Proteasome Function Is Regulated by Cyclic AMP-dependent Protein Kinase through Phosphorylation of Rpt6
2007; Elsevier BV; Volume: 282; Issue: 31 Linguagem: Inglês
10.1074/jbc.m702439200
ISSN1083-351X
AutoresFengxue Zhang, Yong Hu, Ping Huang, Clifford A. Toleman, Andrew J. Paterson, Jeffrey E. Kudlow,
Tópico(s)Endoplasmic Reticulum Stress and Disease
ResumoDysregulation of the proteasome has been documented in a variety of human diseases such as Alzheimer, muscle atrophy, cataracts etc. Proteolytic activity of 26 S proteasome is ATP- and ubiquitin-dependent. O-GlcNAcylation of Rpt2, one of the AAA ATPases in the 19 S regulatory cap, shuts off the proteasome through the inhibition of ATPase activity. Thus, through control of the flux of glucose into O-GlcNAc, the function of the proteasome is coupled to glucose metabolism. In the present study we found another metabolic control of the proteasome via cAMP-dependent protein kinase (PKA). Contrary to O-Glc-NAcylation, PKA activated proteasomes both in vitro and in vivo in association with the phosphorylation at Ser120 of another AAA ATPase subunit, Rpt6. Mutation of Ser120 to Ala blocked proteasome function. The stimulatory effect of PKA and the phosphorylation of Rpt6 were reversible by protein phosphatase 1γ. Thus, hormones using the PKA system can also regulate proteasomes often in concert with glucose metabolism. This finding might lead to novel strategies for the treatment of proteasome-related diseases. Dysregulation of the proteasome has been documented in a variety of human diseases such as Alzheimer, muscle atrophy, cataracts etc. Proteolytic activity of 26 S proteasome is ATP- and ubiquitin-dependent. O-GlcNAcylation of Rpt2, one of the AAA ATPases in the 19 S regulatory cap, shuts off the proteasome through the inhibition of ATPase activity. Thus, through control of the flux of glucose into O-GlcNAc, the function of the proteasome is coupled to glucose metabolism. In the present study we found another metabolic control of the proteasome via cAMP-dependent protein kinase (PKA). Contrary to O-Glc-NAcylation, PKA activated proteasomes both in vitro and in vivo in association with the phosphorylation at Ser120 of another AAA ATPase subunit, Rpt6. Mutation of Ser120 to Ala blocked proteasome function. The stimulatory effect of PKA and the phosphorylation of Rpt6 were reversible by protein phosphatase 1γ. Thus, hormones using the PKA system can also regulate proteasomes often in concert with glucose metabolism. This finding might lead to novel strategies for the treatment of proteasome-related diseases. The proteome is in a dynamic state of synthesis and degradation. Although synthesis plays a role in controlling the concentration of many proteins, many other protein concentrations are controlled by the rate of degradation. Indeed controlling protein half-life by destruction has emerged as a major cellular regulatory mechanism. The destruction process is carried out by diverse proteases in the cell. The two major proteolytic pathways involve either the lysosomes or the ubiquitin-proteasome system. The proteasome is an abundant giant major cellular organelle with protease activities that degrades intracellular proteins in an ATP-dependent manner. Not only does it remove abnormal proteins that may be misfolded, aged, or damaged by oxidation, it also regulates the half-life of the short lived regulatory proteins such as cyclins involved in the control of cell cycle (1Hershko A. Cell Death Differ. 