Portal de Periódicos da CAPES

Characterization of Cyclin L1 and L2 Interactions with CDK11 and Splicing Factors

2008; Elsevier BV; Volume: 283; Issue: 12 Linguagem: Inglês

10.1074/jbc.m708188200

1083-351X

Pascal Loyer, Janeen H. Trembley, José Grenet, Adeline Busson, Anne Corlu, Wei Zhao, Mehmet Koçak, Vincent J. Kidd, Jill M. Lahti,

Cancer-related molecular mechanisms research

Although it has been reported that cyclin L1α and L2α proteins interact with CDK11p110, the nature of the cyclin L transcripts, the formation of complexes between the five cyclin L and the three CDK11 protein isoforms, and the influence of these complexes on splicing have not been thoroughly investigated. Here we report that cyclin L1 and L2 genes generate 14 mRNA variants encoding six cyclin L proteins, one of which has not been described previously. Using cyclin L gene-specific antibodies, we demonstrate expression of multiple endogenous cyclin L proteins in human cell lines and mouse tissues. Moreover, we characterize interactions between CDK11p110, mitosis-specific CDK11p58, and apoptosis-specific CDK11p46 with both cyclin Lα and -β proteins and the co-elution of these proteins following size exclusion chromatography. We further establish that CDK11p110 and associated cyclin Lα/β proteins localize to splicing factor compartments and nucleoplasm and interact with serine/arginine-rich proteins. Importantly, we also determine the effect of CDK11-cyclin L complexes on pre-mRNA splicing. Preincubation of nuclear extracts with purified cyclin Lα and -β isoforms depletes the extract of in vitro splicing activity. Ectopic expression of cyclin L1α, L1β, L2α, or L2β or active CDK11p110 individually enhances intracellular intron splicing activity, whereas expression of CDK11p58/p46 or kinase-dead CDK11p110represses splicing activity. Finally, we demonstrate that expression of cyclins Lα and -β and CDK11p110 strongly and differentially affects alternative splicing in vivo. Together, these data establish that CDK11p110 interacts physically and functionally with cyclin Lα and -β isoforms and SR proteins to regulate splicing. Although it has been reported that cyclin L1α and L2α proteins interact with CDK11p110, the nature of the cyclin L transcripts, the formation of complexes between the five cyclin L and the three CDK11 protein isoforms, and the influence of these complexes on splicing have not been thoroughly investigated. Here we report that cyclin L1 and L2 genes generate 14 mRNA variants encoding six cyclin L proteins, one of which has not been described previously. Using cyclin L gene-specific antibodies, we demonstrate expression of multiple endogenous cyclin L proteins in human cell lines and mouse tissues. Moreover, we characterize interactions between CDK11p110, mitosis-specific CDK11p58, and apoptosis-specific CDK11p46 with both cyclin Lα and -β proteins and the co-elution of these proteins following size exclusion chromatography. We further establish that CDK11p110 and associated cyclin Lα/β proteins localize to splicing factor compartments and nucleoplasm and interact with serine/arginine-rich proteins. Importantly, we also determine the effect of CDK11-cyclin L complexes on pre-mRNA splicing. Preincubation of nuclear extracts with purified cyclin Lα and -β isoforms depletes the extract of in vitro splicing activity. Ectopic expression of cyclin L1α, L1β, L2α, or L2β or active CDK11p110 individually enhances intracellular intron splicing activity, whereas expression of CDK11p58/p46 or kinase-dead CDK11p110represses splicing activity. Finally, we demonstrate that expression of cyclins Lα and -β and CDK11p110 strongly and differentially affects alternative splicing in vivo. Together, these data