Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Identification and Characterization of the cis-Acting Elements of the Human CD155Gene Core Promoter

1999; Elsevier BV; Volume: 274; Issue: 3 Linguagem: Inglês

10.1074/jbc.274.3.1791

ISSN

1083-351X

Autores

David J. Solecki, Eckard Wimmer, Martin Lipp, Günter Bernhardt,

Tópico(s)

Viral Infectious Diseases and Gene Expression in Insects

Resumo

The CD155 protein is the founding member of a new group of related molecules within the immunoglobulin superfamily sharing a V-C2-C2 domain structure and significant amino acid identity. We have recently isolated the promoter of the CD155 gene so that we may determine the transcription factors that regulate its expression and possibly gain insight into the cell biology of this gene. Here we report the mapping of three cis-elements within the CD155 core promoter, designated FPI, II, and III. The results of linker scanning mutagenesis suggest that all three of these cis-elements are required in varying degrees for the promoter activity of the core promoter fragment. The relative contribution of each region ranked in the following order: III > II > I. Interestingly, footprint and electrophoretic mobility shift assays show that FPIII binding activity is much reduced in a human cell line that does not express CD155. Additionally, protein binding to FPI and FPII was also investigated. DNase I footprinting using recombinant hAP-2α indicated that this transcription factor bound to both the FPI and FPII regions of the CD155 core promoter fragment. Electrophoretic mobility shift assays and supershift analysis confirmed the binding of AP-2 from crude nuclear extracts to FPI and to FPII. Lastly, cotransfection of the CD155promoter with an AP-2α expression vector indicates that overexpression of AP-2α modulated the promoter activity of aCD155 promoter construct. The CD155 protein is the founding member of a new group of related molecules within the immunoglobulin superfamily sharing a V-C2-C2 domain structure and significant amino acid identity. We have recently isolated the promoter of the CD155 gene so that we may determine the transcription factors that regulate its expression and possibly gain insight into the cell biology of this gene. Here we report the mapping of three cis-elements within the CD155 core promoter, designated FPI, II, and III. The results of linker scanning mutagenesis suggest that all three of these cis-elements are required in varying degrees for the promoter activity of the core promoter fragment. The relative contribution of each region ranked in the following order: III > II > I. Interestingly, footprint and electrophoretic mobility shift assays show that FPIII binding activity is much reduced in a human cell line that does not express CD155. Additionally, protein binding to FPI and FPII was also investigated. DNase I footprinting using recombinant hAP-2α indicated that this transcription factor bound to both the FPI and FPII regions of the CD155 core promoter fragment. Electrophoretic mobility shift assays and supershift analysis confirmed the binding of AP-2 from crude nuclear extracts to FPI and to FPII. Lastly, cotransfection of the CD155promoter with an AP-2α expression vector indicates that overexpression of AP-2α modulated the promoter activity of aCD155 promoter construct. The study of the mechanism by which poliovirus (PV) 1The abbreviations used are: PV, poliovirus; bp, base pair(s); EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; RSV, Rous sarcoma virus; RT, reverse transcription; BL, Burkitt's lymphoma; NF, nuclear factor. binds to and enters a host cell has led to the discovery of a group of related genes belonging to the immunoglobulin superfamily. The founding member of this group