2005; 12: 1191-1197Crossref PubMed Scopus (278) Google Scholar, 2Sudakin V. Ganoth D. Dahan A. Heller H. Hershko J. Luca F.C. Ruderman J.V. Hershko A. Mol. Biol. Cell. 1995; 6: 185-197Crossref PubMed Scopus (643) Google Scholar, 3Richter-Ruoff B. Wolf D.H. FEBS Lett. 1993; 336: 34-36Crossref PubMed Scopus (49) Google Scholar) and transcription regulators like β-catenin (4Aberle H. Bauer A. Stappert J. Kispert A. Kemler R. EMBO J. 1997; 16: 3797-3804Crossref PubMed Scopus (2157) Google Scholar) and p53 (5Maki C.G. Huibregtse J.M. Howley P.M. Cancer Res. 1996; 56: 2649-2654PubMed Google Scholar). Malfunction of the proteasome has been documented in a variety of human diseases such as neurodegenerative disorders (6Bossy-Wetzel E. Schwarzenbacher R. Lipton S.A. Nat. Med. 2004; 10 (suppl.): S2-S9Crossref PubMed Scopus (633) Google Scholar, 7Ding Q. Keller J.N. J. Alzheimer's Dis. 2003; 5: 241-245Crossref PubMed Scopus (18) Google Scholar), cataracts (8Andersson M. Sjostrand J. Karlsson J. Exp. Eye Res. 1998; 67: 231-236Crossref PubMed Scopus (28) Google Scholar), and muscle atrophy (9Tawa Jr., N.E. Odessey R. Goldberg A.L. J. Clin. Investig. 1997; 100: 197-203Crossref PubMed Scopus (263) Google Scholar, 10Mitch W.E. Goldberg A.L. N. Engl. J. Med. 1996; 335: 1897-1905Crossref PubMed Scopus (1003) Google Scholar). The degradation process of proteins by the ubiquitin-proteasome system is divided into two steps: first, a specific recognition process using the ubiquitin conjugation cascade (11Hershko A. Ciechanover A. Annu. Rev. Biochem. 1998; 67: 425-479Crossref PubMed Scopus (6894) Google Scholar), and second, an indiscriminate destruction process mediated by the proteolytic activities in the proteasome core. The structure and function of the proteasome is fairly clear after extensive investigation (12Varshavsky A. Trends Biochem. Sci. 2005; 30: 283-286Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar). The intact 26 S proteasome is composed of a cylindrical 670-kDa 20 S core particle and two 19 S regulatory particles at each end of the core cylinder. The core particle is composed of 28 subunits, α and β in type, which are arranged in four stacked heptameric rings (α1–7β1–7β1–7α1–7). The aperture through which the protein substrates traverse is small enough that the protein substrates must be unfolded prior to their entry into the catalytic core. This core particle in the eukaryotic proteasome has three distinct catalytic activities: a chymotrypsin-like activity with preference for tyrosine or phenylalanine at the P1 position, a trypsin-like activity with preference for arginine or lysine at the P1 position, and a post-glutamyl hydrolyzing activity with a preference for glutamate or aspartate at the P1 position. These catalytic activities each require an N-terminal threonine residue on their respective β-subunit to act as a nucleophile to coordinately cleave long proteins (13Liu C.W. Corboy M.J. DeMartino G.N. Thomas P.J. Science. 2003; 299: 408-411Crossref PubMed Scopus (347) Google Scholar, 14Kierszenbaum A.L. Mol. Reprod. Dev. 2000; 57: 109-110Crossref PubMed Scopus (22) Google Scholar, 15Myung J. Kim K.B. Crews C.M. Med. Res. Rev. 2001; 21: 245-273Crossref PubMed Scopus (369) Google Scholar). The degradation of protein substrates requires the 19 S regulatory particle (PA700), which is 700 kDa in size and is composed of about 20 subunits. The 19 S particle binds to one or both ends of the 20 S core particle. By recognizing and unraveling the ubiquitin-conjugated substrates (16Navon A. Goldberg A.L. Mol. Cell. 2001; 8: 1339-1349Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar) and perhaps by controlling the opening of the core particle (17Kohler A. Cascio P. Leggett D.S. Woo K.M. Goldberg A.L. Finley D. Mol. Cell. 2001; 7: 1143-1152Abstract Full Text Full Text PDF PubMed Scopus (343) Google Scholar), the 19 S particle regulates the entry and degradation of the protein substrates in the proteolytic cavity of the core particle. The hexameric ring