Gene Expression Profile in Prion Protein-Deficient Fibroblasts in Culture
2000; Elsevier BV; Volume: 157; Issue: 1 Linguagem: Inglês
10.1016/s0002-9440(10)64517-8
ISSN1525-2191
AutoresJun-ichi Satoh, Yasuo Kuroda, Shigeru Katamine,
Tópico(s)Neurological diseases and metabolism
ResumoTo investigate the physiological function of the cellular isoform of prion protein (PrPC), the gene expression profile was studied by analyzing a cDNA expression array containing 597 clones of various functional classes in two distinct skin fibroblast cell lines designated SFK and SFH, established from PrP-deficient (PrP−/−) mice and PrP+/+ mice, respectively. The cells were incubated in the culture medium with or without inclusion of basic fibroblast growth factor (bFGF). When SFK cells were compared with SFH cells in untreated conditions, the expression of 15 genes, including those essential for cell proliferation and adhesion, was reduced, whereas the expression of 27 genes, including those involved in the insulin-like growth factor-I (IGF-I) signaling pathway, was elevated. Northern blot analysis verified a significant down-regulation of the receptor tyrosine kinase substrate Eps8, cyclin D1, and CD44 mRNAs, and a substantial up-regulation of phosphatidylinositol 3-kinase p85, IGF-I, and serine protease inhibitor-2.2 mRNAs in SFK cells. The patterns of induction or reduction of gene expression after exposure to bFGF showed considerable overlap between both cell types. Furthermore, both Eps8 and CD44 mRNA levels were reduced greatly in the brain tissues of the cerebrum isolated from the PrP−/− mice. These results indicate that the disruption of the PrP gene resulted in an aberrant regulation of a battery of genes important for cell proliferation, differentiation, and survival, including those located in the Ras and Rac signaling pathways. To investigate the physiological function of the cellular isoform of prion protein (PrPC), the gene expression profile was studied by analyzing a cDNA expression array containing 597 clones of various functional classes in two distinct skin fibroblast cell lines designated SFK and SFH, established from PrP-deficient (PrP−/−) mice and PrP+/+ mice, respectively. The cells were incubated in the culture medium with or without inclusion of basic fibroblast growth factor (bFGF). When SFK cells were compared with SFH cells in untreated conditions, the expression of 15 genes, including those essential for cell proliferation and adhesion, was reduced, whereas the expression of 27 genes, including those involved in the insulin-like growth factor-I (IGF-I) signaling pathway, was elevated. Northern blot analysis verified a significant down-regulation of the receptor tyrosine kinase substrate Eps8, cyclin D1, and CD44 mRNAs, and a substantial up-regulation of phosphatidylinositol 3-kinase p85, IGF-I, and serine protease inhibitor-2.2 mRNAs in SFK cells. The patterns of induction or reduction of gene expression after exposure to bFGF showed considerable overlap between both cell types. Furthermore, both Eps8 and CD44 mRNA levels were reduced greatly in the brain tissues of the cerebrum isolated from the PrP−/− mice. These results indicate that the disruption of the PrP gene resulted in an aberrant regulation of a battery of genes important for cell proliferation, differentiation, and survival, including those located in the Ras and Rac signaling pathways. Prion diseases are a group of neurodegenerative disorders affecting both animals and humans.1Prusiner SB Prions.Proc Natl Acad Sci USA. 1998; 95: 13363-13383Crossref PubMed Scopus (5052) Google Scholar The majority of these diseases are transmissible and characterized by intracerebral accumulation of an abnormal prion protein (PrPSc) that is identical in the amino acid sequence to the cellular isoform (PrPC) expressed on the cell surface and attached by a glycosylphosphatidylinositol anchor. The PrPSc protein differs biochemically from PrPC by its β-sheet-enriched structure, detergent insolubility, limited proteolysis by proteinase K, and slower turnover rate.1Prusiner SB Prions.Proc Natl Acad Sci USA. 1998; 95: 13363-13383Crossref PubMed Scopus (5052) Google Scholar It has been proposed that the conversion of PrPC into PrPSc is mediated by a homotypic interaction between endogenous PrPC and incoming or de novo generated PrPSc via an undefined post-translational process.1Prusiner SB Prions.Proc Natl Acad Sci USA. 1998; 95: 13363-13383Crossref PubMed Scopus (5052) Google Scholar The gene coding for the PrPC protein is expressed constitutively in a wide variety of neural and nonneural tissues at the highest level in neurons in the central nervous system (CNS), yet little is known about its biological functions.2Bendheim PE Brown HR Rudelli RD Scala LJ Goller NL Wen GY Kascsak RJ Cashman NR Bolton DC Nearly ubiquitous tissue distribution of the scrapie agent precursor protein.Neurology. 1992; 42: 149-156Crossref PubMed Google Scholar, 3Kretzschmar HA Prusiner SB Stowring LE DeArmond SJ Scrapie prion proteins are synthesized in neurons.Am J Pathol. 1986; 122: 1-5PubMed Google Scholar Recent studies indicate that the phylogenetically conserved octarepeat region of the PrPC protein has a capacity to bind copper, suggesting that PrPC plays a role in copper metabolism.4Brown DR Qin K Herms JW Madlung A Manson J Strome R Fraser PE Kruck T von Bohlen A Schulz-Schaeffer W Giese A Westaway D Kretzschmar H The cellular prion protein binds copper in vivo.Nature. 1997; 390: 684-687Crossref PubMed Scopus (37) Google Scholar, 5Viles JH Cohen FE Prusiner SB Goodin DB Wright PE Dyson HJ Copper binding to the prion protein: structural implications of four identical cooperative binding sites.Proc Natl Acad Sci USA. 1999; 96: 2042-2047Crossref PubMed Scopus (506) Google Scholar Recently, five independent groups have established lines of mice devoid of the PrPCprotein (PrP−/−), designated Zur, Npu, Ngsk, Rcm0, and Rikn, using different gene-targeting strategies.6Büeler H Fischer M Lang Y Bluethmann H Lipp H-P DeArmond SJ Prusiner SB Aguet M Weissmann C Normal development and behaviour of mice lacking the neuronal cell-surface PrP protein.Nature. 1992; 356: 577-582Crossref PubMed Scopus (1429) Google Scholar, 7Büeler H Aguzzi A Sailer A Greiner R-A Autenried P Aguet M Weissman C Mice devoid of PrP are resistant to scrapie.Cell. 1993; 73: 1339-1347Abstract Full Text PDF PubMed Scopus (1791) Google Scholar, 8Manson JC Clarke AR Hooper ML Aitchison L McConnell I Hope J 129/Ola mice carrying a null mutation in PrP that abolishes mRNA production are developmentally normal.Mol Neurobiol. 1994; 8: 121-127Crossref PubMed Scopus (491) Google Scholar, 9Sakaguchi S Katamine S Shigematsu K Nakatani A Moriuchi R Nishida N Kurokawa K Nakaoke R Sato H Jishage K Kuno J Noda T Miyamoto T Accumulation of proteinase K-resistant prion protein (PrP) is restricted by the expression level of normal PrP in mice inoculated with a mouse-adapted strain of the Creutzfeldt-Jakob disease agent.J Virol. 1995; 69: 7586-7592Crossref PubMed Google Scholar, 10Sakaguchi S Katamine S Nishida N Moriuchi R Shigematsu K Sugimoto T Nakatani A Kataoka Y Houtani T Shirabe S Okada H Hasegawa S Miyamoto T Noda T Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene.Nature. 1996; 380: 528-531Crossref PubMed Scopus (430) Google Scholar, 11Nishida N Tremblay P Sugimoto T Shigematsu K Shirabe S Petromilli C Erpel SP Nakaoke R Atarashi R Houtani T Torchia M Sakaguchi S DeArmond SJ Prusiner SB Katamine S A mouse prion protein transgene rescues mice deficient for the prion protein gene from Purkinje cell degeneration and demyelination.Lab Invest. 