of related genes, the human poliovirus receptor (hPVR)/CD155, was cloned based on its ability to mediate the attachment of PV to host cells (1Mendelsohn C.L. Wimmer E. Racaniello V.R. Cell. 1989; 56: 855-865Abstract Full Text PDF PubMed Scopus (824) Google Scholar). The CD155 gene encodes glycoproteins with three extracellular immunoglobulin domains designated V-C2-C2 (1Mendelsohn C.L. Wimmer E. Racaniello V.R. Cell. 1989; 56: 855-865Abstract Full Text PDF PubMed Scopus (824) Google Scholar, 2Koike S. Horie H. Ise I. Okitsu A. Yoshida M. Iizuka N. Takeuchi K. Takegami T. Nomoto A. EMBO J. 1990; 9: 3217-3224Crossref PubMed Scopus (270) Google Scholar, 3Zibert A. Selinka H.C. Elroy-Stein O. Moss B. Wimmer E. Virology. 1991; 182: 250-259Crossref PubMed Scopus (13) Google Scholar, 4Bibb J.A. Bernhardt G. Wimmer E. J. Gen. Virol. 1994; 75: 1875-1881Crossref PubMed Scopus (8) Google Scholar, 5Bibb J.A. Bernhardt G. Wimmer E. J. Virol. 1994; 68: 6111-6115Crossref PubMed Google Scholar, 6Bernhardt G. Bibb J.A. Bradley J. Wimmer E. Virology. 1994; 199: 105-113Crossref PubMed Scopus (54) Google Scholar). Alternate splicing of the CD155primary transcript gives rise to four isoforms: CD155α and CD155δ, which are integral membrane proteins; and CD155β and CD155γ, which are presumably secreted because they lack the exon encoding a transmembrane domain (2Koike S. Horie H. Ise I. Okitsu A. Yoshida M. Iizuka N. Takeuchi K. Takegami T. Nomoto A. EMBO J. 1990; 9: 3217-3224Crossref PubMed Scopus (270) Google Scholar). The involvement of the viral receptor activity of the CD155 protein in both poliovirus attachment and the pathogenesis of poliovirus infections has been the subject of intense investigation (for review, see Refs. 7Wimmer E. Harber J.J. Bibb J.A. Gromeier M. Lu H.-H. Bernhardt G. Wimmer E. Cellular Receptors for Animal Viruses. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1994: 101-127Google Scholar, 8Freistadt M. Wimmer E. Cellular Receptors for Animal Viruses. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1994: 445-461Google Scholar, 9Koike S. Aoki J. Nomoto A. Wimmer E. Cellular Receptors for Animal Viruses. Cold Spring Harbor Laboratory, Cold Sring Harbor, NY1994: 463-480Google Scholar). The amino-terminal V type immunoglobulin domain of the integral membrane splice variants of CD155 serves as the PV binding moeity. Receptor binding then leads to virion destabilization and virus entry into host cells (7Wimmer E. Harber J.J. Bibb J.A. Gromeier M. Lu H.-H. Bernhardt G. Wimmer E. Cellular Receptors for Animal Viruses. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1994: 101-127Google Scholar, 10Freistadt M.S. Racaniello V.R. J. Virol. 1991; 65: 3873-3876Crossref PubMed Google Scholar, 11Koike S. Ise I. Nomoto A. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 4104-4108Crossref PubMed Scopus (86) Google Scholar, 12Selinka H.C. Zibert A. Wimmer E. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 3598-3602Crossref PubMed Scopus (71) Google Scholar, 13Zibert A. Selinka H.C. Elroy-Stein O. Wimmer E. Virus Res. 1992; 25: 51-61Crossref PubMed Scopus (13) Google Scholar, 14Morrison M.E. He Y.-J. Wien M.W. Hogle J.M. Racaniello V.R. J. Virol. 1994; 68: 2578-2588Crossref PubMed Google Scholar, 15Aoki J. Koike S. Ise I. Sato-Yoshida Y. Nomoto A. J. Biol. Chem. 1994; 269: 8431-8438Abstract Full Text PDF PubMed Google Scholar, 16Bibb J.A. Witherell G. Bernhardt G. Wimmer E. Virology. 1994; 201: 107-115Crossref PubMed Scopus (19) Google Scholar, 17Bernhardt G. Harber J.J. Zibert A. deCrombrugghe M. Wimmer E. Virology. 1994; 203: 344-356Crossref PubMed Scopus (65) Google Scholar, 18Harber J. Bernhardt G. Lu H.H. Sgro J.Y. Wimmer E. Virology. 