of the 19 S particle that contacts with the outer α ring of the core particle is composed of six ATPases, which belong to the AAA ATPase family. The six ATPases in the cap have been demonstrated to play important roles in the proteasome function but they are not functionally redundant and have to work coordinately (18Rubin D.M. Glickman M.H. Larsen C.N. Dhruvakumar S. Finley D. EMBO J. 1998; 17: 4909-4919Crossref PubMed Scopus (265) Google Scholar) to unfold the protein substrates and transport them into the proteolytic cavity of the 20 S core (16Navon A. Goldberg A.L. Mol. Cell. 2001; 8: 1339-1349Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar) where proteolysis occurs. Although the structure and function of the proteasome have been extensively investigated (12Varshavsky A. Trends Biochem. Sci. 2005; 30: 283-286Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar), the regulation of its activity remains elusive. The emphasis on regulation of proteolysis by the ubiquitin-proteasome system has been on substrate recognition through polyubiquitination. The proteasome was considered a passive machine that acted uniformly after the substrate proteins were identified. However, hints that the proteolytic activities of the proteasome itself might also be regulated have emerged. The proteasomal activity in muscle cells has been found to be stimulated during starvation (19Jagoe R.T. Goldberg A.L. Curr. Opin. Clin. Nutr. Metab. Care. 2001; 4: 183-190Crossref PubMed Scopus (329) Google Scholar). The posttranslational modification of the mammalian proteasome by O-GlcNAc 2The abbreviations used are: O-GlcNAc, O-linked N-acetylglucosamine; AMC, aminomethylcoumarin; FIU, fluorescence intensity unit; GFP, green fluorescent protein; GST, glutathione S-transferase; NE, nuclear extract; NRK, normal rat kidney; OGT, O-GlcNAc-transferase; PKA, cAMP-dependent protein kinase; PP1, protein phosphatase 1; Boc, t-butoxycarbonyl; Suc, succinyl; Z, benzyloxycarbonyl; LLnL, N-acetyl-l-leucinyl-l-leucinyl-l-norleucinal; DTT, dithiothreitol; LC, liquid chromatography. 2The abbreviations used are: O-GlcNAc, O-linked N-acetylglucosamine; AMC, aminomethylcoumarin; FIU, fluorescence intensity unit; GFP, green fluorescent protein; GST, glutathione S-transferase; NE, nuclear extract; NRK, normal rat kidney; OGT, O-GlcNAc-transferase; PKA, cAMP-dependent protein kinase; PP1, protein phosphatase 1; Boc, t-butoxycarbonyl; Suc, succinyl; Z, benzyloxycarbonyl; LLnL, N-acetyl-l-leucinyl-l-leucinyl-l-norleucinal; DTT, dithiothreitol; LC, liquid chromatography. can inhibit its proteolytic function (20Zhang F. Su K. Yang X. Bowe D.B. Paterson A.J. Kudlow J.E. Cell. 2003; 115: 715-725Abstract Full Text Full Text PDF PubMed Scopus (348) Google Scholar), suggesting that proteasome function is under metabolic control. Phosphorylation, another posttranslational modification, has also been recognized in both core and regulatory subunits of the proteasome (21Bose S. Stratford F.L. Broadfoot K.I. Mason G.G. Rivett A.J. Biochem. J. 2004; 378: 177-184Crossref PubMed Scopus (146) Google Scholar, 22Marambaud P. Wilk S. Checler F. J. Neurochem. 1996; 67: 2616-2619Crossref PubMed Scopus (38) Google Scholar, 23Bardag-Gorce F. Venkatesh R. Li J. French B.A. French S.W. Life Sci. 2004; 75: 585-597Crossref PubMed Scopus (42) Google Scholar). One function of phosphorylation in the core particle (21Bose S. Stratford F.L. Broadfoot K.I. Mason G.G. Rivett A.J. Biochem. J. 2004; 378: 177-184Crossref PubMed Scopus (146) Google Scholar) or some subunits in the 19 S regulatory particle (24Satoh K. Sasajima H. Nyoumura K.I. Yokosawa H. Sawada H. Biochemistry. 