1999; 79: 689-697PubMed Google Scholar, 12Moore RC Lee IY Silverman GL Harrison PM Strome R Heinrich C Karunaratne A Pasternak SH Chishti MA Liang Y Mastrangelo P Wang K Smit AFA Katamine S Carlson GA Cohen FE Prusiner SB Melton DW Tremblay P Hood LE Westaway D Ataxia in prion protein (PrP)-deficient mice is associated with upregulation of the novel PrP-like protein doppel.J Mol Biol. 1999; 292: 797-817Crossref PubMed Scopus (472) Google Scholar, 13Kuwahara C Takeuchi AM Nishimura T Haraguchi K Kubosaki A Matsumoto Y Saeki K Matsumoto Y Yokoyama T Itohara S Onodera T Prions prevent neuronal cell-line death.Nature. 1999; 400: 225-226Crossref PubMed Scopus (372) Google Scholar The entire open reading frame of the PrP gene (Prnp) was replaced by selectable markers in Ngsk, Rcm0, and Rikn PrP−/− mice, whereas a part of the open reading frame remained intact in Zur and Npu PrP−/− mice. All of these mice exhibited normal early development and complete protection against scrapie infection, indicating that PrPC, a dispensable protein in embryonic development, is essential for inducing prion diseases.6Büeler H Fischer M Lang Y Bluethmann H Lipp H-P DeArmond SJ Prusiner SB Aguet M Weissmann C Normal development and behaviour of mice lacking the neuronal cell-surface PrP protein.Nature. 1992; 356: 577-582Crossref PubMed Scopus (1429) Google Scholar, 7Büeler H Aguzzi A Sailer A Greiner R-A Autenried P Aguet M Weissman C Mice devoid of PrP are resistant to scrapie.Cell. 1993; 73: 1339-1347Abstract Full Text PDF PubMed Scopus (1791) Google Scholar, 8Manson JC Clarke AR Hooper ML Aitchison L McConnell I Hope J 129/Ola mice carrying a null mutation in PrP that abolishes mRNA production are developmentally normal.Mol Neurobiol. 1994; 8: 121-127Crossref PubMed Scopus (491) Google Scholar, 9Sakaguchi S Katamine S Shigematsu K Nakatani A Moriuchi R Nishida N Kurokawa K Nakaoke R Sato H Jishage K Kuno J Noda T Miyamoto T Accumulation of proteinase K-resistant prion protein (PrP) is restricted by the expression level of normal PrP in mice inoculated with a mouse-adapted strain of the Creutzfeldt-Jakob disease agent.J Virol. 1995; 69: 7586-7592Crossref PubMed Google Scholar, 10Sakaguchi S Katamine S Nishida N Moriuchi R Shigematsu K Sugimoto T Nakatani A Kataoka Y Houtani T Shirabe S Okada H Hasegawa S Miyamoto T Noda T Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene.Nature. 1996; 380: 528-531Crossref PubMed Scopus (430) Google Scholar, 11Nishida N Tremblay P Sugimoto T Shigematsu K Shirabe S Petromilli C Erpel SP Nakaoke R Atarashi R Houtani T Torchia M Sakaguchi S DeArmond SJ Prusiner SB Katamine S A mouse prion protein transgene rescues mice deficient for the prion protein gene from Purkinje cell degeneration and demyelination.Lab Invest. 1999; 79: 689-697PubMed Google Scholar, 12Moore RC Lee IY Silverman GL Harrison PM Strome R Heinrich C Karunaratne A Pasternak SH Chishti MA Liang Y Mastrangelo P Wang K Smit AFA Katamine S Carlson GA Cohen FE Prusiner SB Melton DW Tremblay P Hood LE Westaway D Ataxia in prion protein (PrP)-deficient mice is associated with upregulation of the novel PrP-like protein doppel.J Mol Biol. 1999; 292: 797-817Crossref PubMed Scopus (472) Google Scholar Zur PrP−/− mice showed impairment in the GABAA receptor-mediated fast inhibition and long-term potentiation in hippocampal CA1 pyramidal neurons, suggesting that PrPC is necessary for normal synaptic function and plasticity in the hippocampus.14Collinge J Whittington MA Sidle KCL Smith CJ Palmer MS Clarke AR Jefferys JGR Prion protein is necessary for normal synaptic function.Nature. 