The 3′-Untranslated Region of Murine Cyclooxygenase-2 Contains Multiple Regulatory Elements That Alter Message Stability and Translational Efficiency
2001; Elsevier BV; Volume: 276; Issue: 25 Linguagem: Inglês
10.1074/jbc.m008461200
ISSN1083-351X
AutoresSteven J. Cok, Aubrey R. Morrison,
Tópico(s)Pharmacogenetics and Drug Metabolism
ResumoRenal mesangial cells regulate their expression of the pro-inflammatory gene cyclooxygenase-2 (COX-2) through mechanisms involving gene transcription and post-transcriptional events. Post-transcriptional regulation of COX-2 is dependent, in part, on sequences within the 3′-untranslated region (3′-UTR) of the COX-2 mRNA. Insertion of the entire 3′-UTR of COX-2 into the 3′-UTR of luciferase resulted in a 70% decrease in luciferase enzymatic activity. Measurement of steady-state reporter gene mRNA levels suggested that the loss of activity was due to decreased translational efficiency. Deletion analysis identified the first 60 nucleotides of the 3′-UTR of COX-2 as a major translational control element. This region of the 3′-UTR of COX-2 is highly conserved across species; is AU-rich; and contains multiple repeats of the regulatory sequence AUUUA, reported to confer post-transcriptional control. In addition, we identified regions of the 3′-UTR of COX-2 outside of the first 60 nucleotides that altered message stability. Some of these regions contained AUUUA consensus sequences, whereas others did not, and represent novel control elements. These results suggest that expression of COX-2 in mesangial cells depends on the complex integration of multiple signals derived from the 3′-UTR of the message. Renal mesangial cells regulate their expression of the pro-inflammatory gene cyclooxygenase-2 (COX-2) through mechanisms involving gene transcription and post-transcriptional events. Post-transcriptional regulation of COX-2 is dependent, in part, on sequences within the 3′-untranslated region (3′-UTR) of the COX-2 mRNA. Insertion of the entire 3′-UTR of COX-2 into the 3′-UTR of luciferase resulted in a 70% decrease in luciferase enzymatic activity. Measurement of steady-state reporter gene mRNA levels suggested that the loss of activity was due to decreased translational efficiency. Deletion analysis identified the first 60 nucleotides of the 3′-UTR of COX-2 as a major translational control element. This region of the 3′-UTR of COX-2 is highly conserved across species; is AU-rich; and contains multiple repeats of the regulatory sequence AUUUA, reported to confer post-transcriptional control. In addition, we identified regions of the 3′-UTR of COX-2 outside of the first 60 nucleotides that altered message stability. Some of these regions contained AUUUA consensus sequences, whereas others did not, and represent novel control elements. These results suggest that expression of COX-2 in mesangial cells depends on the complex integration of multiple signals derived from the 3′-UTR of the message. The 3′-untranslated region of murine cyclooxygenase-2 contains multiple regulatory elements that alter message stability and translational efficiency.Journal of Biological ChemistryVol. 276Issue 43PreviewPage 23184: Fig. 7should have been printed in color. The color figure is shown below. Full-Text PDF Open Access cyclooxygenase-2 mitogen-activated protein kinase extracellular signal-regulated kinase c-Jun N-terminal kinase 3′-untranslated region interleukin adenosine- and uridine-rich element polymerase chain reaction glyceraldehyde-3-phosphate dehydrogenase Cyclooxygenase-2 (COX-2)1 catalyzes the conversion of arachidonate to prostaglandin H, the rate-limiting step in prostaglandin biosynthesis. COX-2 was identified as an immediate-early response gene whose synthesis is rapidly increased in response to various cytokines and mitogenic factors (1Fletcher B.S. Kujubu D.A. Perrin D.M. Herschman H.R. J. Biol. Chem. 1992; 267: 4338-4344Abstract Full Text PDF PubMed Google Scholar, 2Kujubu D.A. Fletcher B.S. Varnum B.C. Lim R.W. Herschman H.R. J. Biol. Chem. 1991; 266: 12866-12872Abstract Full Text PDF PubMed Google Scholar, 3Herschman H.R. Xie W. Reddy S. Bioessays. 