2001; 40: 314-319Crossref PubMed Scopus (115) Google Scholar) might be for the assembly of the intact 26 S proteasome. But the kinases responsible for other phosphorylation and the effect of phosphorylation on other proteasome functions are still unknown. There are indications that proteasome function can be stimulated in a cAMP-dependent manner. Peptidase activity could be elevated by treating osteoblast cells with parathyroid hormone, which functions through a cAMP-dependent mechanism (25Murray E.J. Bentley G.V. Grisanti M.S. Murray S.S. Exp. Cell Res. 1998; 242: 460-469Crossref PubMed Scopus (38) Google Scholar). Sp1 proteasome-dependent degradation was stimulated in normal rat kidney (NRK) cells by forskolin treatment (26Su K. Roos M.D. Yang X. Han I. Paterson A.J. Kudlow J.E. J. Biol. Chem. 1999; 274: 15194-15202Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 27Han I. Kudlow J.E. Mol. Cell. Biol. 1997; 17: 2550-2558Crossref PubMed Scopus (377) Google Scholar), which stimulates cAMP formation. Cyclic AMP-dependent protein kinase (PKA), which is the downstream serine/threonine kinase stimulated by cAMP, is involved in many cellular processes (28Krebs E.G. J. Am. Med. Assoc. 1989; 262: 1815-1818Crossref PubMed Scopus (87) Google Scholar) especially in energy metabolism (28Krebs E.G. J. Am. Med. Assoc. 1989; 262: 1815-1818Crossref PubMed Scopus (87) Google Scholar, 29Collins S. Surwit R.S. Recent Prog. Horm. Res. 2001; 56: 309-328Crossref PubMed Scopus (213) Google Scholar, 30Cohen P.T. J. Cell Sci. 2002; 115: 241-256Crossref PubMed Google Scholar). To more directly determine whether cAMP modulates proteasomal function through phosphorylation, we undertook these studies. We found that PKA can directly stimulate the chymotrypsin-like and trypsin-like activities of proteasomes so that a protein substrate, such as Sp1, can be degraded. Here evidence is presented that another AAA ATPase in the 19 S cap of the mammalian proteasome, Rpt6, is the in vivo target of PKA phosphorylation that results in proteasome stimulation. Mutation of the PKA phosphorylation site in Rpt6, Ser120 to Ala, blocked the proteasome function in vivo. Furthermore the stimulatory effect of PKA on the proteolytic activity of the proteasome and the phosphorylation of Rpt6 were reversible by protein phosphatase 1γ (PP1γ). The linkage of proteasomal function to metabolic regulators like PKA and the O-GlcNAc system underlines the role that proteasomes play in the metabolism in the cell and whole organism. Materials—Purified 26 S proteasome, proteasome substrate Z-GGL-AMC and proteasome inhibitor epoxomycin were purchased from Biomol (Plymouth Meeting, PA). 20 S proteasome was purchased from A. G. Scientific (San Diego, CA). PKA; monoclonal anti-GST antibody; proteasome inhibitors β-lactone, PSI, MG132, and LLnL; and proteasome substrates Suc-LLVY-AMC and Boc-LSTR-AMC were purchased from Sigma. PP1γ was purchased from Roche Applied Science and/or Calbiochem. [γ-32P]ATP was purchased from PerkinElmer Life Sciences. Anti-phosphoserine antibody (clone 4A9) was purchased from Calbiochem. Recombinant Rpt6 and Mutagenesis—The human Rpt6/Sug1 from human breast cancer cell line MDA 468 was cloned into pGEX and pcDNA 3.1 as described before (31Su K. Yang X. Roos M.D. Paterson A.J. Kudlow J.E. Biochem. J. 2000; 348: 281-289Crossref PubMed Scopus (60) Google Scholar). For point mutations, the pGEX-Rpt6 was modified by site-directed mutagenesis using a four-primer cassette strategy to introduce the substitution (mutated residues are underlined). PCR amplifications were performed with the following oligonucleotides (5′–3′): S120A, CGGGTGGCTCTAAGGAATGACGCCTACACTCTGCACAAGATCCTG; and S215A, GACTGTACCTTTATTCGTGTCGCTGGCTCTGAACTGGTACAG. Flanking oligonucleotides were: upstream, GAGCCAAAACCTCCGGAGGCTGCAGG; and downstream, CATTCTCGGAAGATGAACCTG. Products