Portal de Periódicos da CAPES

Hepatic Fibrosis Is Enhanced and Accompanied by Robust Oval Cell Activation after Chronic Carbon Tetrachloride Administration to Egr-1-Deficient Mice

2010; Elsevier BV; Volume: 176; Issue: 6 Linguagem: Inglês

10.2353/ajpath.2010.091186

1525-2191

Michele T. Pritchard, Laura E. Nagy,

Pancreatic function and diabetes

The transcription factor early growth response (Egr)−1 regulates the expression of genes required for execution of the wound healing response. Multiple cycles of injury, coupled to incomplete wound healing, lead to fibrosis. Therefore, we hypothesized that Egr-1 is required for the development of hepatic fibrosis. To test this hypothesis, we exposed wild-type and egr-1−/− mice to acute or chronic carbon tetrachloride (CCl4). Acute CCl4 exposure established a profibrotic milieu in the liver, including activation of hepatic stellate cells as well as expression of type 1 collagen genes and tissue inhibitor of matrix metalloproteinase 1 in both wild-type and egr-1−/− mice. This response was exacerbated in egr-1−/− mice. After chronic CCl4 exposure, hepatic fibrosis was established in both genotypes; however, the fibrotic response was profoundly worsened in Egr-1–deficient mice. Importantly, enhanced fibrosis in egr-1−/− mice was accompanied by a robust activation of the oval cell response, suggesting more severe liver injury and/or reduced hepatocyte proliferation when compared with wild-type mice. Hepatic expression of genes indicative of oval cell activation, as well as the number of cells expressing A6, a mouse oval cell marker, was greater in egr-1−/− mice. Taken together, these data reveal novel roles for Egr-1 as a negative regulator of both CCl4-induced hepatic fibrosis and the oval cell response. The transcription factor early growth response (Egr)−1 regulates the expression of genes required for execution of the wound healing response. Multiple cycles of injury, coupled to incomplete wound healing, lead to fibrosis. Therefore, we hypothesized that Egr-1 is required for the development of hepatic fibrosis. To test this hypothesis, we exposed wild-type and egr-1−/− mice to acute or chronic carbon tetrachloride (CCl4). Acute CCl4 exposure established a profibrotic milieu in the liver, including activation of hepatic stellate cells as well as expression of type 1 collagen genes and tissue inhibitor of matrix metalloproteinase 1 in both wild-type and egr-1−/− mice. This response was exacerbated in egr-1−/− mice. After chronic CCl4 exposure, hepatic fibrosis was established in both genotypes; however, the fibrotic response was profoundly worsened in Egr-1–deficient mice. Importantly, enhanced fibrosis in egr-1−/− mice was accompanied by a robust activation of the oval cell response, suggesting more severe liver injury and/or reduced hepatocyte proliferation when compared with wild-type mice. Hepatic expression of genes indicative of oval cell activation, as well as the number of cells expressing A6, a mouse oval cell marker, was greater in egr-1−/− mice. Taken together, these data reveal novel roles for Egr-1 as a negative regulator of both CCl4-induced hepatic fibrosis and the oval cell response. The wound healing response is a rapidly induced and finely orchestrated series of cellular and molecular events necessary for prompt tissue repair and reinstatement of tissue/organ integrity after injury.1Hantash BM Zhao L Knowles JA Lorenz HP Adult and fetal wound healing.Front Biosci. 2008; 13: 51-61Crossref PubMed Scopus (99) Google Scholar Perturbations in this system lead to aberrant tissue repair. In the case of prolonged exposure to injury, tissue fibrosis, defined by excessive extracellular matrix (ECM) deposition, is established. Liver fibrosis is a common end point of chronic hepatic diseases of all etiologies.2Henderson NC Iredale JP Liver fibrosis: cellular mechanisms of progression and resolution.Clin Sci (Lond). 