Phospholipase D Is Required in the Signaling Pathway Leading to p38 MAPK Activation in Neutrophil-like HL-60 Cells, Stimulated by N-Formyl-methionyl-leucyl-phenylalanine
2001; Elsevier BV; Volume: 276; Issue: 34 Linguagem: Inglês
10.1074/jbc.m101265200
ISSN1083-351X
AutoresShaliha Bechoua, Larry W. Daniel,
Tópico(s)S100 Proteins and Annexins
ResumoHuman acute myelogenous leukemia cells (HL-60 cells) can be induced to differentiate to neutrophils by exposure to dibutyryl-cyclic AMP. The differentiation of HL-60 cells allowed the mitogen-activated protein kinases p38 and p44/p42 to be rapidly and transiently activated upon stimulation withN-formyl-methionyl-leucyl-phenylalanine (fMLP). Western blot analysis using phosphospecific p38 and p44/p42 mitogen-activated protein kinase antibodies showed that increasing concentrations of ethanol or 1-butanol but not 2-butanol (0.05–0.5%) inhibited fMLP-induced p38 activation but did not inhibit p44/p42 activation. These data indicated that activation of phospholipase D (PLD) was required for activation of p38 but not p44/p42. We compared the effect of fMLP with those of tumor necrosis factor α (TNFα) and granulocyte-macrophage colony-stimulating factor (GM-CSF). We found that ethanol did not inhibit p38 phosphorylation upon stimulation with either GM-CSF or TNFα. These results suggested that in cells stimulated with fMLP, PLD was upstream of p38. To further test the involvement of PLD, we used antisense inhibition of human PLD1 expression. Treatment with antisense oligonucleotides inhibited p38 but not p44/p42 phosphorylation. These data supported a role for human PLD1 in fMLP-induced p38 activation in neutrophil-like HL-60 cells. In addition, the results obtained with TNFα and GM-CSF demonstrated that p38 activation occurred independently of PLD activation. Human acute myelogenous leukemia cells (HL-60 cells) can be induced to differentiate to neutrophils by exposure to dibutyryl-cyclic AMP. The differentiation of HL-60 cells allowed the mitogen-activated protein kinases p38 and p44/p42 to be rapidly and transiently activated upon stimulation withN-formyl-methionyl-leucyl-phenylalanine (fMLP). Western blot analysis using phosphospecific p38 and p44/p42 mitogen-activated protein kinase antibodies showed that increasing concentrations of ethanol or 1-butanol but not 2-butanol (0.05–0.5%) inhibited fMLP-induced p38 activation but did not inhibit p44/p42 activation. These data indicated that activation of phospholipase D (PLD) was required for activation of p38 but not p44/p42. We compared the effect of fMLP with those of tumor necrosis factor α (TNFα) and granulocyte-macrophage colony-stimulating factor (GM-CSF). We found that ethanol did not inhibit p38 phosphorylation upon stimulation with either GM-CSF or TNFα. These results suggested that in cells stimulated with fMLP, PLD was upstream of p38. To further test the involvement of PLD, we used antisense inhibition of human PLD1 expression. Treatment with antisense oligonucleotides inhibited p38 but not p44/p42 phosphorylation. These data supported a role for human PLD1 in fMLP-induced p38 activation in neutrophil-like HL-60 cells. In addition, the results obtained with TNFα and GM-CSF demonstrated that p38 activation occurred independently of PLD activation. granulocyte-macrophage colony-stimulating factor N 6,2′-O-dibutyryladenosine 3′:5′-cyclic monophosphate extracellular signal-regulated kinase N-formyl-methionyl-leucyl-phenylalanine human acute myelogenous leukemia cells mitogen-activated protein MAP kinase phosphatidylethanol phospholipase D human PLD tumor necrosis factor α c-Jun N-terminal kinase stess-activated protein kinase Human neutrophils constitute the first line of defense against invading microorganisms and are a major cellular component of acute inflammatory reactions (1Haslett C. Savill J.S. Meagher L. Curr. Opin. Immunol. 