establish that CDK11p110 interacts physically and functionally with cyclin Lα and -β isoforms and SR proteins to regulate splicing. It has become apparent over the past decade that several cyclin-dependent kinases (CDKs) 4The abbreviations used are: CDKcyclin-dependent kinaseRNPS1RNA-binding protein with serine-rich domainCK2casein kinase IIHFFhuman foreskin fibroblastRTreverse transcriptionIPimmunoprecipitationIRESinternal ribosomal entry sitePHAphytohemagglutininGSTglutathione S-transferaseWTwild-typeNEnuclearextractPBCperipheralbloodcellHAhemagglutininmAbmonoclonal antibodypAbpolyclonal antibodyNi2+-NTAnickel-nitrilotriacetic acidPBSphosphate-buffered salinePCNAproliferating cell nuclear antigenSFCsplicing factor compartmentDNAsp-to-Asn mutationSRserine/arginine-rich. 4The abbreviations used are: CDKcyclin-dependent kinaseRNPS1RNA-binding protein with serine-rich domainCK2casein kinase IIHFFhuman foreskin fibroblastRTreverse transcriptionIPimmunoprecipitationIRESinternal ribosomal entry sitePHAphytohemagglutininGSTglutathione S-transferaseWTwild-typeNEnuclearextractPBCperipheralbloodcellHAhemagglutininmAbmonoclonal antibodypAbpolyclonal antibodyNi2+-NTAnickel-nitrilotriacetic acidPBSphosphate-buffered salinePCNAproliferating cell nuclear antigenSFCsplicing factor compartmentDNAsp-to-Asn mutationSRserine/arginine-rich. and their cyclin regulatory partners participate in regulating mRNA production (1Loyer P. Trembley J.H. Katona R. Kidd V.J. Lahti J.M. Cell. Signal. 2005; 17: 1033-1051Crossref PubMed Scopus (136) Google Scholar). Thus far, CDK7, CDK8, and CDK9 functions are ascribed to transcriptional initiation and elongation, and CDK12 (CrkRS) and CDK13 (CDC2L5) functions are related to pre-mRNA splicing (2Chen H.H. Wang Y.C. Fann M.J. Mol. Cell. Biol. 2006; 26: 2736-2745Crossref PubMed Scopus (107) Google Scholar–4Even Y. Durieux S. Escande M.L. Lozano J.C. Peaucellier G. Weil D. Geneviere A.M. J. Cell. Biochem. 2006; 99: 890-904Crossref PubMed Scopus (46) Google Scholar). Interestingly, CDK11p110 plays roles in both transcription and splicing, suggesting that this CDK may link the two processes (5Trembley J.H. Hu D. Hsu L.C. Yeung C.Y. Slaughter C. Lahti J.M. Kidd V.J. J. Biol. Chem. 2002; 277: 2589-2596Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 6Hu D. Mayeda A. Trembley J.H. Lahti J.M. Kidd V.J. J. Biol. Chem. 2003; 278: 8623-8629Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). In addition, the CDK11p110 partner proteins cyclins L1 and L2 also influence splicing (7Dickinson L.A. Edgar A.J. Ehley J. Gottesfeld J.M. J. Biol. Chem. 2002; 277: 25465-25473Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 8Yang L. Li N. Wang C. Yu Y. Yuan L. Zhang M. Cao X. J. Biol. Chem. 2004; 279: 11639-11648Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Two distinct genes, Cdc2L1 and Cdc2L2 (acronym for Cell division control 2 Like), encode the human p110 and p58 PITSLRE protein kinases (9Bunnell B.A. Heath L.S. Adams D.E. Lahti J.M. Kidd V.J. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 7467-7471Crossref PubMed Scopus (125) Google Scholar–12Trembley J.H. Loyer P. Hu D. Li T. Grenet J. Lahti J.M. Kidd V.J. Prog. Nucleic Acids Res. Mol. Biol. 2004; 77: 263-288Crossref PubMed Scopus (36) Google Scholar). These kinases were renamed CDK11p110 and CDK11p58 when cyclins L1 and L2 were identified as regulatory subunits of CDK11p110 (13Berke J.D. Sgambato V. Zhu P.P. Lavoie B. Vincent M. Krause M. Hyman S.E. Neuron. 