2007; 112: 265-280Crossref PubMed Scopus (245) Google Scholar, 3Friedman SL Mechanisms of hepatic fibrogenesis.Gastroenterology. 2008; 134: 1655-1669Abstract Full Text Full Text PDF PubMed Scopus (2179) Google Scholar Although there has been significant progress in defining the roles of the many cell types, soluble mediators and transcription factors that contribute to fibrosis and its resolution in animal models, these advances have not yet led to improvements in the therapeutic arsenal available for patients with fibrosis or cirrhosis. Indeed, liver transplant remains the only viable treatment option for the burgeoning population of patients with fibrosis and is hampered by a limited supply of available organs.4Fowell AJ Iredale JP Emerging therapies for liver fibrosis.Dig Dis. 2006; 24: 174-183Crossref PubMed Scopus (56) Google Scholar Early growth response (Egr)−1 (also known as NGFI-A, zif268, TIS8, and Krox24) is an 80- to 82-kDa transcription factor and prototypic member of the early growth response gene family.5Gashler A Sukhatme VP Early growth response protein 1 (Egr-1): prototype of a zinc-finger family of transcription factors.Prog Nucleic Acid Res Mol Biol. 1995; 50: 191-224Crossref PubMed Scopus (557) Google Scholar Egr-1 is an immediate early gene induced in response to a number of growth and differentiation factors and in response to tissue injury.5Gashler A Sukhatme VP Early growth response protein 1 (Egr-1): prototype of a zinc-finger family of transcription factors.Prog Nucleic Acid Res Mol Biol. 1995; 50: 191-224Crossref PubMed Scopus (557) Google Scholar, 6Yan SF Fujita T Lu J Okada K Shan Zou Y Mackman N Pinsky DJ Stern DM Egr-1, a master switch coordinating upregulation of divergent gene families underlying ischemic stress.Nat Med. 2000; 6: 1355-1361Crossref PubMed Scopus (398) Google Scholar, 7Harja E Bucciarelli LG Lu Y Stern DM Zou YS Schmidt AM Yan SF Early growth response-1 promotes atherogenesis: mice deficient in early growth response-1 and apolipoprotein E display decreased atherosclerosis and vascular inflammation.Circ Res. 2004; 94: 333-339Crossref PubMed Scopus (118) Google Scholar, 8Pawlinski R Pedersen B Kehrle B Aird WC Frank RD Guha M Mackman N Regulation of tissue factor and inflammatory mediators by Egr-1 in a mouse endotoxemia model.Blood. 2003; 101: 3940-3947Crossref PubMed Scopus (83) Google Scholar, 9McMullen MR Pritchard MT Wang Q Millward CA Croniger CM Nagy LE Early growth response-1 transcription factor is essential for ethanol-induced fatty liver injury in mice.Gastroenterology. 2005; 128: 2066-2076Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 10Pritchard MT Roychowdhury S McMullen MR Guo L Arteel GE Nagy LE Early growth response-1 contributes to galactosamine/lipopolysaccharide-induced acute liver injury in mice.Am J Physiol Gastrointest Liver Physiol. 2007; 293: G1124-G1133Crossref PubMed Scopus (34) Google Scholar Its swift induction and rapid decay place Egr-1 at a position to induce the expression of genes necessary for rapid yet transient responses to many forms of acute cellular stress. Using its three zinc-finger DNA binding domain, Egr-1 binds to G/C-rich regions found in the promoters of genes involved in inflammation (tumor necrosis factor [TNF] α, intercellular adhesion molecule-1) and also indirectly affects the expression of other inflammatory mediators (macrophage inflammatory protein-2, monocyte chemoattractant protein [MCP]−1).11Yao J Mackman N Edgington TS Fan ST Lipopolysaccharide induction of the tumor necrosis factor-alpha promoter in human monocytic cells. Regulation