1989; 2: 10-18Crossref PubMed Scopus (117) Google Scholar). Neutrophils become rapidly activated (2Gomez-Cambronero J. Sha'afi R.I. Adv. Exp. Med. Biol. 1991; 314: 35-71Crossref PubMed Scopus (13) Google Scholar, 3Buhl A.M. Avdi N. Worthen G.S. Johnson G.L. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9190-9194Crossref PubMed Scopus (111) Google Scholar) through plasma membrane receptors that trigger responses to various compounds including proinflammatory cytokines granulocyte-macrophage colony stimulating factor (GM-CSF),1 tumor necrosis factor α (TNFα), and the chemotactic factorN-formyl-methionyl-leucyl-phenylalanine (fMLP). The fMLP receptor is a seven-transmembrane-spanning receptor that is linked to heterotrimeric GTP-binding proteins (4Gerard C. Gerard N.P. Curr. Opin. Immunol. 1994; 6: 140-145Crossref PubMed Scopus (115) Google Scholar). GM-CSF and TNFα are potent proinflammatory cytokines secreted by a variety of cells in response to infection and exert profound effects on the host immune system (5Abst J.J. Johnson R.B. J. Exp. Med. 1980; 151: 101-114Crossref PubMed Scopus (246) Google Scholar, 6Arai K.-I. Lee F. Miyajima A. Miyatake S. Arai N. Yokota T. Annu. Rev. Biochem. 1988; 59: 783-836Crossref Scopus (1168) Google Scholar, 7Guthrie L.A. McPhail L.C. Henson P.M. Johnston Jr., R.B. J. Exp. Med. 1984; 160: 1656-1671Crossref PubMed Scopus (457) Google Scholar). The exposure of neutrophils to GM-CSF and TNFα, whose effects are mediated through non-G-protein-coupled receptors, primes the cells for enhanced release of microbicidal metabolites in response to other signals (6Arai K.-I. Lee F. Miyajima A. Miyatake S. Arai N. Yokota T. Annu. Rev. Biochem. 1988; 59: 783-836Crossref Scopus (1168) Google Scholar, 8Rothstein J.L. Schreiber H. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 607-611Crossref PubMed Scopus (197) Google Scholar, 9Wright S.D. Ramos R.A. Tobias P.S. Ulevitch R.J. Mathison J.C. Science. 1990; 249: 1431-1433Crossref PubMed Scopus (3350) Google Scholar). One of the early intracellular events to occur during neutrophil activation is the rapid induction of protein phosphorylation, which plays an essential role in the regulation of many neutrophil functions (8Rothstein J.L. Schreiber H. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 607-611Crossref PubMed Scopus (197) Google Scholar, 9Wright S.D. Ramos R.A. Tobias P.S. Ulevitch R.J. Mathison J.C. Science. 1990; 249: 1431-1433Crossref PubMed Scopus (3350) Google Scholar, 10Darby C. Chien P. Rossman M.D. Schreiber A.D. Blood. 1990; 75: 2396-2400Crossref PubMed Google Scholar, 11Chao W. Olson M.S. Biochem. J. 1993; 292: 617-629Crossref PubMed Scopus (412) Google Scholar). Mitogen-activated protein kinases (MAPKs) have been demonstrated to play a central role in mediating intracellular signal transduction and regulating cellular functions in response to extracellular stimuli. The phosphorylation and activation of MAP kinases can be effected by both G-protein-coupled receptors and non-G-protein-coupled receptors (12Nahas N. Molski T.F.P. Fernandez G.A. Sha'afi R.I. Biochem. J. 1996; 318: 247-253Crossref PubMed Scopus (121) Google Scholar). The MAPKs are activated by diverse stimuli in the transduction of signals from the cell membrane to the nucleus. Three distinct MAP kinases have been identified to date in mammalian cells: p44/p42 ERKs are activated by growth factors (13Derijard B. Raingeaud J. Barrett T. Wu I-H Han J. Ulevitch R.J. Davis R.J. Science. 