2001; 32: 277-287Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Expression of the CDK11p110 isoforms is ubiquitous and constant throughout the cell cycle (11Xiang J. Lahti J.M. Grenet J. Easton J. Kidd V.J. J. Biol. Chem. 1994; 269: 15786-15794Abstract Full Text PDF PubMed Google Scholar). In contrast, CDK11p58 is expressed and functions specifically in G2/M via an internal ribosome entry site (IRES) located within the CDK11p110 mRNA (14Cornelis S. Bruynooghe Y. Denecker G. Van Huffel S. Tinton S. Beyaert R. Mol. Cell. 2000; 5: 597-605Abstract Full Text Full Text PDF PubMed Scopus (282) Google Scholar–17Hu D. Valentine M. Kidd V.J. Lahti J.M. J. Cell Sci. 2007; 120: 2424-2434Crossref PubMed Scopus (69) Google Scholar). During apoptosis, a third isoform, CDK11p46, is generated by caspase-dependent cleavage of CDK11p110 and CDK11p58, leaving the catalytic domain intact (18Beyaert R. Kidd V.J. Cornelis S. Van de Craen M. Denecker G. Lahti J.M. Gururajan R. Vandenabeele P. Fiers W. J. Biol. Chem. 1997; 272: 11694-11697Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 19Lahti J.M. Xiang J. Heath L.S. Campana D. Kidd V.J. Mol. Cell. Biol. 1995; 15: 1-11Crossref PubMed Scopus (191) Google Scholar). cyclin-dependent kinase RNA-binding protein with serine-rich domain casein kinase II human foreskin fibroblast reverse transcription immunoprecipitation internal ribosomal entry site phytohemagglutinin glutathione S-transferase wild-type nuclearextract peripheralbloodcell hemagglutinin monoclonal antibody polyclonal antibody nickel-nitrilotriacetic acid phosphate-buffered saline proliferating cell nuclear antigen splicing factor compartment Asp-to-Asn mutation serine/arginine-rich. cyclin-dependent kinase RNA-binding protein with serine-rich domain casein kinase II human foreskin fibroblast reverse transcription immunoprecipitation internal ribosomal entry site phytohemagglutinin glutathione S-transferase wild-type nuclearextract peripheralbloodcell hemagglutinin monoclonal antibody polyclonal antibody nickel-nitrilotriacetic acid phosphate-buffered saline proliferating cell nuclear antigen splicing factor compartment Asp-to-Asn mutation serine/arginine-rich. A role for CDK11p110 in transcription and pre-mRNA splicing is supported by data from both this and other laboratories. We have shown that soluble nuclear extracts contain two macromolecular CDK11p110 protein complexes of 1–2 MDa and ∼800 kDa. These complexes contain transcription-related proteins such as the largest subunit of RNA polymerase II, FACT (facilitates chromatin transcription), CK2, and general transcription factor IIF. We demonstrated the involvement of CDK11p110 in transcription more directly by showing that anti-CDK11p110 catalytic domain antibodies reduced RNA transcription from both TATA-like and GC-rich promoters in vitro (5Trembley J.H. Hu D. Hsu L.C. Yeung C.Y. Slaughter C. Lahti J.M. Kidd V.J. J. Biol. Chem. 2002; 277: 2589-2596Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Recently, CDK11p58, in association with cyclin D3, was reported to negatively affect androgen receptor transcriptional activity, whereas CDK11p110 positively affected transcription of numerous reporter genes (20Zong H. Chi Y. Wang Y. Yang Y. Zhang L. Chen H. Jiang J. Li Z. Hong Y. Wang H. Gu J. Mol. Cell. Biol. 2007; 27: 7125-7142Crossref PubMed Scopus (57) Google Scholar). Similarly, CDK11 was identified as a positive regulator of hedgehog signaling in both fly and vertebrate cells (21Nybakken K. Vokes S.A. Lin T-Y. McMahon A.P. Perrimon N. Nat. Genet. 