1995; 17: 1031-1037Crossref PubMed Scopus (82) Google Scholar). Transcription of COX-2 can be activated by a variety of extracellular ligands (4Dean J.L.E. Brook M. Clark A.R. Saklatvala J. J. Biol. Chem. 1999; 274: 264-269Abstract Full Text Full Text PDF PubMed Scopus (462) Google Scholar, 5Wadleigh D.J. Reddy S.T. Kopp E. Ghosh S. Herschman H.R. J. Biol. Chem. 2000; 275: 6259-6266Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar, 6Sirois J. Simmons D.L. Richards J.S. J. Biol. Chem. 1992; 267: 11586-11592Abstract Full Text PDF PubMed Google Scholar, 7Sirois J. Richards J.S. J. Biol. Chem. 1993; 268: 21931-21938Abstract Full Text PDF PubMed Google Scholar, 8Morris J.K. Richards J.S. J. Biol. Chem. 1996; 271: 16633-16643Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 9Xie W. Herschman H.R. J. Biol. Chem. 1996; 271: 31742-31748Abstract Full Text Full Text PDF PubMed Scopus (222) Google Scholar, 10Meade E.A. McIntyre T.M. Zimmerman G.A. Prescott S.M. J. Biol. Chem. 1999; 274: 8328-8334Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar, 11Diaz A. Chepenik K.P. Korn J.H. Reginato A.M. Jimenez S.A. Exp. Cell Res. 1998; 241: 222-229Crossref PubMed Scopus (137) Google Scholar, 12Ristimaki A. Garfinkel S. Wessendorf J. Maciag T. Hla T. J. Biol. Chem. 1994; 269: 11769-11775Abstract Full Text PDF PubMed Google Scholar). Signal transduction occurs through many different signaling pathways, most of which require activation of protein kinase cascades. Studies using pharmacological inhibitors of MAPKs or their upstream protein kinase activators and dominant-negative mutant forms of protein kinases demonstrated the role of ERK, JNK, and p38 MAPK in transcriptional activation of COX-2 (5Wadleigh D.J. Reddy S.T. Kopp E. Ghosh S. Herschman H.R. J. Biol. Chem. 2000; 275: 6259-6266Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar, 9Xie W. Herschman H.R. J. Biol. Chem. 1996; 271: 31742-31748Abstract Full Text Full Text PDF PubMed Scopus (222) Google Scholar, 13Reddy S.T. Wadleigh D.J. Herschman H.R. J. Biol. Chem. 2000; 275: 3107-3113Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 14Subbaramaiah K. Chung W.J. Dannenberg A.J. J. Biol. Chem. 1998; 273: 32943-32949Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar, 15Yang T. Huang Y. Heasley L.E. Berl T. Schnermann J.B. Briggs J.P. J. Biol. Chem. 2000; 275: 23281-23286Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 16Guan Z. Baier L.D. Morrison A.R. J. Biol. Chem. 1997; 272: 8083-8089Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 17Guan Z. Buckman S.Y. Pentland A.P. Templeton D.J. Morrison A.R. J. Biol. Chem. 1998; 273: 12901-12908Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 18Guan Z. Buckman S.Y. Miller B.W. Springer L.D. Morrison A.R. J. Biol. Chem. 1998; 273: 28670-28676Abstract Full Text Full Text PDF PubMed Scopus (226) Google Scholar). Recently, it has been reported that MAPK signaling pathways are involved in regulating gene expression at the post-transcriptional level (19Chen C.Y. Gatto-Konczak F. Wu Z. Karin M. Science. 1998; 280: 1945-1949Crossref PubMed Scopus (329) Google Scholar, 20Ming X.F. Kaiser M. Moroni C. EMBO J. 1998; 17: 6039-6048Crossref PubMed Scopus (137) Google Scholar, 21Holtmann H. Winzen R. Holland P. Eickemeier S. Hoffmann E. Wallach D. Malinin N.L. Cooper J.A. Resch K. Kracht M. Mol. Cell. Biol. 1999; 19: 6742-6753Crossref PubMed Scopus (269) Google Scholar, 22Winzen R. Kracht M. Ritter B. Wilhelm A. Chen C.Y. Shyu A.B. Muller M. Gaestel M. Resch K. Holtmann H. EMBO J. 1999; 18: 4969-4980Crossref PubMed Scopus (711) Google Scholar, 23Lee N.H. Malek R.L. J. Biol. Chem. 1998; 273: 22317-22325Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 24Pages G. Berra E. Milanini J. Levy A.P. Pouyssegur J. J. Biol. Chem. 2000; 275: 26484-26491Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar). In the majority of these investigations, activation of one or more MAPKs resulted in stabilization of the target mRNA, which was dependent on regulatory elements contained within the 3′-UTR of the message. Post-transcriptional regulation is not limited to changes in message stability. Sequences within the 3′-UTR of mRNAs have also been shown to be important for enhancing message translation as well as for translational silencing (25Izquierdo J.M. Cuezva J.M. Mol. Cell. Biol. 1997; 17: 5255-5268Crossref PubMed Google Scholar, 26Piecyk M. Wax S. Beck A.R.P. Kedersha N. Gupta M. Maritim B. Chen S. Gueydan C. Kruys V. Streuli M. Anderson P. EMBO J. 2000; 19: 4154-4163Crossref PubMed Scopus (422) Google Scholar, 27Kruys V. Wathelet M. Poupart P. Contreras R. Fiers W. Content J. Huez G. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 6030-6044Crossref PubMed Scopus (136) Google Scholar, 28Kruys V. Marinx O. Shaw G. Deschamps J. Huez G. Science. 1989; 245: 852-855Crossref PubMed Scopus (269) Google Scholar, 29Kruys V. Huez G. Biochimie ( Paris ). 1994; 76: 862-866Crossref PubMed Scopus (46) Google Scholar, 30Gueydan C. Droogmans L. Chalon P. Huez G. Caput D. Kruys V. J. Biol. Chem. 1999; 274: 2322-2326Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 31Mbella E.G. Bertrand S. Huez G. Octave J.N. Mol. Cell. Biol. 2000; 20: 4572-4579Crossref PubMed Scopus (26) Google Scholar, 32Ostareck D.H. Ostareck-Lederer A. Wilm M. Thiele B.J. Mann M. Hentze M.W. Cell. 1997; 89: 597-606Abstract Full Text Full Text PDF PubMed Scopus (430) Google Scholar, 33Standart N. Jackson R.J. Biochimie ( Paris ). 1994; 76: 867-879Crossref PubMed Scopus (103) Google Scholar). In renal mesangial cells, the induction of COX-2 is important for modulation of glomerular inflammation. COX-2 is rapidly induced in response to IL-1β and phorbol 12-myristate 13-acetate (16Guan Z. Baier L.D. Morrison A.R. J. Biol. Chem. 1997; 272: 8083-8089Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 17Guan Z. Buckman S.Y. Pentland A.P. Templeton D.J. Morrison A.R. J. Biol. Chem. 1998; 273: 12901-12908Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 18Guan Z. Buckman S.Y. Miller B.W. Springer L.D. Morrison A.R. J. Biol. Chem. 1998; 273: 28670-28676Abstract Full Text Full Text PDF PubMed Scopus (226) Google Scholar, 34Srivastava S.K. Tetsuka T. Daphna-Iken D. Morrison A.R. Am. J. Physiol. 1994; 267: F504-F508PubMed Google Scholar). The cellular mechanism of IL-1β signaling in renal mesangial cells, although not yet fully defined, includes activation of both JNK and p38 MAPK signaling pathways (18Guan Z. Buckman S.Y. Miller B.W. Springer L.D. Morrison A.R. J. Biol. Chem. 1998; 273: 28670-28676Abstract Full Text Full Text PDF PubMed Scopus (226) Google Scholar). Blocking either of these pathways attenuates the IL-1β-induced expression of COX-2 protein and reduces COX-2 mRNA levels. It is believed that increased COX-2 expression is due to regulation of both transcriptional and post-transcriptional events. We have previously shown that IL-1β increases the half-life of COX-2 mRNA and is associated with the induction of RNA-binding proteins that interact with sequences in the 3′-UTR of COX-2 (34Srivastava S.K. Tetsuka T. Daphna-Iken D. Morrison A.R. Am. J. Physiol. 1994; 267: F504-F508PubMed Google Scholar). These binding proteins interact with the first 150 nucleotides of the 3′-UTR, which contains highly conserved adenosine- and uridine-rich elements (AREs). The results support a critical role for the AREs of COX-2 in IL-1β-dependent gene expression in mesangial cells. Thus, it appears that a common mechanism for control of gene expression by MAPK signaling pathways is through post-transcriptional gene regulation, which requires the 3′-UTR of the target gene. Other investigators have shown the importance of AREs in COX-2 gene expression (35Gou Q. Liu C.H. Ben Av P. Hla T. Biochem. Biophys. Res. Commun. 1998; 242: 508-512Crossref PubMed Scopus (70) Google Scholar, 36Lasa M. Mahtani K.R. Finch A. Brewer G. Saklatvala J. Clark A.R. Mol. Cell. Biol. 2000; 20: 4265-4274Crossref PubMed Scopus (370) Google Scholar, 37Dixon D.A. Kaplan C.D. McIntyre T.M. Zimmerman G.A. Prescott S.M. J. Biol. Chem. 2000; 275: 11750-11757Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar, 38Xu K. Robida A.M. Murphy T.J. J. Biol. Chem. 2000; 275: 23012-23019Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 39Sheng H. Shao J. Dixon D.A. Williams C.S. Prescott S.M. DuBois R.N. Beauchamp R.D. J. Biol. Chem. 2000; 275: 6628-6635Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar). The majority of the AREs of COX-2 reside within the first 100 nucleotides of the 3′-UTR. This region of the 3′-UTR was shown to regulate message stability and translational efficiency of hybrid reporter genes. The entire 3′-UTR of COX-2 encompasses >2000 