1995; 267: 682-685Crossref PubMed Scopus (1400) Google Scholar); JNK/SAPK is potently activated by irradiation and other environmental stresses such as hyperosmolarity (14Marais R. Wynne J. Treisman R. Cell. 1993; 73: 381-393Abstract Full Text PDF PubMed Scopus (1102) Google Scholar, 15Whitmarsh A.J. Shore P. Sharrocks A.D. Davis R.J. Science. 1995; 269: 403-407Crossref PubMed Scopus (873) Google Scholar); and p38 MAP kinase is activated by proinflammatory cytokines, osmotic stress, and UV irradiation (15Whitmarsh A.J. Shore P. Sharrocks A.D. Davis R.J. Science. 1995; 269: 403-407Crossref PubMed Scopus (873) Google Scholar). The p38 MAP kinase is associated with immune cell activation, because it is activated by a variety of inflammatory mediators (16Han J. Lee J.D. Bibbs L. Ulevitch R.J. Science. 1994; 265: 808-811Crossref PubMed Scopus (2390) Google Scholar, 17Raingeaud J. Gupta S. Rogers J.S. Dickens M. Han J. Ulevitch R.J. Davis R.J. J. Biol. Chem. 1995; 270: 7420-7426Abstract Full Text Full Text PDF PubMed Scopus (2029) Google Scholar). It is well established that p38 plays an important role in gene expression in monocytes and macrophages (18Lee J.C. Young P.R. J. Leukocyte Biol. 1996; 59: 152-157Crossref PubMed Scopus (372) Google Scholar, 19Han J. Jiang Y. Li Z. Kravchenko V.V. Ulevitch R.J. Nature. 1997; 386: 296-299Crossref PubMed Scopus (676) Google Scholar, 20Foey A.D. Parry S.L. Williams L.M. Feldmann M. Foxwell B.M. Brennan F.M. J. Immunol. 1998; 160: 920-928PubMed Google Scholar). A specific function for p38 in the neutrophil remains unclear, but it has been suggested to play an important role in the respiratory burst, interleukin-8 production, and apoptosis (21Schnyder B. Meunier P.C. Car B.D. Biochem. J. 1998; 331: 489-495Crossref PubMed Scopus (50) Google Scholar, 22Frasch S.C. Nick J.A. Fadok V.A. Bratton D.L. Worthen G.S. Henson P.M. J. Biol. Chem. 1998; 273: 8389-8397Abstract Full Text Full Text PDF PubMed Scopus (271) Google Scholar, 23Zu Y.L. Qi J. Gilchrist A. Fernandez G.A. Vasquez-Abad D. Kreutzer D.L. Huang C.K. Sha'afi R.I. J. Immunol. 1998; 160: 1982-1989PubMed Google Scholar, 24El Benna J. Han J. Park J.W. Schmid E. Ulevitch R.J. Babior B.M. Arch. Biochem. Biophys. 1996; 334: 395-400Crossref PubMed Scopus (208) Google Scholar). Activation of p38 follows phosphorylation of a distinctive TGY motif by the upstream kinase MEK3 or MEK6 (25Raingeaud J. Whitmarsh A.J. Barrett T. Derijard B. Davis R.J. Mol. Cell. Biol. 1996; 16: 1247-1255Crossref PubMed Scopus (1137) Google Scholar, 26Denhardt D.T. Biochem. J. 1996; 318: 729-747Crossref PubMed Scopus (449) Google Scholar, 27Han J. Lee J.D. Jiang Y. Li Z. Feng L. Ulevitch R.J. J. Biol. Chem. 1996; 271: 2886-2891Abstract Full Text Full Text PDF PubMed Scopus (482) Google Scholar). Activation of p38 leads to phosphorylation of specific transcription factors in vitro and in intact cells and thus may regulate gene expression (12Nahas N. Molski T.F.P. Fernandez G.A. Sha'afi R.I. Biochem. J. 1996; 318: 247-253Crossref PubMed Scopus (121) Google Scholar, 25Raingeaud J. Whitmarsh A.J. Barrett T. Derijard B. Davis R.J. Mol. Cell. Biol. 1996; 16: 1247-1255Crossref PubMed Scopus (1137) Google Scholar, 28Wang X.Z. Ron D. Science. 1996; 272: 1347-1349Crossref PubMed Scopus (733) Google Scholar). The activity of p38 MAP kinase is rapidly increased in neutrophils in response to extracellular stimuli, suggesting that this kinase cascade plays a pivotal role in regulating neutrophil function. Activation of p38 is involved in the signaling elicited by fMLP, TNFα, and GM-CSF (29Downey G.P. Butler J.R. Brumell J. Borregaard N. Kjeldsen L. Sue-A-Quan A.K. Grinstein S. J. Biol. Chem. 1996; 271: 21005-21011Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). Phospholipase D (PLD) is an important signal-transducing enzyme in a wide variety of cells and catalyzes the hydrolysis of phosphatidylcholine to produce the potential second messenger phosphatidic acid (reviewed in Refs. 30Singer W.D. Brown H.A. Sternweis P.C. Annu. Rev. Biochem. 