2005; 37: 1323-1332Crossref PubMed Scopus (159) Google Scholar). We have also identified two splicing factors, RNPS1 (22Loyer P. Trembley J.H. Lahti J.M. Kidd V.J. J. Cell Sci. 1998; 111: 1495-1506Crossref PubMed Google Scholar) and 9G8 (6Hu D. Mayeda A. Trembley J.H. Lahti J.M. Kidd V.J. J. Biol. Chem. 2003; 278: 8623-8629Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar), as partners for CDK11p110. RNPS1 is an SR protein that functions as a general activator of splicing, promotes alternative splicing in a substrate-specific manner, and is a component of the exon-exon junction complex. RNPS1 co-immunoprecipitates with CDK11p110, and both RNPS1 and CDK11p110 are phosphorylated by CK2 (23Trembley J.H. Hu D. Slaughter C.A. Lahti J.M. Kidd V.J. J. Biol. Chem. 2003; 278: 2265-2270Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 24Trembley J.H. Tatsumi S. Sakashita E. Loyer P. Slaughter C.A. Suzuki H. Endo H. Kidd V.J. Mayeda A. Mol. Cell. Biol. 2005; 25: 1446-1457Crossref PubMed Scopus (40) Google Scholar). The general splicing factor 9G8, which also promotes the nucleocytoplasmic export of mRNA, co-immunoprecipitates with CDK11p110 and is a CDK11p110 substrate. A role for CDK11p110 in pre-mRNA splicing was confirmed using conventional in vitro splicing assays that showed that immunodepletion of the CDK11p110 kinase from nuclear extracts greatly reduced splicing activity (6Hu D. Mayeda A. Trembley J.H. Lahti J.M. Kidd V.J. J. Biol. Chem. 2003; 278: 8623-8629Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). The cyclin L1 (Ania-6a) gene is alternatively spliced to produce mRNAs encoding three putative proteins, cyclins L1α,-β, and -γ (13Berke J.D. Sgambato V. Zhu P.P. Lavoie B. Vincent M. Krause M. Hyman S.E. Neuron. 2001; 32: 277-287Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Cyclin L1α, the largest isoform, is an atypical 526-amino acid cyclin consisting of an N-terminal cyclin box and a C-terminal RS domain similar to that of SR proteins. Cyclin L1β, a 232-amino acid protein, contains the entire cyclin box but lacks the RS domain. Similarly, the 172-amino acid cyclin L1γ protein is a C-terminal truncated version of cyclin L1β. The cyclin L2 (Ania-6b) gene encodes two putative proteins, cyclins L2α and -β, that are structurally similar to cyclins L1α and L1β (13Berke J.D. Sgambato V. Zhu P.P. Lavoie B. Vincent M. Krause M. Hyman S.E. Neuron. 2001; 32: 277-287Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). The observation that cyclins L1α and L2α contain an RS domain and the finding that they both co-immunoprecipitate with CDK11p110 are consistent with a role for CDK11p110-cyclin L1/2α complexes in pre-mRNA splicing. This hypothesis is supported by the fact that cyclin L1α is an immobile component of the splicing factor compartment (25Herrmann A. Fleischer K. Czajkowska H. Muller-Newen G. Becker W. FASEB J. 2007; 21: 3142-3152Crossref PubMed Scopus (18) Google Scholar) that is also associated with hyperphosphorylated RNA polymerase II (13Berke J.D. Sgambato V. Zhu P.P. Lavoie B. Vincent M. Krause M. Hyman S.E. Neuron. 2001; 32: 277-287Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). In addition, de Graaf et al. (26de Graaf K. Hekerman P. Spelten O. Herrmann A. Packman L.C. Bussow K. Muller-Newen G. Becker W. J. Biol. Chem. 2004; 279: 4612-4624Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar) identified cyclin L2α as a substrate of DYRK1A, a dual specificity protein kinase that phosphorylates several transcription factors and induces SR protein redistribution. Other support for a functional role of CDK11p110-cyclin L complexes in splicing includes data from our group revealing that CDK11p110, cyclin L1α, and 9G8 form a ternary complex and that 9G8 is phosphorylated by CDK11p110 and data from others demonstrating that bacterially produced cyclins L1α and L2α stimulate splicing in an in vitro assay (7Dickinson L.A. Edgar A.J. Ehley J. Gottesfeld J.M. J. Biol. Chem. 2002; 277: 25465-25473Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 8Yang L. Li N. Wang C. Yu Y. Yuan L. Zhang M. Cao X. J. Biol. Chem. 2004; 279: 11639-11648Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Cell