by Egr-1, c-Jun, and NF-kappaB transcription factors.J Biol Chem. 1997; 272: 17795-17801Crossref PubMed Scopus (424) Google Scholar, 12McMahon SB Monroe JG The role of early growth response gene 1 (egr-1) in regulation of the immune response.J Leukoc Biol. 1996; 60: 159-166PubMed Google Scholar, 13Maltzman JS Carmen JA Monroe JG Transcriptional regulation of the Icam-1 gene in antigen receptor- and phorbol ester-stimulated B lymphocytes: role for transcription factor EGR1.J Exp Med. 1996; 183: 1747-1759Crossref PubMed Scopus (115) Google Scholar Egr-1 is characterized as a ‘master regulator’ of inflammatory gene expression in mouse models of ischemia/reperfusion, endotoxemia, ethanol-induced fatty liver injury, and acute hepatitis.6Yan SF Fujita T Lu J Okada K Shan Zou Y Mackman N Pinsky DJ Stern DM Egr-1, a master switch coordinating upregulation of divergent gene families underlying ischemic stress.Nat Med. 2000; 6: 1355-1361Crossref PubMed Scopus (398) Google Scholar, 8Pawlinski R Pedersen B Kehrle B Aird WC Frank RD Guha M Mackman N Regulation of tissue factor and inflammatory mediators by Egr-1 in a mouse endotoxemia model.Blood. 2003; 101: 3940-3947Crossref PubMed Scopus (83) Google Scholar, 9McMullen MR Pritchard MT Wang Q Millward CA Croniger CM Nagy LE Early growth response-1 transcription factor is essential for ethanol-induced fatty liver injury in mice.Gastroenterology. 2005; 128: 2066-2076Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 10Pritchard MT Roychowdhury S McMullen MR Guo L Arteel GE Nagy LE Early growth response-1 contributes to galactosamine/lipopolysaccharide-induced acute liver injury in mice.Am J Physiol Gastrointest Liver Physiol. 2007; 293: G1124-G1133Crossref PubMed Scopus (34) Google Scholar Egr-1 expression is also a component of the wound healing response.14Grose R Harris BS Cooper L Topilko P Martin P Immediate early genes krox-24 and krox-20 are rapidly up-regulated after wounding in the embryonic and adult mouse.Dev Dyn. 2002; 223: 371-378Crossref PubMed Scopus (42) Google Scholar, 15Amendt C Mann A Schirmacher P Blessing M Resistance of keratinocytes to TGFbeta-mediated growth restriction and apoptosis induction accelerates re-epithelialization in skin wounds.J Cell Sci. 2002; 115: 2189-2198Crossref PubMed Google Scholar, 16Wu M Melichian DS de la Garza M Gruner K Bhattacharyya S Barr L Nair A Shahrara S Sporn PH Mustoe TA Tourtellotte WG Varga J Essential roles for early growth response transcription factor Egr-1 in tissue fibrosis and wound healing.Am J Pathol. 2009; 175: 1041-1055Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar Successful repair after injury involves inflammation, coagulation, angiogenesis, new tissue formation, and ECM remodeling/scarring.1Hantash BM Zhao L Knowles JA Lorenz HP Adult and fetal wound healing.Front Biosci. 2008; 13: 51-61Crossref PubMed Scopus (99) Google Scholar Egr-1 contributes to this process by regulating genes involved in coagulation (tissue factor, plasminogen activator inhibitor-1), ECM deposition and metabolism (transforming growth factor β, fibroblast growth factor-2, type 1 collagen, matrix metalloproteinase 14, platelet-derived growth factor A and B, thrombospondin-1, and fibronectin), cell division (p53 and cell division cycle protein 20 homolog [Cdc20]) and angiogenesis (vascular endothelial growth factor).17Thiel G Cibelli G Regulation of life and death by the zinc finger transcription factor Egr-1.J Cell Physiol. 