1997; 66: 475-509Crossref PubMed Scopus (347) Google Scholar, 31Exton J.H. J. Biol. Chem. 1997; 272: 15579-15582Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar, 32Exton J.H. Physiol. Rev. 1997; 77: 303-320Crossref PubMed Scopus (385) Google Scholar, 33Exton J.H. Biochim. Biophys. Acta. 1999; 1439: 121-133Crossref PubMed Scopus (334) Google Scholar). In the presence of primary alcohols, PLD catalyzes a transphosphatidylation reaction producing phosphatidylalcohols at the expense of phosphatidic acid; this feature provides a tool to implicate PLD in cellular responses. The activation of human neutrophils by fMLP stimulates PLD (34Fensome A. Whatmore J. Morgan C. Jones D. Cockcroft S. J. Biol. Chem. 1998; 273: 13157-13164Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Upon the addition ofN 6,2′-O-dibutyryladenosine 3′:5′-cyclic monophosphate (dbcAMP), human acute myelogenous leukemia cells (HL-60 cells) differentiate into cells that display functions similar to neutrophils and have been used to study the regulatory mechanisms of differentiation and functions of neutrophils (35Collins S.J. Blood. 1987; 70: 1233-1244Crossref PubMed Google Scholar). HL-60 cells express PLD1, but little (36Colley W.C. Altshuller Y.M. Sue-Ling C.K. Copeland N.G. Gilbert D.J. Jenkins N.A. Branch K.D. Tsirka S.E. Bollag R.J. Bollag M.A. Frohman M.A. Biochem. J. 1997; 326: 745-753Crossref PubMed Scopus (115) Google Scholar) or no PLD2 (37Saqib K.M. Wakelam M.J.O. Biochem. Soc. Trans. 1997; 25: S586Crossref PubMed Scopus (9) Google Scholar). The regulation of expression of PLD has also been examined in HL-60 cells, which is used as a model for studies of PLD1 regulation (38Martin A. Saqib K.M. Hodgkin M.N. Brown F.D. Pettit T.R. Armstrong S. Wakelam M.J. Biochem. Soc. Trans. 1997; 25: 1157-1160Crossref PubMed Scopus (16) Google Scholar). Moreover, Ohguchi et al. (39Ohguchi K. Nakashima S. Tan Z. Banno Y. Dohi S. Nozawa Y. J. Biol. Chem. 1997; 272: 1990-1996Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar) found that the hPLD1 mRNA level is up-regulated during HL-60 cell differentiation. Therefore, we used the HL-60 cell model to determine the potential role of PLD1 in the activation of the MAP kinases p38 and p44/p42. So far, studies have not demonstrated a relationship between PLD and p38 activation in neutrophils stimulated with chemotactic factors. Using differentiated HL-60 cells as a model for studying regulatory mechanisms and functions of neutrophils, we determined the effect of fMLP on the activation of p38 and p44/42 as well as the involvement of phospholipase D in the signaling pathway utilized by fMLP. We compared the fMLP effect, which is mediated through a seven-transmembrane G-coupled-receptor, with TNFα and GM-CSF, which, unlike fMLP, act through non-G-coupled receptors (6Arai K.-I. Lee F. Miyajima A. Miyatake S. Arai N. Yokota T. Annu. Rev. Biochem. 1988; 59: 783-836Crossref Scopus (1168) Google Scholar, 9Wright S.D. Ramos R.A. Tobias P.S. Ulevitch R.J. Mathison J.C. Science. 1990; 249: 1431-1433Crossref PubMed Scopus (3350) Google Scholar, 10Darby C. Chien P. Rossman M.D. Schreiber A.D. Blood. 1990; 75: 2396-2400Crossref PubMed Google Scholar). One method to investigate PLD involvement in the signaling pathway leading to p38 activation is through the use of antisense oligonucleotides designed to hybridize to complementary mRNA sequences and block production of proteins encoded by the targeted mRNA transcripts. In general, most studies target antisense oligonucleotides to the AUG translation initiation codon (40Zon G. Pharm. Res. (N. Y.). 