Culture, Transfection, and Retroviral Infection—HuH7, HEK 293T, HeLa, NB9, NB13, and human foreskin fibroblasts (HFFs) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and 2% l-glutamine. Histopaque-1077 (Sigma)-purified lymphocytes were cultured for 4 days from peripheral blood obtained from healthy donors in RPMI 1640 medium supplemented with 20% fetal bovine serum, 2% l-glutamine, and 2% phytohemagglutinin (PHA, M-form; catalog number 10576-015 Invitrogen). Recombinant Protein Production—His6-tagged cDNAs encoding full-length cyclins L1α, L1β, L2α, and L2β and His6-tagged cyclin L1α peptide (amino acids 314–369) were cloned into the pQE expression vector (Qiagen), expressed in M15[pREP4] bacteria, and purified using nickel-nitrilotriacetic acid (Ni2+-NTA) affinity under denaturing conditions according to the manufacturer's protocol (The QIAexpressionist™, Qiagen). Purified proteins were renatured by gradual elimination of denaturing agent, and beads were resuspended in in vitro splicing assay compatible buffer containing 20 mm Hepes-KOH (pH 8), 100 mm KCl, 0.2 mm EDTA, 0.5 mm dithiothreitol, 0.5 mm phenylmethanesulfonyl fluoride, and 20% glycerol. 9G8 was produced as described previously (6Hu D. Mayeda A. Trembley J.H. Lahti J.M. Kidd V.J. J. Biol. Chem. 2003; 278: 8623-8629Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar), and SF2/ASF was a gift from Dr. A. Mayeda (University of Miami, FL). GST-cyclin L2α (amino acids 307–379) was expressed in BL21 bacteria and purified using GSH-Sepharose™ 4B (Amersham Biosciences) using the manufacturer's protocol. Antibodies—The CDK11 antibodies P2N100 and P1C have been described previously (12Trembley J.H. Loyer P. Hu D. Li T. Grenet J. Lahti J.M. Kidd V.J. Prog. Nucleic Acids Res. Mol. Biol. 2004; 77: 263-288Crossref PubMed Scopus (36) Google Scholar, 24Trembley J.H. Tatsumi S. Sakashita E. Loyer P. Slaughter C.A. Suzuki H. Endo H. Kidd V.J. Mayeda A. Mol. Cell. Biol. 2005; 25: 1446-1457Crossref PubMed Scopus (40) Google Scholar). The cyclin L antibodies were produced by immunization of rabbits with purified His6-tagged full-length cyclin L1β (pan-L antibody), His6-tagged cyclin L1α peptide (cyclin L1α-specific antibody, amino acids 314–369), or GST-cyclin L2α peptide (cyclin L2α-specific antibody, amino acids 307–379). The antibodies were affinity-purified by column chromatography using the recombinant proteins described above. Antibodies recognizing HA tag (Roche Applied Science), FLAG tag (M2, Sigma), CK2α (C-18), SF2/ASF (P-15), 9G8 (H-120) (Santa Cruz Biotechnology), PCNA (PC10, Dako), and SR proteins (1H4, Zymed Laboratories Inc.) were used as described by the manufacturer. The anti-SR mAb 1H4 recognizes five proteins (SRp75, SRp55, SRp40, SRp30a/b, and SRp20) and several other bands that have not been fully characterized (27Neugebauer K.M. Roth M.B. Genes Dev. 1997; 11: 1148-1159Crossref PubMed Scopus (115) Google Scholar). Chromatography/Size Fractionation—Size fractionation analysis was carried out using a Superose 6 column (Amersham Biosciences). Protein standards of 737, 460, 170, 67, and 25 kDa were used to calibrate the column. Mouse liver was sonicated in 50 mm phosphate (pH 7), 150 mm NaCl, 0.2 mm EDTA, 0.1% Nonidet P-40, and 1× protease inhibitors (Complete EDTA-free, Roche Applied Science). Lysates were centrifuged twice at 14,000 rpm for 20 min. One mg of liver lysate or HeLaScribe® nuclear extract (Promega) was loaded onto the column, and 1-ml fractions were collected. Immunoblots, Immunoprecipitations, and Immunofluorescence—For immunoblot analysis, human cell lines and mouse tissues were washed in PBS and lysed by brief sonication as described previously (22Loyer P. Trembley J.H. Lahti J.M. Kidd