were separated by electrophoresis, extracted, and purified by the QIAquick extraction kit (Qiagen, Valencia, CA). Products were digested with NcoI and EcoRI, ligated into pGEX-Rpt6 at the same sites, and transformed into DH5α cells (Invitrogen). The point mutations were confirmed by sequencing. The mutants were then subcloned into pcDNA3.1. Affinity Purification—GST-tagged Sp1 recombinant protein was expressed in a vaccinia virus system and purified with glutathione beads (Amersham Biosciences) as described previously (20Zhang F. Su K. Yang X. Bowe D.B. Paterson A.J. Kudlow J.E. Cell. 2003; 115: 715-725Abstract Full Text Full Text PDF PubMed Scopus (348) Google Scholar, 26Su K. Roos M.D. Yang X. Han I. Paterson A.J. Kudlow J.E. J. Biol. Chem. 1999; 274: 15194-15202Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 31Su K. Yang X. Roos M.D. Paterson A.J. Kudlow J.E. Biochem. J. 2000; 348: 281-289Crossref PubMed Scopus (60) Google Scholar). Briefly the full-length human Sp1 cDNA (kindly provided by Dr. James Kadonaga) was subcloned into the pTM3GST vector, and a recombinant vaccinia virus containing GST-Sp1 (vGST-Sp1) was generated. Confluent BSC-40 cells that were maintained in Dulbecco's modified Eagle's medium with 10% newborn bovine serum were co-infected with recombinant vGST-Sp1 and vTF7-3 containing the T7 RNA polymerase coding sequence. After 24 h of incubation, the infected cells were harvested, and the whole cell lysate was prepared in lysis buffer containing 20 mm Tris (pH 7.5), 0.5 m NaCl, 0.5% Nonidet P-40, 1 mm MgCl2, 0.5 mm EDTA, 20% glycerol, 1 mm dithiothreitol (DTT), and 0.5 mm phenylmethylsulfonyl fluoride. GST-Sp1 was purified from lysates using glutathione-Sepharose beads (Amersham Biosciences) and eluted with glutathione elution buffer containing 50 mm Tris (pH 8.0), 150 mm NaCl, 30 mm reduced glutathione, 0.5 mm DTT, and 0.2 mm phenylmethylsulfonyl fluoride. GST fusion proteins (GST, GST-OGT, GST-Rpt6, GST-Rpt6S120A, GST-Rpt6S215A, and GST-Rpt6S120A/S215A) were expressed in Escherichia coli. O-GlcNAc-transferase (OGT), Rpt6, and its mutants were subcloned into pGEX. Protein expression was induced with 0.5 mm isopropyl 1-thio-β-d-galactopyranoside. The cells containing recombinant proteins were collected and resuspended in lysis buffer containing 50 mm Tris (pH 8.0), 150 mm NaCl, 5 mm EDTA, 1 mm DTT, 1 mm phenylmethylsulfonyl fluoride, and 4 mm benzamidine. 6.5 mg of lysozyme/200 ml of cell culture was added to the cell suspension. After incubation on ice for 10 min, Nonidet P-40 was added to a final concentration of 1%. The suspension was then sonicated and centrifuged. The supernatant was saved as the lysate. The GST fusion proteins were purified using glutathione-Sepharose beads and washed with the lysis buffer containing 1% Nonidet P-40. His-tagged proteins (His-Rpt6 and His-Rpt6S120A) were expressed in 293 cells. pcDNA3.1-Rpt6 or pcDNA3.1-Rpt6S120A plasmids were transfected into 80% confluent 293 cells, maintained in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, with Lipofectamine 2000 (Invitrogen). After incubation for 24 h, the transfected cells were harvested. The cell lysate was prepared in lysis buffer containing 20 mm Tris (pH 7.5), 500 mm NaCl, 5 mm imidazole, and 20% glycerol in the presence of 50 mm sodium fluoride and 10 mm sodium orthovanadate. The proteins in the lysate were denatured by adjusting the final concentration to 6 m urea. His-tagged proteins were isolated with His-Mag™ agarose beads (Novagen, Madison, WI) under denaturing conditions. The beads bearing the recombinant proteins were washed with washing buffer containing 20 mm Tris (pH 7.9), 500 mm NaCl, 60 mm imidazole, 50 mm sodium fluoride, and 10 mm sodium orthovanadate. 