1988; 5: 539-549Crossref PubMed Scopus (240) Google Scholar, 41Stein C.A. Cohen J.S. Cancer Res. 1988; 48: 2659-2668PubMed Google Scholar, 42Dolnick B.J. Biochem. Pharmacol. 1990; 40: 671-675Crossref PubMed Scopus (36) Google Scholar, 43Helene C. Toulme J.J. Biochim. Biophys. Acta. 1990; 1049: 99-125Crossref PubMed Scopus (844) Google Scholar), and this strategy has proven useful in designing the oligonucleotides targeted to PLD1 inhibition. 2A. J. Melendez, personal communication. 2A. J. Melendez, personal communication. These studies showed through the use of primary alcohols and antisense oligonucleotides that PLD was upstream of p38 in differentiated HL-60 cells stimulated with fMLP. However, the signaling pathways leading to the activation of p38 by the cytokines GM-CSF and TNFα did not require PLD. The results demonstrated that in HL-60 neutrophil-like cells, diverse agonists could activate p38 and that this response was mediated by PLD-dependent or PLD-independent mechanisms. HL-60 cells were purchased from the American Type Culture Collection (Manassas, VA). Fetal bovine serum, RPMI 1640 medium, and insulin-transferrin-selenium-X (100×) were obtained from Life Technologies, Inc. dbcAMP, formyl-Met-Leu-Phe, leupeptin, and pepstatin were from Sigma. TNFα was from PeproTech EC Ltd. (London, United Kingdom), and GM-CSF was from R&D Systems (Minneapolis, MN). Ethanol, 1-butanol, and 2-butanol were from Fisher. [5,6,8,9,11,12,14,15-3H]arachidonic acid was fromAmersham Pharmacia Biotech. Rabbit polyclonal antiphospho-p38 MAP kinase (Thr180/Tyr182) and the horseradish peroxidase-conjugated goat anti-rabbit antibodies were obtained from New England Biolabs, Inc. (Beverly, MA). phosphorylated ERK (p-ERK) (E-4) mouse monoclonal IgG2a antibody against a peptide corresponding to amino acids 196–209 of ERK1 of human origin phosphorylated on Tyr-204 (identical to corresponding ERK2 sequence) and the horseradish peroxidase-conjugated goat anti-mouse antibody were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Gel electrophoresis Kaleidoscope prestained standards were purchased from Bio-Rad. Enhanced chemiluminescence detection reagents were fromAmersham Pharmacia Biotech. Nitrocellulose membranes were obtained from Schleicher and Schuell. BCA protein assay reagents were obtained from Pierce. The human PLD1 antisense was initially synthesized and tested at the Institut de Recherche Jouveinal/Parke-Davis (Fresnes, France).2 The PLD1 antisense and randomized oligonucleotides were synthesized in the Wake Forest University School of Medicine DNA synthesis core laboratory as phosphorothioate derivatives the first two and last two deoxynucleotides and purified by high performance liquid chromatography. The sequences used were as follows: hPLD1 antisense (CCGTGGCTCGTTTTTCAGTGACAT) and hPLD1 Rd (CTTCTCGTGACGTTCGTTCTAGAG). The sequences were screened for their uniqueness using Blast 2.1.2 (NCBI). Silica gel 60 thin layer chromatography plates and Kodak X-Omat AR film were purchased from VWR (Suwannee, GA). Phosphatidylethanol was purchased from Avanti Polar Lipids, Inc. (Alabaster, AL). The HL-60 cell line was subcultured three times per week to a density of 0.5–1.0 × 106cells/ml. The cells were grown in RPMI 1640 medium supplemented with 10% heat-inactivated (56 °C, 30 min) fetal bovine serum, 100 units/ml penicillin, 100 µg/ml streptomycin, and 2 mml-glutamine in a humidified atmosphere containing 5% CO2 at 37 °C. For differentiation, HL-60 cells were centrifuged and suspended at 1.0 × 106 cells/ml in serum-free RPMI 1640 medium supplemented with insulin-transferrin-selenium (1×, final concentration); differentiation was initiated by the addition of 0.5 mmdbcAMP and allowed to proceed for 3 days. For differentiation markers, lysozyme and myeloperoxidase activities