2002; 193: 287-292Crossref PubMed Scopus (505) Google Scholar, 18Braddock M The transcription factor Egr-1: a potential drug in wound healing and tissue repair.Ann Med. 2001; 33: 313-318Crossref PubMed Scopus (41) Google Scholar, 19Bryant M Drew GM Houston P Hissey P Campbell CJ Braddock M Tissue repair with a therapeutic transcription factor.Hum Gene Ther. 2000; 11: 2143-2158Crossref PubMed Scopus (60) Google Scholar, 20Liao Y Shikapwashya ON Shteyer E Dieckgraefe BK Hruz PW Rudnick DA Delayed hepatocellular mitotic progression and impaired liver regeneration in early growth response-1-deficient mice.J Biol Chem. 2004; 279: 43107-43116Crossref PubMed Scopus (85) Google Scholar, 21Yan SF Zou YS Gao Y Zhai C Mackman N Lee SL Milbrandt J Pinsky D Kisiel W Stern D Tissue factor transcription driven by Egr-1 is a critical mechanism of murine pulmonary fibrin deposition in hypoxia.Proc Natl Acad Sci U S A. 1998; 95: 8298-8303Crossref PubMed Scopus (167) Google Scholar, 22Liu C Rangnekar VM Adamson E Mercola D Suppression of growth and transformation and induction of apoptosis by EGR-1.Cancer Gene Ther. 1998; 5: 3-28PubMed Google Scholar, 23Liu C Calogero A Ragona G Adamson E Mercola D EGR-1, the reluctant suppression factor: eGR-1 is known to function in the regulation of growth, differentiation, and also has significant tumor suppressor activity and a mechanism involving the induction of TGF-beta1 is postulated to account for this suppressor activity.Crit Rev Oncog. 1996; 7: 101-125Crossref PubMed Google Scholar, 24Chen SJ Ning H Ishida W Sodin-Semrl S Takagawa S Mori Y Varga J The early-immediate gene EGR-1 is induced by transforming growth factor-beta and mediates stimulation of collagen gene expression.J Biol Chem. 2006; 281: 21183-21197Crossref PubMed Scopus (142) Google Scholar, 25Haas TL Stitelman D Davis SJ Apte SS Madri JA Egr-1 mediates extracellular matrix-driven transcription of membrane type 1 matrix metalloproteinase in endothelium.J Biol Chem. 1999; 274: 22679-22685Crossref PubMed Scopus (173) Google Scholar This broad array of gene expression suggests that Egr-1 has the ability to affect the wound healing response of many, if not all, cell types in a given tissue. For example, in the liver, Egr-1 could potentially promote hepatic stellate cell (HSC) activation via regulation of platelet-derived growth factor, endothelial cell proliferation by vascular endothelial growth factor, and hepatocyte proliferation by Cdc20. Indeed, Egr-1–regulated expression of Cdc20 is required for hepatocyte proliferation in response to partial hepatectomy.20Liao Y Shikapwashya ON Shteyer E Dieckgraefe BK Hruz PW Rudnick DA Delayed hepatocellular mitotic progression and impaired liver regeneration in early growth response-1-deficient mice.J Biol Chem. 2004; 279: 43107-43116Crossref PubMed Scopus (85) Google Scholar Although transient, regulated expression of these gene products is required for appropriate wound healing responses; chronic expression of repair-associated genes is associated with the development of fibrosis. Despite the key regulatory role that Egr-1 plays in the timely expression of genes induced during the tissue response to injury, the role of Egr-1 in hepatic fibrosis is not known. Because Egr-1 regulates the expression of many profibrotic genes, we hypothesized that Egr-1 is required for hepatic fibrosis in response to chronic injury and that Egr-1–deficient mice would be protected from hepatotoxin-induced fibrosis. To test this hypothesis, we used the well-characterized carbon tetrachloride (CCl4)-induced hepatic fibrosis model26Constandinou C Henderson N Iredale JP Modeling liver fibrosis in rodents.Methods Mol Med. 2005; 117: 237-250PubMed Google Scholar in both wild-type and egr-1−/− mice. We predicted that, in the absence of Egr-1, fibrosis would be attenuated by the contribution of Egr-1 to expression of many genes associated with the wound healing response. To our surprise, hepatic fibrosis in egr-1−/− mice after chronic CCl4 was enhanced and recovery delayed compared with