1994; 370: 295-297Crossref PubMed Scopus (684) Google Scholar, 15Whittington MA Sidle KCL Gowland I Meads J Hill AF Palmer MS Jefferys JGR Collinge J Rescue of neurophysiological phenotype seen in PrP null mice by transgene encoding human prion protein.Nat Genet. 1995; 9: 197-201Crossref PubMed Scopus (138) Google Scholar However, some investigators were unable to confirm these observations.16Lledo P-M Tremblay P DeArmond SJ Prusiner SB Nicoll RA Mice deficient for prion protein exhibit normal neuronal excitability and synaptic transmission in the hippocampus.Proc Natl Acad Sci USA. 1996; 93: 2403-2407Crossref PubMed Scopus (190) Google Scholar Both Zur and Npu PrP−/− mice exhibited altered circadian activity rhythms and sleep patterns.17Tobler I Gaus SE Deboer T Achermann P Fischer M Rülicke T Moser M Oesch B McBride PA Manson JC Altered circadian activity rhythms and sleep in mice devoid of prion protein.Nature. 1996; 380: 639-642Crossref PubMed Scopus (563) Google Scholar Ngsk, Rcm0, and Rikn PrP−/− mice exhibited late-onset cerebellar ataxia due to an extensive loss of Purkinje cells in the cerebellum.10Sakaguchi S Katamine S Nishida N Moriuchi R Shigematsu K Sugimoto T Nakatani A Kataoka Y Houtani T Shirabe S Okada H Hasegawa S Miyamoto T Noda T Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene.Nature. 1996; 380: 528-531Crossref PubMed Scopus (430) Google Scholar, 11Nishida N Tremblay P Sugimoto T Shigematsu K Shirabe S Petromilli C Erpel SP Nakaoke R Atarashi R Houtani T Torchia M Sakaguchi S DeArmond SJ Prusiner SB Katamine S A mouse prion protein transgene rescues mice deficient for the prion protein gene from Purkinje cell degeneration and demyelination.Lab Invest. 1999; 79: 689-697PubMed Google Scholar, 12Moore RC Lee IY Silverman GL Harrison PM Strome R Heinrich C Karunaratne A Pasternak SH Chishti MA Liang Y Mastrangelo P Wang K Smit AFA Katamine S Carlson GA Cohen FE Prusiner SB Melton DW Tremblay P Hood LE Westaway D Ataxia in prion protein (PrP)-deficient mice is associated with upregulation of the novel PrP-like protein doppel.J Mol Biol. 1999; 292: 797-817Crossref PubMed Scopus (472) Google Scholar Furthermore, Ngsk PrP−/− mice showed a significant amount of demyelination in the spinal cord and peripheral nerves, although the pathophysiological basis for these abnormalities remains unclear.10Sakaguchi S Katamine S Nishida N Moriuchi R Shigematsu K Sugimoto T Nakatani A Kataoka Y Houtani T Shirabe S Okada H Hasegawa S Miyamoto T Noda T Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene.Nature. 1996; 380: 528-531Crossref PubMed Scopus (430) Google Scholar, 11Nishida N Tremblay P Sugimoto T Shigematsu K Shirabe S Petromilli C Erpel SP Nakaoke R Atarashi R Houtani T Torchia M Sakaguchi S DeArmond SJ Prusiner SB Katamine S A mouse prion protein transgene rescues mice deficient for the prion protein gene from Purkinje cell degeneration and demyelination.Lab Invest. 1999; 79: 689-697PubMed Google Scholar, 12Moore RC Lee IY Silverman GL Harrison PM Strome R Heinrich C Karunaratne A Pasternak SH Chishti MA Liang Y Mastrangelo P Wang K Smit AFA Katamine S Carlson GA Cohen FE Prusiner SB Melton DW Tremblay P Hood LE Westaway D Ataxia in prion protein (PrP)-deficient mice is associated with upregulation of the novel PrP-like protein doppel.J Mol Biol. 1999; 292: 797-817Crossref PubMed Scopus (472) Google Scholar The introduction of a wild-type PrP transgene rescued them from Purkinje cell degeneration and demyelination, indicating that PrPC is directly involved not only in the long-term survival of Purkinje neurons but also in the myelinating capacity of oligodendrocytes and Schwann cells.10Sakaguchi S Katamine S Nishida N Moriuchi R Shigematsu K Sugimoto T Nakatani A Kataoka Y Houtani T Shirabe S Okada H Hasegawa S Miyamoto T Noda T Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene.Nature. 