were measured (45O'Flaherty J.T. Kuroki M. Nixon A.B. Wijkander J. Yee E. Lee S.L. Smitherman P.K. Wykle R.L. Daniel L.W. J. Biol. Chem. 1996; 271: 17821-17828Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). Differentiated HL-60 cells were harvested, washed, and resuspended in RPMI 1640 insulin-transferrin-selenium at a density of 2.5 × 106 cells/ml. Cells were then incubated at 37 °C under gentle agitation for 1 h before adding the agonist. fMLP was diluted in RPMI 1640 prior to stimulation and was added to medium to a final concentration of 100 nm. TNFα prepared in Tris, pH 8.0, was added to medium to a final concentration of 25 ng/ml, and GM-CSF prepared in PBS was added to a final concentration of 200 pm. In the experiments studying the effect of ethanol, 1-butanol, and 2-butanol on the phosphorylation of the MAP kinases in response to stimulation with fMLP (100 nm; 2 min), GM-CSF (200 pm; 5 min), and TNFα (25 ng/ml; 5 min), varying concentrations of ethanol, 1-butanol, or 2-butanol (0.025–0.5%) were added just prior to the addition of the agonist. The reaction was stopped on ice, and the cell suspensions were centrifuged. The supernatants were removed, and the pellets were resuspended in 100 µl of lysis buffer consisting of 50 mmTris-HCl, pH 8.0, 100 mm NaCl, 2 mm EDTA, 0.1% SDS, 0.5% Nonidet P-40, 0.5% sodium deoxycholate, 0.5% Triton X-100, 20 mm β-glycerophosphate, 1 mmphenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, 10 µg/ml aprotinin, 1 mm Na3VO4, and 50 mm NaF. Cell lysates were then sonicated with 12 × 1-s bursts with a Branson probe-type sonicator (Branson Sonic Power Co., Danbury, CT) set at 20% of maximum energy. Insoluble material was removed by centrifugation at 16,000 × g for 10 min at 4 °C. Protein content was determined with the BCA protein assay (Pierce) using bovine serum albumin as a standard. The proteins were combined with equal volumes of 2× Laemmli sample buffer and boiled for 4 min. For both p44/42 and p38, 50 µg of proteins were resolved by SDS-polyacrylamide electrophoresis (4.5% stacking gel and 12% running gel) and electrotransferred to nitrocellulose membranes for 75 min. Prestained protein standards (Bio-Rad) were run in each gel. The blots were blocked overnight at 4 °C in Tris-buffered saline/Tween 20 (TBS-T containing 10 mm Tris-base, pH 7.4, 154 mmNaCl, and 0.1% Tween 20) supplemented with 3% Carnation nonfat milk. The membranes were then hybridized with phosphospecific antibodies (phospho-p44/42 and phospho-p38) or nonphosphospecific anti-p44/42 or anti-p38. After three washes of 5 min each with TBS-T (1×), blots were incubated with horseradish peroxidase-linked anti-IgG antibodies, washed again in the same conditions, and visualized with enhanced chemiluminescence reagents. The phosphorylated or nonphosphorylated MAP kinases were detected by autoradiography for variable lengths of time with Kodak X-Omat film. To confirm that the same amount of cellular proteins was loaded on each lane, the primary antibody-secondary antibody complex was removed by incubating the blot in stripping buffer (100 mm β-mercaptoethanol, 2% SDS, and 62.5 mm Tris/HCl, pH 6.8) for 30 min at 50 °C. After this procedure, the blots were washed with TBS-T (1×), blocked with buffer containing 3% Carnation nonfat milk, and reprobed with rabbit antibodies against p38 MAP kinase, followed by incubation with horseradish peroxidase-conjugated antibodies, as described above. Proteins were detected by the enhanced chemiluminescence reagents method as described by the manufacturer. HL-60 cells were treated with hPLD1 antisense oligonucleotides or hPLD1 randomized oligonucleotides in the presence of LipofectAMINE reagent (2 mg/ml). LipofectAMINE reagent was mixed with oligonucleotides (both