bases, and it seems likely that regions of the 3′-UTR outside of the AREs may also play a role in regulating COX-2 expression. To determine whether additional regions of the 3′-UTR of COX-2 regulate gene expression in mesangial cells, we constructed a series of reporter gene expression vectors containing various regions of the 3′-UTR of COX-2. Based on the results of reporter gene expression, we determined that the 3′-UTR of COX-2 contains multiple control elements that regulate message stability and message translation, many of which represent novel control elements that lie outside of the first 100 nucleotides of the 3′-UTR. Thus, the level of expression for COX-2 in renal mesangial cells is determined in part by integration of multiple signals regulating post-transcriptional events that are dependent on sequences that reside in the 3′-UTR of the message. Unless indicated, all reagents used for biochemical methods were purchased from Sigma, VWR, or Fisher. Restriction enzymes were obtained from New England Biolabs Inc. (Beverly, MA) and Promega (Madison, WI). The plasmid pGL3-control, which encodes firefly luciferase, was purchased from Promega. Cell culture medium and fetal bovine serum were from Life Technologies, Inc. Human recombinant IL-1β and DNase I were purchased from Roche Molecular Biochemicals. The wheat germ in vitro translation kit was from Ambion Inc. (Austin, TX). Rat primary mesangial cell cultures were prepared from male Harlan Sprague-Dawley rats as previously described (40Guan Z. Tetsuka T. Baier L.D. Morrison A.R. Am. J. Physiol. 1996; 270: F634-F641PubMed Google Scholar). Cells were grown in RPMI 1640 medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 0.6% (v/v) insulin, 100 units/ml penicillin, 100 μg/ml streptomycin, 250 μg/ml amphotericin B, and 15 mm HEPES. Where indicated, mesangial cells were stimulated with IL-1β (100 units/ml). All experiments were performed with confluent cells and used at passages 3–6. Mouse immortalized mesangial cells were purchased from American Type Culture Collection (ATCC CRL-1927). Cells were grown in a 3:1 mixture of Dulbecco's modified Eagle's medium and Ham's F-12 medium supplemented with 15 mm HEPES, 5% (v/v) heat-inactivated fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. Transient transfections were performed using cells at 70–80% confluency. Bluescript SK−containing DNA that encodes the 3′-UTR of murine COX-2 was generated as previously described (34Srivastava S.K. Tetsuka T. Daphna-Iken D. Morrison A.R. Am. J. Physiol. 1994; 267: F504-F508PubMed Google Scholar). Various regions of the DNA were amplified by PCR using primers terminating in an XbaI recognition sequence. PCR products were ligated into the TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and subsequently excised withXbaI. DNA fragments were purified by agarose gel electrophoresis and extracted using a Geneclean III kit (BIO 101, Inc., Vista, CA). DNA inserts were ligated into the unique XbaI site of the pGL3-control vector, located in the 3′-UTR of the firefly luciferase gene. Mesangial cells were transiently transfected using SuperFect transfection reagent (QIAGEN Inc., Valencia, CA). Cells were plated in six-well cluster plates at a density of 2 × 105 cells/well and incubated overnight. Mixtures of 2.5 μg of reporter gene plasmid DNA in 75 μl of serum-free medium and 15 μl of SuperFect reagent were incubated for 5–10 min at room temperature, followed by dilution to 0.5 ml with complete medium. The DNA·SuperFect complex was layered onto mesangial cells (2.5 μg of DNA/well); after a 2–3-h incubation, the medium was changed, and cells were incubated overnight for gene expression. Luciferase activity was determined using a luciferase assay system (Promega) following the manufacturer's protocol. Briefly, cell monolayers in six-well clusters were removed by scraping into 100 μl of reporter lysis buffer. Cells were lysed by freeze-thawing, and cellular debris was removed by centrifugation for 30 s at 12,000 × g. Luciferase activity was measured using a Lumat LB 9507 luminometer (EG&G Wallac, Gaithersburg, MD). Assays were performed by injecting 100 μl of luciferase assay reagent into 20 μl of supernatant diluted 1:10. Light output was measured over a 10-s time period. Activity