V.J. J. Cell Sci. 1998; 111: 1495-1506Crossref PubMed Google Scholar). Lysates were centrifuged at 14,000 rpm for 20 min, and the protein concentration was determined. Immunoprecipitation (IP) of endogenous CDK11 protein kinases was performed using 293T and PBC cell lysates. IP of FLAG-tagged CDK11 and HA-tagged cyclin L proteins was performed using cell lysates of 293T cells harvested 48 h after transfection using JetPEI (Qbiogene). In all IP experiments, cell lysates were incubated overnight with antibodies (500 μg of lysate, 1 μg of antibody) and then incubated for 2 h with Gamma-Bind Plus-Sepharose (GE Healthcare) rotating at 4 °C. The beads were then washed four times with lysis buffer, and immunoblot analysis was performed as described previously (22Loyer P. Trembley J.H. Lahti J.M. Kidd V.J. J. Cell Sci. 1998; 111: 1495-1506Crossref PubMed Google Scholar). All immunofluorescence assays were performed using HFF cells grown on coverslips, fixed with cold methanol at -20 °C for 10 min, and rinsed with PBS. Expression of HA-tagged cyclin L proteins was accomplished using retroviruses encoding cyclin L proteins produced by transfection of the 293T Phoenix amphotropic cell line (ATCC) with pMSCV-HA-cyclin L-IRES-GFP vectors. The incubations with primary antibodies were performed for 1 h at 37 °C in PBS containing 0.1% casein. Anti-rabbit, anti-mouse, and anti-rat fluorescent secondary antibodies labeled with Alexa Fluor 488 (Molecular Probes) and Cy3 (Jackson ImmunoResearch) were used as described above. Pulldown Assays, Nuclear Extract Depletion, and in Vitro Splicing Assays—Pulldown assays for SR proteins and depletion experiments were performed by incubating 36 μg (3 μl) of HeLaScribe® nuclear extract adjusted to 15 μl with in vitro splicing assay compatible buffer with His6-cyclin L Ni2+-NTA beads (1 μg of protein/20 μl of beads) or control beads (20 μl) for 1 h on ice. The beads were extensively washed with the binding buffer prior to use for immunoblot analysis or splicing assays (22Loyer P. Trembley J.H. Lahti J.M. Kidd V.J. J. Cell Sci. 1998; 111: 1495-1506Crossref PubMed Google Scholar). For the splicing assays, 32P-labeled β-globin pre-mRNA substrate was prepared by in vitro transcription using SP6 RNA polymerase and linearized pSP64-HβΔE6 plasmid as the template (28Mayeda A. Krainer A.R. Methods Mol. Biol. 1999; 118: 315-321PubMed Google Scholar). In vitro splicing reactions were carried out in a final volume of 25 μl containing HeLaScribe® nuclear extract (36 μg/15 μl) and splicing assay mix (10 μl) containing 0.5 mm ATP, 20 mm creatine phosphate, 8 mm MgCl2, 200 mm Hepes-KOH (pH 7.3), 6.5% polyvinyl alcohol, and 20 fmol of 32P-labeled β-globin pre-mRNA substrate. Reactions were incubated at 30 °C for 4 h. The spliced RNA products were analyzed by autoradiography following electrophoresis on a 5.5% polyacrylamide, 7 m urea gel. In Vivo β-Galactosidase/Luciferase Splicing Assays—293T cells were transfected using FuGENE 6 (Roche Applied Science) as described by the manufacturer with the splicing reporter vector pTN24 (1 μg) (29Nasim M.T. Chowdhury H.M. Eperon I.C. Nucleic Acids Res. 2002; 30: e109Crossref PubMed Scopus (37) Google Scholar) and constructs expressing cyclin L (3 μg) and CDK11 (3 μg). The cyclin L constructs were subcloned into the pFlex vector with an N-terminal FLAG tag, and the CDK11 p110, p110ΔRE (deletion of amino acids 127–220), and p58 constructs were subcloned into the pUHD 10-3 vector with a C-terminal FLAG tag. The CDK11 p46 construct, containing a nuclear localization signal at the N terminus and a FLAG tag at the C terminus, was subcloned into the pTet-1 vector. The pTet-1 vector has a pcDNA 3.1 backbone with the tetracycline-responsive promoter replacing the cytomegalovirus promoter. Cells were harvested 24 h after transfection for the enzymatic assays. β-Galactosidase and luciferase activities were measured using the Dual-Light® Assay System (Applied Biosystems) (24Trembley J.H. Tatsumi S. Sakashita E. Loyer P. Slaughter C.A. Suzuki H. Endo H. Kidd V.J. Mayeda A. Mol. Cell. Biol. 2005; 25: 1446-1457Crossref PubMed Scopus (40) Google Scholar). 