26 S proteasomes were isolated from 293 cell lysates using proteasome affinity agarose beads bearing ubiquitin-like sequence UbLHRB fused to GST provided in the proteasome isolation kit (Calbiochem) as instructed. Tissue Culture and Preparation of NRK Cell Nuclear Extract (NE)—NRK cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum, non-essential amino acids, and antibiotics. To test the effect of forskolin and H-89, 100 μm forskolin and/or 1 μm H-89 was added to the cells and incubated for 24 h before harvest. Nuclear extracts were then prepared as described previously (20Zhang F. Su K. Yang X. Bowe D.B. Paterson A.J. Kudlow J.E. Cell. 2003; 115: 715-725Abstract Full Text Full Text PDF PubMed Scopus (348) Google Scholar, 26Su K. Roos M.D. Yang X. Han I. Paterson A.J. Kudlow J.E. J. Biol. Chem. 1999; 274: 15194-15202Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 31Su K. Yang X. Roos M.D. Paterson A.J. Kudlow J.E. Biochem. J. 2000; 348: 281-289Crossref PubMed Scopus (60) Google Scholar). Proteasome Activity Assay in Vivo—293 Cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum and antibiotics. To measure the proteasome activity in vivo, a short degron, CL1 (ACKNWFSSLSHFVIHL) (32Gilon T. Chomsky O. Kulka R.G. EMBO J. 1998; 17: 2759-2766Crossref PubMed Scopus (177) Google Scholar), was fused to the C terminus of GFP. GFP-CL1 was used as a reporter of proteasome activity in the cell (20Zhang F. Su K. Yang X. Bowe D.B. Paterson A.J. Kudlow J.E. Cell. 2003; 115: 715-725Abstract Full Text Full Text PDF PubMed Scopus (348) Google Scholar, 33Bence N.F. Sampat R.M. Kopito R.R. Science. 2001; 292: 1552-1555Crossref PubMed Scopus (1821) Google Scholar). 1.6 μg each of pcDNA3.1-GFP or pcDNA3.1-GFP-CL1 was transfected into 293 cells in 12-well plates using Lipofectamine 2000 (Invitrogen). The cells were incubated at 37 °C for 24–30 h before harvest. To test the effect of forskolin and H-89, 100 μm forskolin and/or 5 μm H-89 was applied to the 293 cells in the presence of 50 μg/ml cycloheximide at the indicated times. The transfected cells were lysed with 900 μl of whole cell lysis buffer containing 50 mm Tris (pH 8.0), 20% glycerol, 500 mm NaCl, 5 mm MgCl2, 0.2 mm EDTA, 0.5% Nonidet P-40, 1 mm DTT, and 1 mm phenylmethylsulfonyl fluoride. The fluorescence intensity unit (FIU) (excitation, 460 nm; emission, 535 nm) was measured using a Turner Quantech digital filter fluorometer (Barnstead International, Dubuque, IA) and normalized to protein concentration. The untransfected 293 cell lysate was used for calibration. To test the effect of mutant Rpt6 on the degradation of GFP-CL1, Rpt6 or Rpt6S120A was cloned into pcDNA3.1. Each of these plasmids (1.2 μg) was cotransfected into 293 cells with 400 ng of pcDNA3.1-GFP-CL1 or pcDNA3.1-GFP using Lipofectamine 2000 (Invitrogen) in 12-well plates. The FIU was measured after 24–30 h of incubation and normalized to protein concentration. Proteasome Peptidase Assay in Vitro—To measure proteasome peptidase activity in the nuclear extract, A 100 μm concentration of one of the fluorogenic peptide substrates, Suc-LLVY-AMC, Boc-LSTR-AMC, or Z-GGL-AMC, was added to 10 μl of nuclear extract containing 10 μg of total cellular proteins and incubated at 37 °C for 90 min. The protein concentration of the nuclear extracts from different treatments was normalized to 1 μg/μl total cellular proteins. To measure the proteasome activity of the purified 26 S proteasome, the above fluorogenic peptide substrates were added to 30 μl of the proteasome activity assay buffer (50 mm Tris (pH 7.5), 5 mm MgCl2, 10% glycerol, 1 mm ATP, and 1 mm DTT) with 0.1 μg of purified 26 S proteasome and incubated at 37 °C for 90 min. The reactions were stopped with 900 μl of 1% SDS. The FIU (excitation, 360 nm; emission, 