1995; 214: 559-570Crossref PubMed Scopus (72) Google Scholar). In addition, transgenic mice expressing the CD155 protein develop a syndrome very similar to human poliomyelitis when infected by PV, an observation suggesting that the CD155 protein is a major determinant of the tissue tropism displayed by PV (19Ren R.B. Costantini F. Gorgacz E.J. Lee J.J. Racaniello V.R. Cell. 1990; 63: 353-362Abstract Full Text PDF PubMed Scopus (315) Google Scholar, 20Koike S. Taya C. Kurata T. Abe S. Ise I. Yonekawa H. Nomoto A. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 951-955Crossref PubMed Scopus (262) Google Scholar, 21Gromeier M. Lu H.-H. Wimmer E. Microbiol. Pathog. 1995; 18: 253-267Crossref PubMed Scopus (19) Google Scholar). Since the discovery of the CD155 gene, many genes possessing the V-C2-C2 domain architecture have been cloned from mouse, monkey, and man. In keeping with the fact that poliomyelitis is a disease that strictly affects primates, two homologous genes of CD155 which function as viral receptors were cloned from the African green monkey,AGMα1 and AGMα2 (22Koike S. Ise I. Sato Y. Yonekawa H. Gotoh O. Nomoto A. J. Virol. 1992; 66: 7059-7066Crossref PubMed Google Scholar). A mouse relative, called MPH, has been isolated and characterized (23Morrison M.E. Racaniello V.R. J. Virol. 1992; 66: 2807-2813Crossref PubMed Google Scholar). In addition, two human genes, PRR1 (poliovirusreceptor-related) and PRR2 have been described which share approximately 52 and 51% homology to the CD155 extracellular domains (24Lopez M. Eberle F. Mattei M.-G. Gabert J. Birg F. Bardin F. Maroc C. Dubreuil P. Gene (Amst.). 1995; 155: 261-265Crossref PubMed Scopus (146) Google Scholar, 25Eberle F. Dubreuil P. Mattei M.G. Devilard E. Lopez M. Gene (Amst.). 1995; 159: 267-272Crossref PubMed Scopus (162) Google Scholar). Interestingly, the MPH protein is more closely related to PRR2 than to CD155. Thus, MPH may not be the functional homolog of CD155, for which reason we will refer to it as mouse PRR2. In addition a CD155-related gene, the putative tumor antigen Tage4 was identified in rat and mouse (26Chadeneau C. LeMoullac B. Denis M.G. J. Biol. Chem. 1994; 269: 15601-15605Abstract Full Text PDF PubMed Google Scholar,27Chadeneau C. LeMoullac B. LeCabellec M. Mattei M. Meflah K. Denis M.G. Mamm. Genome. 1996; 7: 636-637Crossref PubMed Scopus (18) Google Scholar). Until recently, the functions attributed to the molecules belonging to this subfamily have been obscure. Akoi et al. (28Aoki J. Koike S. Asou H. Ise I. Suwa H. Tanaka T. Miyasaka M. Nomoto A. Exp. Cell Res. 1997; 235: 374-384Crossref PubMed Scopus (115) Google Scholar) have reported that mouse PRR2 can serve as a homotypic cellular adhesion molecule that cannot bind any other members of theCD155-related gene family. Furthermore, CD155 has been reported to be physically associated with CD44 on monocytes (29Freistadt M.S. Eberle K.E. Mol. Immunol. 1997; 34: 1247-1257Crossref PubMed Scopus (30) Google Scholar). Interestingly, two publications by Chadeneau et al. (26Chadeneau C. LeMoullac B. Denis M.G. J. Biol. Chem. 1994; 269: 15601-15605Abstract Full Text PDF PubMed Google Scholar, 30Chadeneau C. LeCabellec M. LeMoullac B. Meflah K. Denis M.G. Int. J. Cancer. 1996; 68: 817-821Crossref PubMed Scopus (43) Google Scholar) report that the rat and mouse Tage4 antigens are highly expressed in neoplastic tissue, but little expression is observed in normal tissues, suggesting that Tage4 is a tumor antigen. Taken together, these studies suggest that the CD155 subfamily of genes may possess important biological activities such as representing a new group of homotypic cellular adhesion molecules or as diagnostic markers in the study of neoplasia. We have recently reported the cloning of the promoter region of theCD155 gene. A characterization of the