wild-type mice. In addition, chronic CCl4 exposure in egr-1−/− mice induced a striking activation of the hepatic progenitor cell or ‘oval cell’ compartment. Oval cell activation is not typically associated with hepatocyte replenishment after CCl4 exposure. Undamaged hepatocytes are widely appreciated to enter the cell cycle and recover lost liver mass in this model; only when liver injury is severe and/or hepatocyte proliferation is attenuated will oval cells participate in liver regeneration.27Fausto N Campbell JS The role of hepatocytes and oval cells in liver regeneration and repopulation.Mech Dev. 2003; 120: 117-130Crossref PubMed Scopus (558) Google Scholar To our knowledge, this is the first study to report a robust progenitor cell response during hepatic recovery after chronic CCl4 exposure. Our recent work (unpublished data) support the hypothesis that very severe liver injury in egr-1−/− mice after an initial exposure to CCl4 contributes to oval cell activation after chronic CCl4 exposure. CCl4 and olive oil were purchased from Sigma-Aldrich (St. Louis, MO). All primers for real-time reverse-transcription PCR were synthesized by Integrated DNA Technologies (Coralville, IA). Primary antibodies were purchased from the following companies: Cytochrome P450 2E1 (CYP2E1) Research Diagnostics, Inc (Flanders, NJ); Hsc 70 Santa Cruz (Santa Cruz, CA); α smooth muscle actin (αSMA, clone 1A6 Sigma-Aldrich, St. Louis, MO); A6 antibody was a generous gift from Dr. Valentina Factor (NIH/NCI). Female wild-type (C57BL/6NTac) or egr-1−/− (B6.129-Egr1tm1Jmi N12) mice (8–12 weeks) were purchased from Taconic Farms (Germantown, NY). The egr-1−/− mouse was originally developed in the laboratory of Jeffrey Milbrandt.28Lee SL Tourtellotte LC Wesselschmidt RL Milbrandt J Growth and differentiation proceeds normally in cells deficient in the immediate early gene NGFI-A.J Biol Chem. 1995; 270: 9971-9977Crossref PubMed Scopus (154) Google Scholar, 29Lee SL Wang Y Milbrandt J Unimpaired macrophage differentiation and activation in mice lacking the zinc finger transplantation factor NGFI-A (EGR1).Mol Cell Biol. 1996; 16: 4566-4572Crossref PubMed Google Scholar Animals were housed in standard microisolator cages and fed standard laboratory chow (rodent diet #2918, Harlan-Teklad, Madison, WI). All animal procedures were approved by the Cleveland Clinic Institutional Animal Care and Use Committee. The following numbers of animals were used in the acute studies: olive oil, 4 wild-type and 4 egr-1−/− mice; 18 hours, 5 wild-type and 5 egr-1−/− mice; 72 hours, 5 wild-type and 5 egr-1−/− mice. The following numbers of animals were used in chronic CCl4 experiments: olive oil, 7 wild-type and 6 egr-1−/− mice; 3 days, 9 wild-type and 6 egr-1−/− mice; 7 days, 5 wild-type and 5 egr-1−/− mice. In both acute and chronic CCl4 studies, CCl4 was prediluted 1:3 in olive oil before administration; controls received injections of olive oil alone. For acute CCl4 studies, mice received a single dose at 1 μl/g body weight of prediluted (1:3 in olive oil) CCl4 administered by intraperitoneal injection using 100 μl Hamilton syringes and 26 G 5/8 inch needles. The dose was well tolerated by wild-type and egr-1−/− mice. Both genotypes had lost 1 g of body weight relative to olive oil controls 18 hours after the CCl4 injection. This weight loss was completely recovered in wild-type mice by 72 hours; egr-1−/− mice recovered some but not all of the weight loss by 72 hours. For chronic CCl4 studies, mice received a total of 10 injections (2 injections each week on Tuesdays and Fridays) over 5 weeks. Mice were ramped up to the full dose of CCl4 over two doses (first injection at 0.25 μl/g body weight, the second at 0.5 μl/g body weight). The third through