450 nm) was then measured using a Turner Quantech digital filter fluorometer (Barnstead International). To test the effect of PKA and PP1γ on proteasome activity, the nuclear extract or purified 26 S proteasome in 30 μl of the proteasome activity assay buffer was first treated with 5 units of PKA and/or 10 milliunits of PP1γ at 30 °C for 30 min. The fluorogenic peptide substrates were then added to the reaction and incubated at 37 °C for 90 min. The FIU was measured as above. The results are shown as percentage of untreated control as indicated. To test the effect of proteasome-specific inhibitors, nuclear extract or purified 26 S proteasome was pretreated with a 50 μm concentration of each inhibitor at 37 °C for 30 min before the fluorogenic peptide substrates were added to the reaction mixture. To test the effect of proteasome inhibitors on the PKA-stimulated peptidase activity, the inhibitors were added to the reaction mixture after the PKA treatment and incubated at 37 °C for 30 min before the addition of the fluorogenic peptide substrates. The incubation was continued at 37 °C for 90 min. To test the effect of PP1γ on the PKA-stimulated peptidase activity, PP1γ was added to the PKA-pretreated nuclear extract and incubated at 30 °C for another 30 min before the addition of peptide substrates. The FIU was measured as above. Sp1 Degradation Assay—The reconstituted Sp1 degradation was performed as described previously (26Su K. Roos M.D. Yang X. Han I. Paterson A.J. Kudlow J.E. J. Biol. Chem. 1999; 274: 15194-15202Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 27Han I. Kudlow J.E. Mol. Cell. Biol. 1997; 17: 2550-2558Crossref PubMed Scopus (377) Google Scholar). About 10–20 ng of GST-Sp1 was added to the NRK cell NE with a protein concentration of 1 μg/μl and incubated at room temperature for 45 min. The reaction was stopped by adding SDS sample buffer and boiling for 3 min. The samples were separated by SDS-PAGE. GST-Sp1 and GST-SpX fragments were revealed by anti-GST Western blot. To test the effect of PKA or PP1γ on the degradation of GST-Sp1, NRK cell nuclear extract was pretreated with 5 units of PKA or 10 milliunits of PP1γ at 30 °C for 30 min before GST-Sp1 was added to the reaction. To test the effect of proteasome-specific inhibitors on the PKA-stimulated Sp1 degradation, a 50 μm concentration of each inhibitor was added to the PKA-pretreated nuclear extract and incubated for 30 min before the addition of GST-Sp1. Labeling of Proteins with 32P—To label the proteasome, 5 μg of purified 26 S proteasome or 2 μg of 20 S proteasome was treated with 10 units of PKA together with 5 μCi of [γ-32P]ATP in the proteasome activity assay buffer in a total volume of 30 μl without ATP. After incubation at 30 °C for 45 min, the reaction samples were separated by SDS-PAGE. The gel was subjected to Coomassie Blue staining and autoradiography. The labeled bands were excised from the gel. Tandem mass spectrometry was performed on the isolated proteins as described below except that the samples were digested with trypsin. To determine the modification site of PKA in Rpt6, potential sites of modification, Ser120 and Ser215, were mutated from serine to alanine by site-directed mutagenesis. The recombinant proteins were expressed and purified as described above. The glutathione beads bearing GST-Rpt6, GST-Rpt6S120A, GST-Rpt6S215A, or GST-Rpt6S120A/S215A were treated with 5 units of PKA and 5 μCi of [γ-32P]ATP at 30 °C for 45 min. The GST beads were then spun down and boiled. The recombinant proteins were resolved with SDS-PAGE and subjected to Coomassie Blue staining and autoradiography. Tandem Mass Spectral Analysis—GST-Rpt6 was pretreated with PKA in the proteasome activity assay buffer as described