3–9 transfected samples were measured in quadruplicate per data point. Immunoblot analyses of equal volume cell lysates were performed. Statistical significance analyses for various pairwise comparisons were performed using a nonparametric rank-based test (see supplemental "Experimental Procedures" for an R-subroutine used in the analyses). E1A in Vivo Splicing Assays—HuH7 hepatoma cells in 60-mm dishes were co-transfected using transfectin (Bio-Rad) via the manufacturer's instructions with pCEP4-E1A (1.2 μg) (30Lai M.C. Kuo H.W. Chang W.C. Tarn W.Y. EMBO J. 2003; 22: 1359-1369Crossref PubMed Scopus (92) Google Scholar) (gift from Dr. Tarn W-Y, Institute of Biomedical Sciences, Taipei, Taiwan) and expression vectors (5 μg) for CDK11 p110 WT or DN (pMSCV-IRES-GFP) and HA-cyclin L isoforms (pcDNA 3.0). Total plasmid amount was equalized for each transfection using the appropriate empty vector. Cells were harvested 48 h after transfection, and total RNA was extracted using the RNeasy kit (Qiagen). The RNAs were further treated using the RNase-free DNase I kit (Qiagen). RT was performed using 5 μg of total RNAs, the SuperScript™ II RNase H- reverse transcriptase kit, and the E1A-specific primer CGGTATTCCACATTTGGACACT (P2). For detection of E1A splice variants, 2 μl of the RT reaction was used as template, and PCR amplification (Takara ExTaq, 50 μl, 35 cycles) was performed using primers CAAGCTTGAGTGCCAGCGAGTAG (P1) and CTCAGGTTCAGACACAGG (P3). PCR products were visualized via 1% agarose gels stained with ethidium bromide using Bio-Vision fluorescence image acquisition system (Vilber-Lourmat, Fisher-Bioblock, France) and quantitated using Bio-1D software (Vilber-Lourmat, Fisher-Bioblock). The percentage of each transcript signal relative to the total amount of the five splice forms was calculated for each sample and expressed relative to the appropriate control splice form percentages, which were set equal to 1. Cyclin L1 and L2 Genomic Organization, mRNA Splice Variants, and Translation Products—We identified nine distinct mRNA splice variants from the human cyclin L1 gene by RT-PCR in human tissues (supplemental Data 1) and HFF cells (data not shown). This gene, located on chromosome 3q23.2–3 (7Dickinson L.A. Edgar A.J. Ehley J. Gottesfeld J.M. J. Biol. Chem. 2002; 277: 25465-25473Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar), contains 14 exons and spans ∼12.3 kb. From these nine mRNAs, three distinct open frames were found encoding the three cyclin L1 protein isoforms, L1α, L1β, and L1γ. All of the cyclin L1 isoforms share a similar N-terminal sequence, encoded by exons 1–3, which contains the cyclin box domain and diverge in their C termini (2Chen H.H. Wang Y.C. Fann M.J. Mol. Cell. Biol. 2006; 26: 2736-2745Crossref PubMed Scopus (107) Google Scholar). The cyclin L1α protein exhibits an extended C terminus with an Arg/Ser (RS) di-peptide region characteristic of splicing factors, which is not present in the β or γ isoforms. Importantly, because of the location of the translational stop sequences, cyclin L1β and L1γ proteins contain 7 and 9 amino acid C-terminal peptides, respectively, which are specific for these two isoforms (Table 1). The human cyclin L2 gene spans ∼11.8 kb on chromosome 1 (1p36.33) (8Yang L. Li N. Wang C. Yu Y. Yuan L. Zhang M. Cao X. J. Biol. Chem. 