tenth injections were administered at the full 1 μl/g body weight dose. As in the acute studies, each dose was prediluted (1:3) in olive oil before administration. Injections were given on the opposite side of the peritoneal cavity from the previous injection. Wild-type mice tolerated the chronic CCl4 administration paradigm well; egr-1−/− mice were less resilient to subsequent doses of CCl4 by the end of the third week. The difference in tolerance to the chronic treatment paradigm was paralleled by differences in body weight at 3 and 7 days after completion of CCl4 exposure (see supplemental Figure S1 at http://ajp.amjpathol.org). In the acute studies, animals were sacrificed 18 and 72 hours after CCl4 administration. In the chronic studies, animals were sacrificed at 3 and 7 days after the final CCl4 exposure. At the time of sacrifice, mice were weighed, and once anesthetized, blood was collected from the posterior vena cava. Plasma was separated from whole blood and stored at −80°C. Mice were then euthanized, while under anesthesia, by exsanguination. Livers were removed, weighed, and portions fixed in formalin, frozen in Optimal Cutting Temperature medium (Sakura Finetek USA, Torrance, CA), snap frozen in liquid nitrogen, or stored in RNAlater (Ambion, Austin, TX) for further analysis. For histological analysis, formalin-fixed tissues were paraffin-embedded, sectioned (5 μm), and stained with hematoxylin and eosin (H&E), Sirius red, or Masson trichrome. Slides were coded before initial examination and viewed by two separate individuals. Quantification of Sirius red staining was performed using ImagePro plus software (Media Cybernatics, Silver Spring, MD). Total RNA was isolated from liver and 4 μg of total hepatic RNA was reverse transcribed.9McMullen MR Pritchard MT Wang Q Millward CA Croniger CM Nagy LE Early growth response-1 transcription factor is essential for ethanol-induced fatty liver injury in mice.Gastroenterology. 2005; 128: 2066-2076Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar Real-time PCR amplification was performed using Brilliant SYBR Green QPCR Master Mix (Stratagene, La Jolla, CA) and gene-specific primers (Table 1) in an Mx3000p PCR machine (Stratagene). Reaction volumes and thermal cycle parameters were as previously described.9McMullen MR Pritchard MT Wang Q Millward CA Croniger CM Nagy LE Early growth response-1 transcription factor is essential for ethanol-induced fatty liver injury in mice.Gastroenterology. 2005; 128: 2066-2076Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar The relative amount mRNA was determined using the comparative threshold (Ct) method by normalizing target cDNA Ct values to that of 18S; 18S Ct values did not change from baseline values at time points after CCl4 used in these studies. Fold induction ratios were calculated relative to basal conditions for each genotype using the formula: 2−ΔΔCt.Table 1Real-Time PCR Primer Sequences for Genes of Interest (GOI)GOIGenBank accessionPrimer bank*, Primer Bank, http://pga.mgh.harvard.edu/primerbank/ accessionPrimer sequences18SX00686NAF:5′–ACGGAAGGGCACCACCAGGA–3′R:5′–CACCACCACCCACGGAATCG–3′Egr-1NM_0079136681285a2F:5′–AGCGAACAACCCTATGAGCAC–3″R:5′–TCGTTTGGCTGGGATAACTCG–3″αSMANM_0073926671507a1F:5′–GTCCCAGACATCAGGGAGTAA–3′R:5′–TCGGATACTTCAGCGTCAGGA–3′desminNM_01004333563250a1F:5′–GTGGATGCAGCCACTCTAGC–3′R:5′–TTAGCCGCGATGGTCTCATAC–3′COL1A1NM_007742NAF:5′–CAAGAACAGCAACGAGTACCG–3′R:5′–GTCACTGGTCAACTCCAGCAC–3′COL1A2NM_0077436680980a2F:5′–GGTGAGCCTGGTCAAACGG–3′R:5′–ACTGTGTCCTTTCACGCCTTT–3′CTGFNM_0102176753878a1F:5′–GGGCCTCTTCTGCGATTTC–3′R:5′–ATCCAGGCAAGTGCATTGGTA–3′TIMP1NM_0115936755795a1F:5′–GCAACTCGGACCTGGTCATAA–3′R:5′–CGGCCCGTGATGAGAAACT–3′AFPNM_00742331982513a2F:5′–AACTCTGGCGATGGGTGTTTA–3′R:5′–ACACTGATGTCTTTCCACTCCA–3′Thy-1NM_0093826678347a1F:5′–TGCTCTCAGTCTTGCAGGTG–3′R:5′–TGGATGGAGTTATCCTTGGTGTT–3′HGFX840464165287A1F:5′–ATGTGGGGGACCAAACTTCTG–3′R:5′–GGATGGCGACATGAAGCAG–3′c-metNM_0085916678868a1F:5′–GTCAACATGAAGTATCAGCTCCC–3′R:5′–TGTAGTTTGTGGCTCCGAGAT–3′TWEAKNM_01161433438584a1F:5′–CCGCCAGATTGGGGAATTTAC–3′R:5′–AGTCCAAAGTAGGTTAGGAAGGG–3′Fn14NM_0137497305059a1F:5′–GTGTTGGGATTCGGCTTGGT–3′R:5′–GTCCATGCACTTGTCGAGGTC–3′MCP1NM_011333NAF:5′–AAGTCCCTGTCATGCTTCTG–3′R:5′–TCTGGACCCATTCCTTCTTG–3′NA, indicates not applicable.