prepared in Opti-MEM), and complexes were allowed to form at room temperature for 1 h. Meanwhile HL-60 cells in suspension in serum-free medium (RPMI 1640 supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin, and 2 mml-glutamine) were incubated at 37 °C in 5% CO2. After a 1-h incubation, the LipofectAMINE-oligonucleotide complexes were added with gentle agitation to HL-60 cells in suspension in 60-mm dishes. Control cells received no treatment or LipofectAMINE alone. The final concentration of oligonucleotides in the incubation mixture was between 0.5 and 50 µm. The treatment was allowed to proceed for 24 h. Following incubation, 4 ml of the complete growth medium (with serum) was added, and the cells were incubated for 24 h. HL-60 cells were then induced to differentiate, treated with fMLP, and lysed as described above. Treated HL-60 cells were induced to differentiate to a neutrophil-like phenotype with dbcAMP. After the addition of dbcAMP for 48 h, the cells were radiolabeled for 24 h with [5,6,8,9,11,12,14,15-3H]arachidonic acid; specific activity 215 Ci/mmol (1 µCi/100-mm dish). Radiolabeled differentiated HL-60 cells were washed once with RPMI 1640 and resuspended in serum-free RMPI 1640 at a density of 2.5 × 106cells/ml. Cells were incubated for 1 h at 37 °C under gentle agitation and then stimulated with 100 nm fMLP for 2 min at 37 °C in the presence of 1% ethanol (v/v). The reaction was stopped on ice, and the cell suspensions were centrifuged. Lipids were extracted according to the method of Bligh and Dyer (46Bligh D.G. Dyer W.J. Can. J. Biochem. Physiol. 1959; 123: 64-70Google Scholar) and separated on Silica Gel 60 TLC plates in a solvent system of the organic phase of ethyl acetate/isooctane/acetic acid/water (110:50:20:100 by volume). The plates were exposed to iodine vapor, and [3H]phosphatidylethanol (PEt) was identified by migration with PEt standard. Lipids were scraped, and radioactivity was quantitated by liquid scintillation counting (Beckman LS 6000-SC; Beckman Instruments, Inc., Fullerton, CA). The analysis was performed using antibodies specific for doubly phosphorylated p38 (Thr180/Tyr182) or antibodies recognizing the tyrosine 204-phosphorylated sequence 196–209 of either p42 or p44 and were quantified by laser-scanning densitometry. The total amount of the MAP kinases p44/p42 (Fig. 1A) and p38 (Fig. 1 B) increased when HL-60 cells were differentiated to a neutrophil-like phenotype with dbcAMP. Immunoblotting of lysates of undifferentiated and differentiated HL-60 cells with p38 and p44/p42 polyclonal antibodies, which recognized both the unphosphorylated and phosphorylated MAP kinases, revealed a 2.2- and 1.7-fold increase, respectively, of the total amount of p44/p42 and p38 upon differentiation of HL-60 cells to a neutrophil-like phenotype. The values, relative to control (100%), were 217 ± 13% for p44/p42 and 168 ± 17% for p38 (mean ± S.E., n = 3). To understand the regulation of MAP kinases in undifferentiated and differentiated HL-60 cells, the cells were stimulated by the chemotactic factor fMLP (100 µm; 2 min). Following stimulation, the activation of cellular MAP kinases was evaluated by using immunoblot to detect the induced protein phosphorylation, as described under "Experimental Procedures." The MAP kinases p38 and p44/p42 became phosphorylated in response to fMLP in differentiated HL-60 cells only (Fig. 2, Aand B, right panels). Phosphorylated p42 was the only activated form of MAP kinase detectable in undifferentiated HL-60 cells (Fig. 2 B, left panel). These findings showed that the differentiation of HL-60 cells to a neutrophil-like phenotype allowed the MAP kinases p38 and p44/p42 to be rapidly phosphorylated in response to fMLP. For differentiation markers, lysozyme