CD155promoter region will allow us to determine the cis-acting elements and trans-acting factors that regulate the expression of the CD155 gene and possibly provide insight into the biology of the CD155 protein. Our previous work determined that the CD155 promoter activity resides within an approximately 280-bp genomic DNA fragment that lacks TATA and CAAT boxes and is rich in GC nucleotide content. Three major and several minor transcriptional start sites have been identified within an approximately 60-bp region of this segment of genomic DNA (31Solecki D. Schwarz S. Wimmer E. Lipp M. Bernhardt G. J. Biol. Chem. 1997; 272: 5579-5586Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Interestingly, promoter constructs containing the 280-bpCD155 core promoter were inactive in Raji cells, a cell line that did not express endogenous CD155 mRNA. In this report we have extended our analyses of the CD155promoter. By DNase I footprinting we have identified three functionalcis-acting elements (FPI–FPIII) within the CD155core promoter and addressed their importance for basal promoter activity by linker scanning mutagenesis. We have also identified acis-element in FPIII which is required for CD155promoter activity and may be involved in the tissue-specific expression of CD155. We demonstrate in footprinting experiments that recombinant hAP-2α can bind two adjacent AP-2 binding motifs within the core promoter. Mutation of these potential binding motifs, either singly or in tandem, resulted in a reduction of core promoter activity. These mutations also abrogated the binding of hAP-2α. Electrophoretic mobility shift assays (EMSAs) confirmed AP-2 binding to FPI and FPII when the experiments were carried out using crude nuclear extracts. Lastly, overexpression of AP-2α in cotransfection experiments was found to stimulate the activity of the CD155 promoter approximately 3-fold. Cells from HeLa (cervical carcinoma), HEp-2 (epidermoid carcinoma), HepG2 (hepatocellular carcinoma), Saos-2 (osteocarcinoma), MDA-MB 435 (breast carcinoma), HEK293 (embryonic kidney), SK-N-SH (neuroblastoma), SK-N-MC (neuroblastoma), and HTB15 (glioblastoma) were grown in Dulbecco's modified Eagle's medium, 10% fetal bovine serum. Raji (Burkitt's lymphoma), BL99 (Burkitt's lymphoma), IARC 549 (B-lymphoblast), U937 (histiocytic lymphoma), K562 (chronic myelogenous leukemia), HL60 (promyelocytic leukemia), CEM (T-lymphoblastic leukemia), and Jurkat (T-lymphoblastic leukemia) cells were grown in RPMI 1640, 10% fetal bovine serum. Nuclear extract preparation and DNase I footprinting were performed as described by Dynan et al. (32Dynan W.S. Setlow J.K. Genetic Engineering. Plenum Press, New York1987: 75-87Crossref Google Scholar) with the following modifications. End-labeled DNA probes were generated via the polymerase chain reaction (PCR), using oligonucleotides that were end-labeled with [γ-32P]ATP by polynucleotide kinase. PCR was performed under standard conditions using 10 ng of pGL2-H template, 25 pmol labeled and unlabeled primers, and 1.2 units ofTaq polymerase. Radiolabeled PCR products were subjected to electrophoresis on a 10% native polyacrylamide gel, the bands were visualized by autoradiography, and a selected band was excised from the gel and passively eluted. DNase I protection assays were performed using 105 cpm of labeled probe that was incubated in a 50-μl binding reaction containing 2 μg of poly(dI-dC) and nuclear protein or recombinant human AP-2α (Promega Corp.). After a 30-min incubation on ice, 50 ml of a solution (room temperature) of 5 mm CaCl2 and 10 mmMgCl2 was added to each reaction and incubated for 1 min at room temperature. 