* , Primer Bank, http://pga.mgh.harvard.edu/primerbank/ Open table in a new tab NA, indicates not applicable. Liver homogenates were prepared and protein concentrations determined for immunoblotting.30Pritchard MT McMullen MR Stavitsky AB Cohen JI Lin F Medof ME Nagy LE Differential contributions of C3. C5, and decay-accelerating factor to ethanol-induced fatty liver in mice.Gastroenterology. 2007; 132: 1117-1126Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar Thirty-five micrograms of protein were resolved on 15% polyacrylamide gels and transferred to Polyvinylidene fluoride membranes. Membranes were probed with antibodies specific for CYP2E1 and Hsc 70 (loading control). Formalin-fixed paraffin embedded liver sections (5 μm) were deparaffinized and hydrated consecutively in 100% twice, 95% and 70% ethanol followed by 2 washes in distilled water. Protein epitopes were unmasked using citrate buffer incubation at 95–100°C for 20 minutes in an 1100 watt microwave using a pressure cooker (Nordic Ware, Minneapolis, MN). After heat treatment, the sections were allowed to cool at room temperature for an additional 20 minutes. Endogenous peroxidase activity and avidin/biotin were quenched using 3% hydrogen peroxide (H2O2) and appropriate avidin and biotin blocking reagents (Vector Laboratories, Inc., Burlingame, CA), respectively. Serum-containing blocking reagents from the Mouse on Mouse kit (Vector Labs) were used per the manufacturer’s instructions before incubation with the mouse αSMA antibody (1:1600). The horseradish peroxidase–conjugated secondary antibody was used as outlined in the Mouse on Mouse kit. After washing away unbound secondary antibody, sections were incubated with Avidin-Biotin Complex reagents followed by incubation with diaminobenzamidine for 1 minute. Sections were then washed in cold running tap water for 5 minutes and then immersed in hematoxylin (DAKO, Carpinteria, CA) for 5 minutes before another 5-minute wash in cold running water. Finally, sections were dehydrated and preserved using Permount (Sigma-Aldrich) and glass coverslips. No immunostaining was seen in sections incubated with blocking reagent alone in the absence of primary antibody. A6 is a marker for mouse oval cells.31Engelhardt NV Factor VM Yasova AK Poltoranina VS Baranov VN Lasareva MN Common antigens of mouse oval and biliary epithelial cells. Expression on newly formed hepatocytes.Differentiation. 1990; 45: 29-37Crossref PubMed Scopus (88) Google Scholar Five-micrometer frozen sections from livers embedded in Tissue-Tek Optimal Cutting Temperature Compound (Sakura Finetek USA, Torrance, CA) were fixed in methanol:acetone (1:1) for 10 minutes and then air dried for 10 minutes. Endogenous peroxidase in liver sections was quenched by emersion in 3% H2O2 for 2 minutes. After blocking in 10% normal goat serum, sections were incubated with the anti-A6 antibody (1:40 dilution in 10% normal goat serum) for 60 minutes at room temperature in a humidified chamber. After two 5-minute washes in Tris-buffered saline (TBS), sections were incubated with an horseradish peroxidase–conjugated goat-anti-rabbit secondary antibody. After two additional washes in TBS, sections were incubated with diaminobenzamidine for 5 