is expressed as relative light units and was normalized to cell protein. In some instances, cells were cotransfected with a Renilla luciferase reporter gene (pRL-TK, Promega), and firefly luciferase activity was normalized to Renilla luciferase activity (data not shown). Results were equivalent to those obtained by normalization to protein content, and only data normalized to protein levels are reported. Total RNA was isolated from cells by a modified single-step acid/guanidine thiocyanate/phenol/chloroform method using RNA STAT-60 reagent (Tel-Test, Inc., Friendswood, TX). Total RNA was treated with DNase I (10 units, 37 °C, 30 min), followed by re-isolation of RNA with RNA STAT-60 reagent. DNase I treatment was repeated twice to eliminate amplification of reporter plasmid DNA and genomic DNA. RNA (0.5 μg) was reverse-transcribed with avian myeloblastosis virus reverse transcriptase (Promega) using random hexamer primers. After first-strand synthesis, the cDNA was quantified by TaqMan real-time PCR using gene-specific primers and the double-stranded DNA-binding dye SYBR green I. Fluorescence was detected with an ABI Prism 7700 sequence detection system (PE Biosystems, Foster City, CA). Luciferase amplification primers were GCCTGAAGTCTCTGATTAAGT for the forward primer and ACACCTGCGTCGAAGATGT for the reverse primer. Amplification primers for glyceraldehyde-3-phosphate (GAPDH) were TGGCAAAGTGGAGATTGTTGCC for the forward primer and AAGATGGTGATGGGCTTCCCG for the reverse primer. The amplicon was designed to be <150 base pairs and to have a melting temperature of 78–84 °C. Primer pairs were tested to ensure a robust amplification signal of the expected size with no additional bands. Melting curves were generated to determine the temperature that maximized fluorescence from SYBR green I binding to the amplicon and that minimized fluorescence due to primer dimers. The amount of luciferase message in each RNA sample was quantified and normalized to GAPDH content. Relative amounts of luciferase cDNA were calculated by the comparative CTmethod (49PE Biosystems, PE Biosystems User Bulletin 2, 1997, Foster City, CA.Google Scholar) and are expressed as a percentage of luciferase cDNA measured in cells transfected with pGL3-control. Mesangial cells were transiently transfected and incubated for 24 h for luciferase gene expression. Transcription was inhibited at this point by adding actinomycin D (10 μg/ml) to the cell culture medium. Total RNA was isolated at various times after actinomycin D addition, and luciferase mRNA content was determined by quantitative reverse transcriptase-PCR as described above. Luciferase mRNA levels were normalized to GAPDH mRNA content and are expressed as a percentage of the mRNA level at the 0-h time point. Total RNA was translated in vitro using the wheat germ translation kit according to the manufacturer's protocol. Translation reactions contained 24 μl of wheat germ extract, 1.2 μl each of Master Mix−Leu and Master Mix−Met (a mixture of all the amino acids except the one indicated), 100 mm potassium acetate, and 4–8 μg of total RNA in total volume of 50 μl. Reactions were incubated for 60 min at 30 °C and stopped by placing tubes on ice. Duplicate samples containing 20 μl of the translation reaction were assayed for luciferase activity using the luciferase assay described above. The amount of translated protein is expressed as luciferase activity normalized to total RNA content. All experiments were performed at least three times, each in duplicate. Data are expressed as the means ± S.E. Comparison of means was performed using Student'st test. To determine the effect of the 3′-UTR of COX-2 on gene expression, reporter gene constructs were created by inserting DNA encoding various regions of the 3′-UTR of murine COX-2 message into the 3′-UTR of the luciferase gene (Fig.1). Each construct contained the luciferase coding sequence under the control of the SV40 promoter and enhancer elements, followed by the 3′-UTR of luciferase and the SV40 late poly(A) signal. The reporter constructs differed only in the regions of the 3′-UTR of COX-2 that were inserted into the luciferase 3′-UTR. Regions of the 3′-UTR of COX-2 included the full-length 3′-UTR (nucleotides 1–2232), serial deletions from