120PubMed Google Scholar). This distribution was also observed in MDCK cells with the antibody against the first 10–130 residues, confirming that the endogenous protein recognized was hINADl (Fig.4 B). The same pattern of labeling was seen on sections of human colon indicating that hINADl was associated with the apical plasma membrane and the tight junctions complex in vivo (not shown). To better evaluate the relationship between hINADl and TJs, we performed immunolocalization experiments with gold particles on ultrathin frozen sections of Caco-2 cells and human colon (Fig.4 C). In both cell types, hINADl was clearly associated with tight junctions, often with the apical side, and was also localized beneath the apical plasma membrane and in the microvilli. Double staining using a monoclonal antibody against occludin confirmed that the two proteins were indeed located in close proximity, confirming that hINADl was associated with TJs (Fig. 4 C). To determine whether it was indeed hINADl that was enriched in the TJs and not a protein cross-reacting with the antibodies, a full-length construct coding for hINADl and tagged with a Myc epitope was transiently expressed in Caco-2 cells and localized using the monoclonal anti-Myc antibody. When expressed at moderate levels, this construct concentrated at the TJs where it co-localized with ZO-1 (Fig.5 B), confirming that hINADl is part of the TJs complex. We next evaluated the impact of overexpression of Myc-hINADl on the integrity of TJs in epithelial cells. For this, we transiently transfected MDCKII cells reaching confluence with Myc-hINADl or with a form in which the first five PDZ domains were deleted (F2 construct) (Fig. 5 A). In cells overexpressing Myc-hINADl the labeling of ZO-1 and ZO-3 was disrupted leading to partial or total loss of peripheral staining (Fig.6). Polarity of apical (BC44) or basolateral (BC11) markers and of γ-catenin was not altered (not shown). These data indicate that cell polarity and adhesion were not affected by these levels of overexpression. No disruption of the ZO-1 and ZO-3 staining was observed with the F2 construct under the same conditions (not shown). Thus, association of at least two molecules of the TJs was impaired, but the overall structure of epithelial cell architecture was preserved.Figure 6Overexpression of hINADl-Myc in MDCK cells. hINADl-Myc was transiently expressed in MDCK cells, and the cells were double-labeled with the anti-Myc (shown in green) and the anti-ZO-1 or anti-ZO-3 antibodies (shown in red).A, X-Y confocal sections show that cells overexpressing hINADl-Myc have a disrupted distribution of ZO-3 (arrows) when compared with non-expressing cells. An arrowheadindicates remaining spots of labeling at the level of TJs.B, Z confocal sections show that cells overexpressing hINADl-Myc have a disrupted distribution of ZO-1 and ZO-3 (arrows) when compared with non-expressing cells.Arrowheads indicate TJs. Bar, 10 μm.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We next tested whether hINADl is a potential homolog of Dlt in mammalian epithelial cells by investigating its capacity to interact with theDrosophila Crumbs. We designed a construct in which the extracellular domain of Drosophila Crumbs was replaced by a VSV-G epitope leaving only the stalk region, the transmembrane, and the cytoplasmic domains (see Fig.7 A). When this dCrumbs-VSV-G was expressed in HeLa cells, it was transported to the plasma membrane (not shown) and thus could be used to study potential interactions with hINADl. dCrumbs-VSV-G was immunoprecipitated from two independent stable clones using the P5D4 antibody against the VSV-G epitope. Immunoprecipitates were then probed for the presence of hINADl, while untransfected HeLa cells were used as a control (Fig. 7 B). hINADl co-immunoprecipitated specifically with dCrumbs-VSV-G, indicating that it could interact like Dlt does with Crumbs inDrosophila (2Bhat M.A. Izaddoost S., Lu, Y. Cho K.O. Choi K.W. Bellen H.J. Cell. 1999; 96: 833-845Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 14Klebes A. Knust E. Curr. Biol. 2000; 10: 76-85Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar). Because the interaction between dCrumbs and Dlt involves the last amino acids of dCrumbs cytoplasmic tail, we also expressed a truncated mutant of dCrumbs-VSV-G (Fig.7 A). This 8F105 mutant lacks the last 23 residues and acts as a null allele in Drosophila (30Wodarz A. Grawe F. Knust E. Mech. Dev. 1993; 44: 175-187Crossref PubMed Scopus (79) Google Scholar). As expected, dCrumbs-VSV-G 8F105 could not precipitate hINADl, confirming that the interaction between the two proteins involves the distal part of the dCrumbs cytoplasmic domain. The full-length Myc-tagged hINADl was also co-expressed as a control and was precipitated with anti-VSV-G antibodies, confirming that it is hINADl indeed that interacts with dCrumbs and not a protein recognized by cross-reacting antibodies (Fig.7 B). As yet no human Crumbs expressed in epithelial cells has been discovered, so we searched human Expressed Sequence Tag (EST) databases with the cytoplasmic tail of Drosophila Crumbs and found three different human Crumbs (Fig.8 A). One was CRB1 (18den Hollander A.I. ten Brink J.B. de Kok Y.J. van Soest S. van den Born L.I. van Driel M.A. van de Pol D.J. Payne A.M. Bhattacharya S.S. Kellner U. Hoyng C.B. Westerveld A. Brunner H.G. Bleeker- Wagemakers E.M. Deutman A.F. Heckenlively J.R. Cremers F.P. Bergen A.A. Nat. Genet. 1999; 23: 217-221Crossref PubMed Scopus (384) Google Scholar), whereas the other two are new gene products and were named, respectively, CRB2 and CRB3. They all share the conserved motif around tyrosine 10 (starting from the membrane) and the four last amino acids, ERLI, essential for dCrumbs function in Drosophila (14Klebes A. Knust E. Curr. Biol. 2000; 10: 76-85Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar). Using specific primers for each human Crumbs, we performed RT-PCR with total RNA from Caco-2 cells (Fig. 8 B) and found that CRB3 was expressed in these cells and could be the endogenous partner of hINADl in colon epithelial cells. We therefore expressed a chimera containing the epitope VSV-G as an extracellular domain, the transmembrane domain of dCrumbs, and CRB3 cytoplasmic domain. This construct was able to co-immunoprecipitate Myc-hINADl when co-expressed in COS-7 cells although a construct deleted of the last four amino acids, ERLI, did not (Fig. 8 C). Thus CRB3 can interact with hINADl in cellulo. To better define the domain of hINADl that interacts with CRB3 we next co-expressed two constructs of Myc-hINADl deleted either of the first N-terminal 125 amino acids (ΔN-ter) or the PDZ2 domain (ΔPDZ2). To our surprise VSV-G-CRB3 was still able to interact with ΔPDZ2 but not with ΔN-ter, demonstrating that the interaction between hINADl and CRB3 was not mediated by an hINADl PDZ domain as was suggested for dCrumbs and Dlt (2Bhat M.A. Izaddoost S., Lu, Y. Cho K.O. Choi K.W. Bellen H.J. Cell. 1999; 96: 833-845Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar). hINADl was cloned by homo
Referência(s)