2004; 279: 11639-11648Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 26de Graaf K. Hekerman P. Spelten O. Herrmann A. Packman L.C. Bussow K. Muller-Newen G. Becker W. J. Biol. Chem. 2004; 279: 4612-4624Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). This gene is comprised of 14 exons and encodes five distinct mRNA variants identified by RT-PCR in human tissues (supplemental Data 2) and HFF cells (data not shown). The products contain three distinct open reading frames. The largest isoform, cyclin L2α, is encoded by the shortest mRNA transcript, and the protein domain composition of L2α is identical to that of L1α. The cyclin L2βA and L2βB isoforms differ by only 2 and 12 amino acids, respectively, in their C-terminal ends (Table 1). The exon and intron lengths for the cyclin L1 and L2 genes are summarized in supplemental Table 1.TABLE 114 alternatively spliced mRNAs encode six cyclin L1 and L2 protein isoforms Alternative splicing of cyclin L1 and L2 genes generates 14 mRNAs that encode six proteins. The final coding exon and corresponding terminal amino acid sequence are indicated in the table with the length in amino acids of each protein isoform.14 mRNAs6 proteinsLast coding exonLengthL1αL1α14, –SRSGHGRHRR*aindicates the presence of a stop codon at that position526L1βL1βExon 7, VVHDGKS*aindicates the presence of a stop codon at that position232L1γ1–7L1γExon 4, SDQLHLPKPG*aindicates the presence of a stop codon at that position172L2αL2αExon 14, –DHPGHSRHRR*aindicates the presence of a stop codon at that position520L2βA1/2/3L2βAExon 6′, GK*aindicates the presence of a stop codon at that position226L2βBL2βBExon 7, DPLLKWDSWQRL*aindicates the presence of a stop codon at that position236*a indicates the presence of a stop codon at that position Open table in a new tab The detection of both cyclin L1 and L2 transcripts by RT-PCR in all human tissues (supplemental Data 1 and 2) and HFF cells tested suggests ubiquitous expression of these two genes. Similar data were obtained by Northern blot analyses of cyclin L1 and L2 gene expression in various human tissues and cell lines (supplemental Data 3). Furthermore, these analyses confirmed the expression of 2.3- and 4.5-kb cyclin L1 and L2 mRNA species in human cells as reported by others (7Dickinson L.A. Edgar A.J. Ehley J. Gottesfeld J.M. J. Biol. Chem. 2002; 277: 25465-25473Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 26de Graaf K. Hekerman P. Spelten O. Herrmann A. Packman L.C. Bussow K. Muller-Newen G. Becker W. J. Biol. Chem. 2004; 279: 4612-4624Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). Although the RT-PCR experiments are not quantitative, the relative abundance of the L1 and L2 splice variants detected differs slightly between tissues suggesting there are different levels of cyclin L isoform expression in the cell types tested. Cyclins L1α and L2α Are Nuclear Proteins That Co-localize with CDK11p110 Protein Kinase—To study expression of cyclin L proteins and investigate formation of complexes with CDK11 kinases in mammalian cells, we raised rabbit polyclonal anti-cyclin L antibodies recognizing various cyclin L isoforms. Independent immunizations were carried out using bacterial recombinant full-length cyclin L1β and two peptides corresponding to amino acids 314–369 for cyclin L1α and 307–379 for cyclin L2α. These two peptides, which are located in a short region connecting the cyclin box and RS domain, demonstrate very low homology between cyclins L1α and L2α and are absent in cyclins L1β/γ and L2β. To assess the specificity of these antibodies, immunoblot analyses were performed using cell extracts from 293T cells transfected with expression vectors encoding HA-tagged cyclin L proteins (Fig. 1A)