the distal and proximal ends of the 3′-UTR, and two internal regions of the 3′-UTR. Since all reporter constructs contained identical promoter elements, differences in luciferase activity reflect differences in regulation as a result of post-transcriptional events. We used a mouse immortalized mesangial cell line as a model system to study regulation of COX-2 in renal mesangial cells. Reporter gene constructs were transiently transfected into this cell line, incubated overnight, and assayed for luciferase activity. Luciferase activity measured in cells transfected with the pGL3-control vector lacking 3′-UTR sequences of COX-2 was designated as 100%. Inserting the entire 3′-UTR (nucleotides 1–2232) of COX-2 into the 3′-UTR of luciferase resulted in a 70% decrease in luciferase activity (Fig.2), suggesting the presence of negative regulatory element(s) within the 3′-UTR of the COX-2 message. Compared with the full-length 3′-UTR, truncation of the distal region of the 3′-UTR of COX-2 to nucleotide 1558 or 1384 had no additional effect on luciferase activity (Fig. 2 A). Removal of nucleotides 792 to 1384 caused a significant increase in luciferase activity (p < 0.05) to 66% of the control. This increase suggests the presence of a negative element between nucleotides 792 and 1384. In support of this conclusion, insertion of only nucleotides 792–1384 alone lowered luciferase activity to 24% of the control (Fig. 2 B). Further truncation from nucleotide 792 to 373 resulted in a significant decrease in luciferase activity (p < 0.001) to a level of activity that was 12% of the control (Fig. 2 A). This result suggested the presence of a positive element between nucleotides 792 and 373. Surprisingly, inclusion of nucleotides 373–792 not only failed to increase luciferase activity, but rather decreased luciferase activity (Fig.2 B). Thus, this region appears to modulate regulation of gene expression in a positive manner through interaction with the first 373 nucleotides of the 3′-UTR, but cannot increase gene expression by itself. Inclusion of only the first 60 nucleotides of the 3′-UTR of COX-2 decreased reporter gene activity to 10% of the control (Fig.2 A). This region of the 3′-UTR contains 7 of the 12 AUUUA consensus sequences, suggesting that the AREs in the 3′-UTR of COX-2 negatively regulate gene expression. Truncation from the proximal region of the 3′-UTR of COX-2 revealed the presence of an additional negative element. Removal of the first 60 nucleotides resulted in an increase in luciferase activity to 70% of the control. This region contains seven AUUUA consensus sequences, suggesting that they account for the decreased luciferase activity measured with the construct containing the full-length 3′UTR. However, truncation to nucleotide 373 or 792 reduced luciferase activity to a level equivalent to that of the full-length 3′-UTR, and inclusion of only the terminal 674 nucleotides of the 3′-UTR of COX-2 (nucleotides 1558–2232) caused a significant decrease in luciferase activity to nearly 5% of the control (Fig. 2 B). These results indicate that additional negative elements are present within the 3′-UTR that are affected by the “context” in which they are presented. The terminal region contains three AUUUA consensus sequences, further supporting a negative role for AREs in the 3′-UTR of COX-2. Measurement of luciferase activity was used to quantitate the amount of reporter enzyme synthesized by transfected cells. Changes in luciferase activity could be due to either alterations in message stability or rates of mRNA translation. To distinguish between these two possibilities, we measured the steady-state levels of luciferase mRNA using reverse transcriptase, followed by real-time PCR analysis. In this technique, the PCR product was measured as it accumulated, allowing for accurate quantitation of mRNA levels without the ambiguities associated with traditional reverse transcriptase-PCR. Luciferase mRNA levels in cells transfected with reporter gene constructs were normalized to GAPDH mRNA levels and are expressed as a percentage of luciferase mRNA measured in cells transfected with the pGL3-control vector (Fig. 3). If loss of luciferase activity were due to decreased message stability, then we would observe comparable