1 μl of DNase I (6–100 ng/μl) was added and incubated another min at room temperature. The reactions were terminated by the addition of 90 μl of stop solution (0.2m NaCl, 0.03 m EDTA, 1% SDS, and linear polyacrylamide as a carrier for ethanol precipitation). The mixture was then phenol/chloroform extracted twice, and the DNAs were ethanol precipitated. The samples were then electrophoresed on 10% polyacrylamide sequencing gels with a sequencing reaction as a marker. Site-directed mutagenesis of the BE CD155 promoter fragment was carried out using the megaprimer mutagenesis technique (33Picard V. Ersdal-Badju E. Aiqin L. Bock S.C. Nucleic Acids Res. 1994; 22: 2587-2591Crossref PubMed Scopus (216) Google Scholar). To generate a megaprimer for each mutant construct, 100 ng of pGL2-BE plasmid was amplified in a reaction containing 50 pmol of either 4529 or 4532 flanking primer, 50 pmol of mutagenic primer, 5 μl of 10 × buffer, 2 μl of 10 mm dNTP mix, and 0.5 μl of Taq polymerase (2.5 units, Stratagene) in a total reaction volume of 50 μl. Reactions to generate FPIII megaprimers utilized 4529 as the first flanking primer, whereas FPII and FPI utilized 4532. PCR amplification conditions were 94 °C, 30 s; 55 °C, 45 s; 72 °C, 45 s for 35 cycles. All megaprimers were then gel purified. To extend a megaprimer to generate to a full-length 280 bp, 100 ng of pGL2-BE plasmid was amplified in a reaction containing 50 pmol of either 4529 or 4532 flanking primer (4529 for FPIII constructs and 4532 for FPII/FPI constructs), 1–2 μg of megaprimer, 5 μl of 10 × buffer, 2 μl of 10 mmdNTP mix, and 0.5 μl of Pfu polymerase (2.5 units, Stratagene). The HTB15 (human glioblastoma), HeLa (human cervical carcinoma), SK-N-MC (human neuroblastoma), and HepG2 (human hepatocellular carcinoma) cell lines were transfected by the calcium phosphate procedure. Each transfection for the linker scan series of constructs was composed of 18 μg of wild type or mutant BE plasmid and 0.5 μg of pRL-TK (standard to the measure of transfectional efficiency). The composition of the cotransfection experiments was 9 μg of the BE, BE II(4), BE I(I), or BE ΔII/I plasmids mixed with up to 3 μg of pSP(RSV)-hAP-2α. Cotransfections with less than 3 μg of expression vector were supplemented with pSP(RSV) to keep the amount of backbone plasmid constant for each experiment. 50 μl of 2.5 mCaCl2 was added to the DNA mixtures, and then they were diluted to a total volume of 500 μl with TE buffer. These solutions were separately combined dropwise with 500 μl of ice-cold 2 × Hanks' balanced saline solution and incubated for 10 min at room temperature. Half of the precipitates were added to a separate plate of tissue culture cells, and the plates were incubated at 37 °C. 4 h later the medium was removed, and a solution of 20% glycerol in Hanks' balanced saline solution was added. After a 3-min incubation at 37 °C, 3 ml of medium was added, and the supernatant was removed again and replaced by fresh medium with serum. All transfected cells were harvested 18 h post-transfection, and cell extracts (usually 200–400 μl) were made using the reporter lysis buffer from Promega. The oligodeoxynucleotides used for EMSAs were as follows. FPIs5′­GGAGCGGCCCCCCGGGGATTCCAGGA­3′FPIas5′­GGTCCTGGAATCCCCGGGGGGCCGCT­3′FPIIs5′­GAAGAAGTGGGTATTCCCCTTCCCACCCCAGGCACT­3′FPIIas5′­GAGTGCCTGGGGTGGGAAGGGGAATACCCACTTCTT­3′FPII(short)s5′­CCTTCCCACCCCAGGCACT­3′FPII(short)as5′­CCAGTGCCTGGGGTGGGAA­3′FPIIIs5′­GGTGGCCCACCCCGCGCCTGGCGGGACTGGCCGCCAACTCCCCTCCGCTCCAGTCA­3′FPIIIas5′­GTGACTGGAGCGGAGGGGAGTTGGCGGCCAGTCCCGCCAGGCGCGGGGTGGGCCA­3′ Sequence IIThe AP-2 consensus oligodeoxynucleotide was purchased from Santa Cruz Biotechnology. 1 nmol of each the coding and noncoding oligodeoxynucleotides was reassociated in a volume of 50 μl using a thermocycler. Settings were: 5 min at 95 °C and 1 h each at 65, 60, 55, 50, 45, and 40 °C. The oligodeoxynucleotides were designed to possess a G as 5′-protruding nucleotide. 