above. Tandem mass spectral analyses were performed with a Q-Tof 2 mass spectrometer (Micromass, Manchester, UK) using electrospray ionization. Samples had undergone a 16-h chymotryptic digest at 37 °C. The resulting peptides were purified using ZipTips to concentrate and desalt the samples. The samples were then analyzed by LC-tandem mass spectrometry. Liquid chromatography was performed using an LC Packings Ultimate LC system, Switchos microcolumn switching unit, and Famos autosampler (LC Packings, San Francisco, CA). The samples were concentrated on a 300 -μm-inner diameter C18 precolumn at a flow rate of 10 μl/min with 0.1% formic acid and then flushed onto a 75-μm-inner diameter C18 column at 20 nl/min with a gradient of 5–100% acetonitrile (0.1% formic acid) in 30 min. The nano-LC interface was used to transfer the LC eluent into the mass spectrometer. The Q-Tof 2 mass spectrometer was operated in the automatic switching mode whereby multiply charged ions were subjected to tandem mass spectrometry if their intensities rose above six counts. The tandem mass spectra were processed with the MassLyx MaxEnt 3 software. Forskolin Stimulation of Proteasome Was Inhibited by H-89—The activation of PKA by forskolin (34Seamon K.B. Daly J.W. Adv. Cyclic Nucleotide Protein Phosphorylation Res. 1986; 20: 1-150PubMed Google Scholar, 35Seamon K.B. Daly J.W. J. Cyclic Nucleotide Res. 1981; 7: 201-224PubMed Google Scholar, 36Daly J.W. Padgett W. Seamon K.B. J. Neurochem. 1982; 38: 532-544Crossref PubMed Scopus (169) Google Scholar), which is produced by Coleus forskohlii and activates adenylate cyclase, in NRK cells is associated with two phenomena. First forskolin treatment dramatically reduces the O-GlcNAc levels on all proteins in these cells (37Chang Q. Su K. Baker J.R. Yang X. Paterson A.J. Kudlow J.E. J. Biol. Chem. 2000; 275: 21981-21987Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar). Because PKA phosphorylation of glutamine: fructose-6-phosphate transferase 1 inhibits its enzymatic activity (37Chang Q. Su K. Baker J.R. Yang X. Paterson A.J. Kudlow J.E. J. Biol. Chem. 2000; 275: 21981-21987Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 38Hu Y. Riesland L. Paterson A.J. Kudlow J.E. J. Biol. Chem. 2004; 279: 29988-29993Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar), halting the conversion of glucose into glucosamine, less UDP-GlcNAc substrate is made available to OGT. The second phenomenon is that forskolin stimulates proteasome-dependent degradation of the transcription factor Sp1 (26Su K. Roos M.D. Yang X. Han I. Paterson A.J. Kudlow J.E. J. Biol. Chem. 1999; 274: 15194-15202Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 27Han I. Kudlow J.E. Mol. Cell. Biol. 1997; 17: 2550-2558Crossref PubMed Scopus (377) Google Scholar) both in vitro and in vivo. Subsequently it was shown that the proteolytic activity of the 26 S proteasome is inhibited by O-GlcNAct modification and that the stability of Sp1 is related to the O-GlcNAc modification of the 19 S cap rather than to the O-GlcNAc modification of itself (20Zhang F. Su K. Yang X. Bowe D.B. Paterson A.J. Kudlow J.E. Cell. 2003; 115: 715-725Abstract Full Text Full Text PDF PubMed Scopus (348) Google Scholar). The initial thought was that the stimulation of proteasome function by forskolin occurs only through changes in O-GlcNAc modification of the 19 S cap of the 26 S proteasome. However, it remained possible that forskolin, by activating PKA, could directly activate the proteasome. To test this idea, NRK cells were treated with forskolin and PKA-specific inhibitor H-89. The proteolytic activity of the proteasome was measured with fluorogenic peptide substrates in NRK cell NEs. We have shown the nuclear extract to be
Referência(s)