and myeloperoxidase activities were measured. The values (expressed in absorption units/min) were 19.8 with dbcAMP and 4.7 with Me2SO versus1 for the control for lysozyme activity and 39 with dbcAMP and 5.2 with Me2SO versus 3.8 for the control for myeloperoxidase activity. We studied the fMLP-induced activation of p38 and p44/p42 in differentiated HL-60 cells using phosphospecific antibodies that bind only the activated form of p38 or p44/p42. Immunoblot analysis demonstrated that fMLP, throughout the dose range of 10−10 to 10−5m, activated the MAP kinases p38 (Fig.3A) and p44/p42 (Fig.4A) in a dose-dependent manner. The maximal level of stimulation was reached at 10−6m of fMLP for p38 and 10−8m for p44/p42. As shown in Fig.3 B, fMLP induced a time-dependent, transient phosphorylation of p38. Phosphorylation of p38 was apparent at the earliest time analyzed, 0.25 min, attained maximal level at 2 min, and returned to near basal level at 15 min. We also determined the phosphorylation of p44/p42 by immunoblot. As for p38 activation, fMLP-induced p44/p42 phosphorylation (Fig. 4 B) occurred very early, reaching maximal level at 0.25 min (the earliest time point examined) and dropped at 10 min stimulation.Figure 4Concentration response and time course of ERK activation by fMLP. Differentiated HL-60 cells (2.5 × 106 cells/ml) were stimulated with the indicated concentrations of fMLP for 2 min (A) or stimulated for the indicated times with 100 nm fMLP at 37 °C (B). Cells were sonicated, and samples were analyzed by immunoblot. Equal amounts of proteins were loaded, and p44/42 phosphorylation was detected by immunoblot with phosphospecific antibodies. Data are representative of three experiments.View Large Image Figure ViewerDownload (PPT) We next investigated the involvement of PLD in the activation of the MAP kinases p38 and p44/p42 upon stimulation with fMLP. To determine if PLD-derived products were involved in activation of MAP kinases, we stimulated cells in the presence of ethanol. As shown in Fig. 5D, increasing concentrations of ethanol (0.025–0.5%) inhibited fMLP-induced activation of p38 MAPK. Inhibition of fMLP-induced p38 MAP kinase phosphorylation occurred with low concentrations of ethanol (0.125%). Significant inhibition (p < 0.05, Student'st test, n = 4) of p38 phosphorylation was observed with 0.25 and 0.5% of ethanol (Fig. 5 D). The inhibition was calculated by comparing stimulation in the presence of ethanol versus stimulation in the absence of ethanol (control). We found 59 and 71% inhibition of p38 phosphorylation with 0.25 and 0.5% of ethanol, respectively. In contrast, ethanol did not inhibit fMLP-induced activation of p44/p42 (Fig. 5, inset,blot C). To rule out a less specific effect of ethanol on the system, we used a longer chain primary alcohol (1-butanol) and included a secondary alcohol (2-butanol), which is not a PLD substrate. We found that 1-butanol, like ethanol, inhibited p38 phosphorylation (Fig. 6A). However, 2-butanol, as expected, did not inhibit p38 phosphorylation (Fig. 6 B). The inhibition of p38 phosphorylation by 1-butanol was more than that with ethanol (86, 80, and 87% inhibition, respectively, with 0.125–0.25 and 0.5% of 1-butanolversus 31, 59, and 71% inhibition with 0.125–0.25 and 0.5% ethanol, respectively).Figure 61-Butanol inhibited fMLP-induced p38 phosphorylation, whereas 2-butanol did not. Differentiated HL-60 cells (2.5 × 106 cells/ml) were stimulated with fMLP (100 nm, 2 min) in the presence of varying concentrations of either 1-butanol or 2-butanol (0.025–0.5%) at 37 °C. The alcohol was added just prior to the addition of fMLP. Cells were sonicated, and samples were analyzed by Western blot. Equal amounts of proteins were loaded, and p38 phosph
Referência(s)