10 pmol of reassociated oligodeoxynucleotide was end labeled by a fill-in reaction using a thermostable polymerase (Thermoprime, Dianova). In a volume of 20 μl, the buffer, 0.5 μl of enzyme, 50 μCi of [α32-P]dCTP, 1 μl of 25 mm MgCl2, and the oligodeoxynucleotide were incubated at 40 °C for 10 min, 45 °C for 10 min, and 50 °C for 20 min. The labeled oligodeoxynucleotide was purified by Sephadex G-50 chromatography (Nick columns, Amersham Pharmacia Biotech). Usually more than 50% of label was found to be incorporated into the oligodeoxynucleotide. Nuclear extracts were prepared according to the procedure by Schreiber et al. (34Schreiber E. Matthias P. Müller M.M. Schaffer W. Nucleic Acids Res. 1989; 17: 6419Crossref PubMed Scopus (3918) Google Scholar). In a total of 17 μl, 5 × incubation buffer (50 mm Tris-HCl, pH 7.5, 250 mm NaCl, 5 mm EDTA, 5 mmdithiothreitol, 25% glycerol), 1.5 μg of poly(dI-dC), various concentrations of competitor or antibody (anti-AP-2α antibody, Santa Cruz Biotechnology) when indicated, and 4 μl of cell extract were preincubated for 10 min at room temperature. After preincubation 3–4 μl of labeled oligodeoxynucleotide corresponding to 100 fmol was added and the incubation continued for another 20 min. Samples were loaded onto a 6% Tris-glycine polyacrylamide gel (5 × Tris-glycine: 250 mm Tris, 1.9 m glycine, 10 mm EDTA). After the electrophoresis (160 V) the gel was fixed in 10% acetic acid and 30% methanol for 30 min and dried. For Northern blotting and RT-PCR, total cellular RNA was isolated from 3 × 107 cells according to the TRIzol protocol (Life Technologies, Inc.). mRNA was extracted from 107 cells using the Quick Prep mRNA purification kit from Amersham Pharmacia Biotech. RT was done with Superscript Reverse Transcriptase from Life Technologies, Inc. using 10 μg of RNA as template and 1 pmol of gene-specific 3′-primer (AP-233) or 1 μg of oligo(dT12–18) in a reaction volume of 12 μl. The mixture was heated to 80 °C for 5 min and then allowed to cool to 42 °C. 4 μl of 5 × reaction buffer, 2 μl of 0.1m dithiothreitol, 1 μl of 10 mm dNTP mix, 1 μl of RNasin (25 units), and 1 μl of reverse transcriptase were added and the reaction incubated for 90 min at 42 °C. The reaction was stopped by adding 20 μl of 0.4 m NaOH. After 10 min at 42 °C 20 μl of 1 m Tris-HCl, pH 7.5, was added and the reverse transcriptase stocks frozen at −20 °C. Oligodeoxynucleotides used were as follows. AP233(for RT)5′­TCGAGGCGGGTGCAGAGTCG­3′AP23(for PCR)5′­CGGAATTCGGAGAGCCTCACTTTCTGTGC­3′AP25(for PCR)5′­CGGAATTCATGAAAATGCTTTGGAAATTGACG­3′AP2A5′5′­GGTCTAGACCAGAGGCAGAGCCAGGAGT­3′AP2A3′5′­CGCTCGAGTTCTTAATTACAGTTTGATCTGG­3′AP2B5′5′­GGTCTAGAGTGGGTTCGGAAGCCGGCTC­3′AP2B3′5′­CGCTCGAGTCATCATTAGAGAAGTCACC­3′AP2G5′5′­GGTCTAGAGCTGCCCTCGCACCACGGG­3′AP2G3′5′­CGCTCGAGCATGGAAATGGGACCTTTGCGA­3′ SEQUENCE III For PCR, 1 μl of reverse transcriptase stock was used and mixed with 2 μl of 10 mm dNTP, 5 μl of primers each (50 pmol of AP23 and AP25 for the AP-2α full-length clone, AP2A[B,G]5′ and AP2A[B,G]3′ for AP-2α[β,γ] subtype-specific PCR), 5 μl of 10 × buffer, 10 μl of 5 × optimizer buffer, 1 μl of CombiPol Polymerase (InViTek), and water to a total volume of 50 μl. Cycling conditions were a denaturation step at 94 °C, 2 min, 35 cycles with 94 °C, 45 s; 55 °C, 45 s; 72 °C, 90 s (45 s for subtype-specific PCR), and a final extension step for 10 min at 72 °C. Products were separated on a 1.2% agarose gel. The HeLa full-length product was cut out and purified. After digestion withEcoRI the fragment was cloned into the expression vector pSP(RSV) (a kind gift from Helen Hurst). The AP-2α full-length insert was sequenced and found to be identical to the published open reading frame. Likewise, one clone each of the AP-2 subtype-specific PCR products was cloned and verified by sequencing. Cells were incubated on ice with monoclonal anti-CD155 antibody D171 (35Nobis P. Zibirre R. Meyer G. Kühne J. Warnecke G. Koch G. J. Gen. Virol. 