1996; 380: 528-531Crossref PubMed Scopus (430) Google Scholar, 11Nishida N Tremblay P Sugimoto T Shigematsu K Shirabe S Petromilli C Erpel SP Nakaoke R Atarashi R Houtani T Torchia M Sakaguchi S DeArmond SJ Prusiner SB Katamine S A mouse prion protein transgene rescues mice deficient for the prion protein gene from Purkinje cell degeneration and demyelination.Lab Invest. 1999; 79: 689-697PubMed Google Scholar The cDNA array technology is a novel approach that allows monitoring of the expression pattern of a large number of genes systematically in a single hybridization, using cDNA probes prepared from different RNA sources on a matrix where a wide variety of cDNA fragments or oligonucleotides are arrayed and immobilized.18Nguyen C Rocha D Granjeaud S Baldit M Bernard K Naquet P Jordan BR Differential gene expression in the murine thymus assayed by quantitative hybridization of arrayed cDNA clones.Genomics. 1995; 29: 207-216Crossref PubMed Scopus (173) Google Scholar, 19Zhao N Hashida H Takahashi N Misumi Y Sakaki Y High-density cDNA filter analysis: a novel approach for large-scale, quantitative analysis of gene expression.Gene. 1995; 156: 207-213Crossref PubMed Scopus (105) Google Scholar Previously, using Western blot analysis, we showed that the constitutive and heat-inducible expression of heat shock proteins, HSP105, HSP72, HSC70, HSP60, and HSP25 was similar between two distinct fibroblast cell lines isolated from Ngsk PrP−/− mice and the control PrP+/+ mice, suggesting that the PrPC protein may not act as a cellular regulator during a heat shock response.20Satoh J-I Yukitake M Kurohara K Nishida N Katamine S Miyamoto T Kuroda Y Cultured skin fibroblasts isolated from mice devoid of the prion protein gene express major heat shock proteins in response to heat stress.Exp Neurol. 1998; 151: 105-115Crossref PubMed Scopus (12) Google Scholar In this study, the gene expression profile was studied in these cell lines by analyzing a cDNA expression array containing 597 clones of various functional classes to elucidate the physiological function of the PrPCprotein. The method for producing mice homozygous for a disrupted PrP gene (Ngsk PrP−/− mice) was previously described.9Sakaguchi S Katamine S Shigematsu K Nakatani A Moriuchi R Nishida N Kurokawa K Nakaoke R Sato H Jishage K Kuno J Noda T Miyamoto T Accumulation of proteinase K-resistant prion protein (PrP) is restricted by the expression level of normal PrP in mice inoculated with a mouse-adapted strain of the Creutzfeldt-Jakob disease agent.J Virol. 1995; 69: 7586-7592Crossref PubMed Google Scholar, 10Sakaguchi S Katamine S Nishida N Moriuchi R Shigematsu K Sugimoto T Nakatani A Kataoka Y Houtani T Shirabe S Okada H Hasegawa S Miyamoto T Noda T Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene.Nature. 1996; 380: 528-531Crossref PubMed Scopus (430) Google Scholar, 11Nishida N Tremblay P Sugimoto T Shigematsu K Shirabe S Petromilli C Erpel SP Nakaoke R Atarashi R Houtani T Torchia M Sakaguchi S DeArmond SJ Prusiner SB Katamine S A mouse prion protein transgene rescues mice deficient for the prion protein gene from Purkinje cell degeneration and demyelination.Lab Invest. 1999; 79: 689-697PubMed Google Scholar Three distinct fibroblast cell lines were established from abdominal skin explant cultures of the homozygous PrP−/− mice with a mixed 129/Sv × C57BL/6J background (SFK), the heterozygous PrP+/− mice (SFHT), and the control C57BL/6J PrP+/+ mice (SFH) at ages 35 to 50 weeks, as described previously.20Satoh J-I Yukitake M Kurohara K Nishida N Katamine S Miyamoto T Kuroda Y Cultured skin fibroblasts isolated from mice devoid of the prion protein gene express major heat shock proteins in response to heat stress.Exp Neurol. 