minutes, rinsed in TBS, and then distilled water and stained with hematoxylin for 5 minutes. After dehydration in a graded series of ethanols and xylene substitute, sections were preserved using Permount (Sigma-Aldrich) and glass coverslips. A6-positive cells were counted in four ×400 fields per slide by blinded individuals. The A6 antibody recognizes biliary epithelial cells found in bile caniculi of the portal tracts as well as oval cells.31Engelhardt NV Factor VM Yasova AK Poltoranina VS Baranov VN Lasareva MN Common antigens of mouse oval and biliary epithelial cells. Expression on newly formed hepatocytes.Differentiation. 1990; 45: 29-37Crossref PubMed Scopus (88) Google Scholar Therefore, only A6-positive cells found in the parenchyma in areas separate from portal tracts were enumerated. Values reported are means ± SEM. Because of the limited number of age-matched egr-1−/− mice, data were collected from several different experiments. The data were analyzed by general linear models procedure (SAS, Carey, NC) followed by least square means analysis of differences between groups, blocking for experiment effects when data from more than one experiment were used in any given data set. Data were log transformed to obtain a normal distribution, if necessary. Comparisons between data sets with P values of less than 0.05 were considered significant. A single CCl4 exposure in mice and rats activates HSCs, the cell type largely responsible for excessive ECM deposition and fibrosis after repeated CCl4 exposure.32Friedman SL Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver.Physiol Rev. 2008; 88: 125-172Crossref PubMed Scopus (2066) Google Scholar Indices of HSC activation and hepatic fibrogenesis after acute exposure to CCl4 can be used to predict the severity of fibrosis after chronic exposure to CCl4. Hepatic αSMA and desmin, markers associated with HSC activation, were increased in livers from wild-type and egr-1−/− mice 72 hours after acute CCl4 exposure; this increase was greater in livers from mice deficient in Egr-1 (Figure 1, A and B). αSMA protein expression paralleled the mRNA data; immunoreactive αSMA was greater in livers from egr-1−/− mice compared with wild-type mice (Figure 1C). Activated HSCs produce type I collagen molecules, the predominate collagen associated with liver fibrosis.3Friedman SL Mechanisms of hepatic fibrogenesis.Gastroenterology. 2008; 134: 1655-1669Abstract Full Text Full Text PDF PubMed Scopus (2179) Google Scholar Seventy-two hours after acute CCl4 exposure, hepatic mRNA accumulation of collagen 1α1 (COL1A1) and collagen 1α2 (COL1A2) was increased in both strains of mice; however, this increase was fivefold greater in livers from egr-1−/− mice (Figure 1, D and E, respectively). Associated with increased activation of HSC and production of type I collagen molecules in egr-1−/− mice was increased expression of connective tissue growth factor (CTGF), a pro-fibrotic molecule, and tissue inhibitor of matrix metalloproteinase−1, an inhibitor of matrix degradation (Figure 1, F and G, respectively) compared with wild-type mice. Expression of cytochrome P450 2E1 (CYP2E1), the enzyme required for CCl4 bioactivation and CCl4-induced liver injury and fibrosis,33Wong FW Chan WY Lee SS Resistance to carbon tetrachloride-induced hepatotoxicity in mice which lack CYP2E1 expression.Toxicol Appl Pharmacol. 1998; 153: 109-118Crossref PubMed Scopus (220) Google Scholar was not different between wild-type and egr-1−/− mice after acute CCl4 exposure (unpublished data). In animal models of acute injury, Egr-1 expression is robust, but transient.8Pawlinski R Pedersen B Kehrle B Aird WC Frank RD Guha M Mackman N Regulation of tissue factor and inflammatory mediators by Egr-1 in a mouse endoto