1985; 66: 2563-2569Crossref PubMed Scopus (62) Google Scholar) in a 96-well plate for 20 min in a total volume of 100 μl, washed twice with 100 μl of phosphate-buffered saline (1% fetal bovine serum), and incubated with R-phycoerythrin-labeled donkey anti-mouse IgG antibody (Dianova) for another 20 min. Cells were washed twice and then analyzed using a flow cytometer (Becton Dickinson). By transfecting several CD155-positive cell lines with reporter plasmids containing 5′ and 3′ serial deletions of CD155 upstream sequence, we have determined regions required for the expression of a reporter gene (31Solecki D. Schwarz S. Wimmer E. Lipp M. Bernhardt G. J. Biol. Chem. 1997; 272: 5579-5586Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). These experiments identified a 280-bp genomic DNA fragment that possessed full promoter activity when transfected into all cell lines that we have previously determined to express CD155 (BE-fragment, see Fig. 1 A). In Raji cells as well as in all other Burkitt's lymphoma (BL) cell lines tested, the endogenous CD155 locus is transcriptionally inactive (31Solecki D. Schwarz S. Wimmer E. Lipp M. Bernhardt G. J. Biol. Chem. 1997; 272: 5579-5586Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). When BE reporter constructs were transfected into Raji cells, only background levels of luciferase reporter gene activity were detected, an observation indicating that this cell line was unable to support the expression of the reporter gene (31Solecki D. Schwarz S. Wimmer E. Lipp M. Bernhardt G. J. Biol. Chem. 1997; 272: 5579-5586Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Therefore, it seemed likely that the BE core promoter fragment may harborcis-element(s) required for basic promoter activity which may also confer cell type-specific expression to the CD155gene. To identify portions of the BE core promoter fragment which would interact with nuclear proteins, we performed DNase I footprint analyses using the nuclear extracts of CD155-negative Raji cells and CD155-positive HeLa S3 cells (Fig. 2). The nuclear extracts of HeLa S3 cells produced three protected regions, designated FPI, FPII, and FPIII (for relative location, see Fig.1 A; for sequences of protected regions, see Fig.1 B). Interestingly, the protection in the FPIII region is absent when the footprint reactions were carried using Raji nuclear extracts. When nuclear extracts of other cell lines that express CD155 were examined, footprint patterns identical to that of HeLa S3 were observed (data no shown). More specifically, the FPIII binding activity was always detected when extracts from CD155-expressing cell lines were used in the footprint assays. The results of these experiments identify three regions of the CD155 core promoter which are bound by nuclear proteins and are therefore candidates to harbor potentialcis-acting elements. In addition, they suggest that one of the binding activities for the CD155 promoter is either not present or may be present in much reduced abundance in the extracts of cells such as Raji cells which do not express CD155. Computer searches were performed to determine which potential transcription factor binding motifs are located in the footprinted regions (see Fig. 1 B). Most notably, putative AP-2 binding motifs are scattered over all three protected regions. In addition, potential binding sites for PuF are found in FPII and FPIII, whereas FPII contains a potential NFκB site. FPII also contains an overlapping GC box adjacent