changes in message levels. If decreased luciferase were due to inhibition of translation, then we would expect to measure no change or a disproportionate change in luciferase mRNA levels. Comparison of the results from luciferase activity measurements (Fig.2) and quantitation of luciferase mRNA levels (Fig. 3) indicated that decreased luciferase expression occurred through multiple mechanisms. Insertion of the entire 3′-UTR of COX-2 into the 3′-UTR of luciferase had no effect on steady-state mRNA levels (Fig.3 A, 1–2232 versus pGL3c). Likewise, luciferase message levels using the reporter construct containing nucleotides 1–792 were not significantly different compared with the control. Thus, the decreased luciferase activity measured using these reporter constructs was presumed to reflect a decreased rate of message translation. In contrast, inclusion of nucleotides 1–60, 373–792, 792–1384, or 1558–2232 caused a significant and dramatic drop in luciferase mRNA levels compared with the luciferase gene alone (pGL3-control) and compared with the construct containing the entire 3′-UTR of COX-2 (nucleotides 1–2232). In most cases, the magnitude of the decrease in luciferase mRNA levels was nearly equal to the corresponding decrease in luciferase activity, suggesting that reporter gene expression with these constructs is strongly dependent on message stability. Truncation of the 3′-UTR to nucleotide 60 lowered luciferase mRNA levels to 30% of the control (Fig. 3 A), whereas luciferase activity decreased further to 10% of the control (Fig.2 A), suggesting both altered message stability and translational regulation. To confirm that changes in steady-state luciferase mRNA levels reflect altered message stability, we directly measured message degradation in cells transfected with three different constructs (Fig.4). Mesangial cells were transiently transfected, incubated for 24 h, and treated with actinomycin D to stop transcription. Luciferase mRNA was measured at various times after inhibition of transcription. Luciferase message without any COX-2 sequences was very stable and exhibited little or no decay over the 10-h treatment period. Adding the full-length 3′-UTR of COX-2 (nucleotides 1–2232) to the luciferase message had no significant effect on its stability. In contrast, insertion of the proximal 60 nucleotides of the 3′-UTR of COX-2 into the 3′-UTR of luciferase mRNA caused a dramatic decrease in message stability. These findings are in complete agreement with steady-state mRNA measurements. The results presented above suggest that various regions of the 3′-UTR of COX-2 regulate gene expression by altering message stability and/or translational efficiency. Table I shows the ratio of luciferase mRNA levels and luciferase activity levels in cells expressing the various reporter constructs. This quotient reflects the relative contribution of translation and message stability to the regulation of reporter gene activity. A larger number indicates that a greater contribution of message translation occurred, and the closer the ratio is to 1, the greater the dependence of reporter gene expression was on message stability. Cells expressing reporter constructs containing regions 1–2232 and 1–60 had the highest ratio of mRNA levels to luciferase activity, indicating a strong effect on message translation. Reporter constructs containing regions 1–373, 60–2232, 792–2232, 1558–2232, 792–1384, and 373–792 of the 3′-UTR of COX-2 expressed luciferase mRNA at levels that corresponded to an equivalent change in luciferase activity. Accordingly, these constructs had ratios nearly equal to 1, suggesting that the loss of reporter expression is due to decreased message stability. Results from the other constructs generated ratios that fell in between these extremes, suggesting a mixed effect on both message stability and message translation.Table IComparison of message and enzymatic activity levels of chimeric reporter gene constructsRegion of 3′-UTRmRNA levelLuciferase levelRatio1–223285.233.62.531–155854.221.82.491–138476.636.72.091–79212666.01.921–37322.411.81.891–6029.89.63.1060–223265.471.30.92373–223253.623.82.25792–223244.136.91.201558–22325.815.561.04792–138416.123.60.68373–79215.912.31.30Results from Fig. 3 (mRNA l
Referência(s)