1998; 151: 105-115Crossref PubMed Scopus (12) Google Scholar Both PrP−/− and PrP+/− mice were produced by intercross between F1 PrP+/− breeding pairs and their genotypes were determined by Southern blot analysis,9Sakaguchi S Katamine S Shigematsu K Nakatani A Moriuchi R Nishida N Kurokawa K Nakaoke R Sato H Jishage K Kuno J Noda T Miyamoto T Accumulation of proteinase K-resistant prion protein (PrP) is restricted by the expression level of normal PrP in mice inoculated with a mouse-adapted strain of the Creutzfeldt-Jakob disease agent.J Virol. 1995; 69: 7586-7592Crossref PubMed Google Scholar, 10Sakaguchi S Katamine S Nishida N Moriuchi R Shigematsu K Sugimoto T Nakatani A Kataoka Y Houtani T Shirabe S Okada H Hasegawa S Miyamoto T Noda T Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene.Nature. 1996; 380: 528-531Crossref PubMed Scopus (430) Google Scholar, 11Nishida N Tremblay P Sugimoto T Shigematsu K Shirabe S Petromilli C Erpel SP Nakaoke R Atarashi R Houtani T Torchia M Sakaguchi S DeArmond SJ Prusiner SB Katamine S A mouse prion protein transgene rescues mice deficient for the prion protein gene from Purkinje cell degeneration and demyelination.Lab Invest. 1999; 79: 689-697PubMed Google Scholar whereas PrP+/+ mice were obtained from Kyudo (Kumamoto, Japan). The cells were plated in 25-cm2 culture flasks at a density of 106 cells/flask and incubated at 37°C in a 5% CO2/95% air incubator in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml of penicillin, and 100 μg/ml of streptomycin (feeding medium). The passage of the cultures was performed biweekly. They were maintained for 4 months (SFK, SFH, and SFHT) or 7 months (SFK) before starting the experiments. After the cultures became subconfluent, the culture medium was replaced by a feeding medium containing 1% FBS instead of 10% FBS; this is the low serum concentration (LS) medium. After a 72-hour incubation in LS medium with or without inclusion of 50 ng/ml of recombinant human basic fibroblast growth factor (bFGF; Sigma, St. Louis, MO) for the final 24 hours, they were processed for RNA preparation. Total RNA was extracted from bFGF-treated SFK, SFH, and SFHT cells (SFK-B, SFH-B, and SFHT-B) and untreated SFK, SFH, and SFHT cells (SFK-C, SFH-C, and SFHT-C), or from the whole cerebral cortices isolated from the PrP−/−mice (CBRK) and from the PrP+/+ mice (CBRH), from which SFK or SFH cells have originated. Poly A+RNA was purified from total RNA pretreated with DNase I, using the oligotex-dT30 latex bead system (Takara, Tokyo, Japan). One microgram of poly A+ RNA was reverse-transcribed by incubating at 50°C for 20 minutes in 11 μl of a reaction mixture containing 50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L KCl, 3 mmol/L MgCl2, 500 μmol/L dCTP, 500 μmol/L dGTP, 500 μmol/L dTTP, 5 μmol/L dATP, 35 μCi of [α-32P]dATP, 5 mmol/L DTT, 50 units of Moloney murine leukemia virus (MMLV) reverse transcriptase, and the coding sequence primers at a final concentration of 1× using a commercial kit (Clontech, Palo Alto, CA) followed by purification through column chromatography. A set of filters containing 597 mouse cDNA clones of various functional classes immobilized as a spot of duplicate dots on a positively charged nylon membrane (Atlas Mouse cDNA Expression Array I, Clontech) were hybridized at 68°C overnight in the hybridization solution containing the 32P-labeled cDNA probes at a concentration of 1 × 106 cpm/ml, according to the methods described previously.21Satoh J-I Kuroda Y Differential gene expression between human neurons and neuronal progenitor cells in culture: an analysis of arrayed cDNA clones in NTera2 human embryonal carcinoma cell line as a model system.J Neurosci Methods. 