to the AP-2 site (not shown). To address the functional significance and map precisely thecis-acting elements located in the FPI–FPIII regions of the BE promoter fragment, a series of linker scan mutations was generated throughout the protected sequences. Each mutant promoter construct contains 6 bp of wild type CD155 promoter sequence replaced by a SpeI restriction enzyme site within the context of the BE fragment (for locations, see Fig. 1 B). The panel of mutant promoter constructs was transfected into the HeLa, SK-N-MC (human neuroblastoma), and HTB15 (human glioblastoma) cell lines (Fig.3). Particular mutations within all three protected regions showed reduced promoter activity. Moreover, the activity profile of the constructs was similar for all three cell lines tested (see Fig. 3). These results indicate that each of the footprinted regions harbors functional cis-acting elements, and the activity patterns of the constructs suggest that the threecis-acting elements exert similar functions in the three CD155-expressing cell lines tested. Profound reductions in promoter activity were observed when mutations were located within a 13-bp segment of FPIII (see Figs. 1 Band 3). The III(5) and III(6) promoter constructs possessed promoter activities 4-fold lower than that of the wild type BE fragment. It should be noted that the III(6) linker replacement disrupts one of the major transcriptional start sites mapped by rapid amplification of cDNA ends in our previous work (31Solecki D. Schwarz S. Wimmer E. Lipp M. Bernhardt G. J. Biol. Chem. 1997; 272: 5579-5586Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). All three of these major transcriptional start sites bear homology to an initiator-like element (36Kraus R.J. Murray E.E. Wiley S.R. Zink N.M. Loritz K. Gelembiuk G.W. Mertz J.E. Nucleic Acids Res. 1996; 24: 1531-1539Crossref PubMed Scopus (59) Google Scholar). To test if the loss of promoter activity seen in the III(6) construct could be attributed to the initiator-like sequence, the CA core of all three potential initiator motif was changed to GC, a mutation that was previously shown to disrupt initiator activity (37Javahery R. Khachi A. Lo K. Zenzie-Gregory B. Smale S.T. Mol. Cell. Biol. 1994; 14: 116-127Crossref PubMed Scopus (597) Google Scholar). The activity of this promoter construct was equal to that of the BE promoter construct (data not shown). This result indicates that the III(5) and III(6) mutations do not elicit their loss in expression of the luciferase reporter gene by disruption of an initiator-like motif in the vicinity of the 5′ most transcriptional start site. Reductions of promoter activity were also observed with single linker replacements in FPII and FPI. The II(4) construct possessed an activity 55% that of wild type, whereas an activity of 60–80% of wild type was seen with the I(1) construct. The close proximity of FPI and FPII, and the II(4) and I(1) linker replacements, led us to speculate that these two cis-acting sequences may act together to contribute functionally toward CD155 promoter activity. To test whether there was an additive effect upon mutating both sites simultaneously a construct was cloned in which the region including both the II(4) and I(1) linker replacements were deleted. The ΔFPII/I construct possessed an activity approximately 40–45% that of the wild type BE promoter construct when transfected into the HeLa S3 and HTB15 cell lines (see Fig. 3). Taken together, these results indicate that FPI and FPII possess cis-acting sequences that contribute significantly toward CD155 promoter activity. These sequences may possibly contribute in an additive manner because deletion of both sites leads to a linear reduction in promoter activity. Footprinting and

Referência(s)