2000; 94: 155-164Crossref PubMed Scopus (53) Google Scholar The membranes were exposed to Kodak BioMax MS X-ray films with the intensifying screen at −80°C for 24 hours. For rehybridization, the probes were stripped from the membranes by washing in boiled 0.5% sodium dodecyl sulfate solution for 15 minutes. Densitometric analysis was performed on an imaging system using NIH Image version 1.61 software. The signal intensities were standardized against those of a housekeeping gene, β-actin. For reverse transcription-polymerase chain reaction (RT-PCR) analysis, 5 μg of total RNA pretreated with DNase I was processed for cDNA synthesis using oligo(dT)12–18 primers and SuperScript II reverse transcriptase (Gibco BRL, Gaithersburg, MD). Fifty nanograms of cDNA were amplified by PCR using the specific sense and antisense primers listed in Table 1. For Northern blot analysis, 2 μg (SFK, SFH, and SFHT) or 6 μg (CBRK and CBRH) of total RNA was separated on a 1.5% agarose-6% formaldehyde gel, transferred onto nylon membranes, and immobilized by UV fixation as described previously.21Satoh J-I Kuroda Y Differential gene expression between human neurons and neuronal progenitor cells in culture: an analysis of arrayed cDNA clones in NTera2 human embryonal carcinoma cell line as a model system.J Neurosci Methods. 2000; 94: 155-164Crossref PubMed Scopus (53) Google Scholar, 22Satoh J-I Kurohara K Yukitake M Kuroda Y Constitutive and cytokine-inducible expression of prion protein gene in human neural cell lines.J Neuropathol Exp Neurol. 1998; 57: 131-139Crossref PubMed Scopus (34) Google Scholar The membranes were hybridized at 53°C overnight in the hybridization buffer containing a digoxigenin (DIG)-labeled DNA probe synthesized using a PCR DIG probe synthesis kit (Boehringer Mannheim, Mannheim, Germany) and the specific sense and antisense primers listed in Table 1. The membranes were further processed for rehybridization with the DIG-labeled DNA probe specific for the β-actin gene to normalize the reaction. The specific reaction was visualized using the DIG chemiluminescence detection kit (Boehringer Mannheim).Table 1Primer Sequences Used for PCR AmplificationPrimersSequenceProduct size (bp)Genbank accession no.Eps8 sense5′TGTCTAACCGCTCCAGTGGGTATG3′676L21671Eps8 antisense5′CTAACGTCCACCTGTGTGACAGTC3′cyclin D1 sense5′CGTACCCTGACACCAATCTCCTCA3′641S78355cyclin D1 antisense5′TGTGCGGTAGCAGGAGAGGAAGTT3′CD44 sense5′AATGTAACCTGCCGCTACGCAGGT3′475M27129CD44 antisense5′AGCCGCTGCTGACATCGTCATCTA3′PI3K p85 sense5′AGTGCAGAGGGCTACCAGTACAGA3′484M60651PI3K p85 antisense5′GTCGTAATTCTGCAGGGTTGCTGG3′IGF-I sense5′TCGTCTTCACACCTCTTCTACCTG3′369/421X04480IGF-I antisense5′GGTCTTGTTTCCTGCACTTCCTCT3′Spi-2.2 sense5′GAACTCCCCAAGTGTTGACGCTTC3′521M64086Spi-2.2 antisense5′GTGGACAAAGTGAGGAGATCCTGC3′PrP sense5′CATTTTGGCAACGACTGGGAGGAC3′551M13685PrP antisense5′GACTCCATCAAAGGGACCTGAAGC3′β-actin sense5′GAGCACAGCTTCTTTGCAGCTCCT3′255X03672β-actin antisense5′GGTCAGGATACCTCTCTTGCTCTG3′PI3K, phosphatidylinositol 3-kinase; IGF-I, insulin-like growth factor-I; Spi, serine protease inhibitor; PrP, prion protein. Open table in a new tab PI3K, phosphatidylinositol 3-kinase; IGF-I, insulin-like growth factor-I; Spi, serine protease inhibitor; PrP, prion protein. With RT-PCR analysis, the expression of PrP mRNA was undetectable in bFGF-treated and untreated SFK cells (SFK-B and SFK-C), whereas it was identified in SFH cells derived from the PrP+/+ mice under both culture conditions, SFH-B and SFH-C (Figure 1, lanes 2, 4, 6, and 8). In contrast, the expression of β-actin mRNA was observed in both SFK and SFH cells (Figure 1, lanes 10, 12, 14, and 16). No products were amplified in total RNA samples processed for PCR when the reverse transcription step was omitted, confirming that a contamination of genomic DNA was excluded (Figure 1, lanes 1, 3, 5, 7, 9, 11, 13, and 15). The cDNA expression array was analyzed by Southern blot hybridization with the 32P-labeled cDNA probes prepared from poly A+ RNA which was isolated from SFH-C, SFK-C, SFH-B or SFK-B cells, all of which were maintained for 4 months in vitro. Among the 597 cDNA clones, 42 genes exhibited a differential expression pattern between SFK-C and SFH-C cells (Figure 2, a and b, and Table 2). The expression of 15 genes including those essential for cell proliferation and adhesion, such as c-myc proto-oncogene, cyclin D1, the receptor tyrosine kinase substrate Eps8, CD44, and vascular cell adhesion molecule-1, was reduced in SFK-C cells compared to the levels in SFH-C cells (Table 2). In contrast, the expression of 27 genes including those involved in the insulin-like growth factor-I (IGF-I) signaling pathway, such as phosphatidylinositol 3-kinase (PI3K) p85, IGF-binding proteins (IGFBP) -3, -5, and -6, and IGF-I, was elevated in SFK-C cells compared to the levels in SFH-C cells (Table 2). Exposure to bFGF elevated the expression levels of 25 genes in SFH cells and 17 genes in SFK cells by up-regulating eight genes shared between both, such as 14-3-3η and the UV excision repair protein homologue MHR23B (Figure 2, a-d, and Table 2). Treatment with bFGF reduced the levels of expression of 15 genes in SFH cells and 22 genes in SFK cells by down-regulating 12 genes shared between both, such as cdk4/cdk6 inhibitor p18 and protein kinase C-θ (Figure 2, a-d, and Table 2).Table 2Genes Exhibiting a Differential Expression Pattern between SFK and SFH Cells in Analysis of 597 Arrayed cDNA ClonesGenes up-regulated or down-regulated in SFK-C cells compared to SFH-C cellsUp-regulation (27 clones)Down-regulation (15 clones)c-ErbA proto-oncogeneZO-1 tight junction proteinCot proto-oncogenec-myc proto-oncogenePDGF receptor αCyclin B1Golgi 4-transmembrane spanning transporter*Cyclin D1RNA-activating protein kinase inhibitor p58Thrombin receptor*Phosphatidylinositol 3-kinase p85Transferrin receptor protein p90Glutathione peroxidaseTranscription factor A10Microsomal glutathione S-transferaseMatrix metalloproteinase-11Mu 1 glutathione S-transferaseMHR23B UV excision repair protein homologuePi 1 glutathione S-transferaseActivating transcription factor 4Serine proteinase inhibitor SPI3*Eps8 receptor tyrosine kinase substrateAdipocyte differentiation-associated protein*CD44p45 NF-E2-related transcription factorVascular cell adhesion molecule-1Transcription factor S-IIIGF-binding protein-4Monocyte chemoattractant protein-3Ornithine decarboxylaseGrowth hormone receptorIntegrin β1IGF-binding protein-3IGF-binding protein-5IGF-binding protein-6*IGF-ITGF-β2Cathepsin BCathepsin D*Serine protease inhibitor-2.2Serine protease inhibitor-2.4Tissue inhibitor of metalloproteinase-3Genes Up-regulated or Down-regulated in SFH-B Cells Compared to SFH-C CellsUp-regulation (25 clones)Down-regulation (15 clones)c-myc proto-oncogeneCot proto-oncogeneNet transcription factorCdk4/cdk6 inhibitor p18Lfc proto-oncogeneProthymosin αCyclin B2Protein kinase C-θ*Cyclin D1*Phosphatidylinositol 3-kinase p85Etoposide-induced p53 responsive mRNAGlutathione reductase14-3-3ηHomeobox protein-2.1Microsomal glutathione S-transferaseHomeobox protein-8Gadd45C5A receptorSerine proteinase inhibitor SPI3Cannabinoid receptor 2PA6 stromal proteinP-selectinMHR23B UV excision repair protein homologueIGF-binding protein-1*Eps8 receptor tyrosine kinase substrateIGF-binding protein-5SRY-box containi
Referência(s)