Portal de Periódicos da CAPES

DNA Aptamers Selected Against the HIV-1trans-Activation-responsive RNA Element Form RNA-DNA Kissing Complexes

1999; Elsevier BV; Volume: 274; Issue: 18 Linguagem: Inglês

10.1074/jbc.274.18.12730

1083-351X

Claudine Boiziau, Eric Dausse, Ludmila Yurchenko, Jean‐Jacques Toulmé,

RNA and protein synthesis mechanisms

In vitro selection was performed in a DNA library, made of oligonucleotides with a 30-nucleotide random sequence, to identify ligands of the human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element. Aptamers, extracted after 15 rounds of selection-amplification, either from a classical library of sequences or from virtual combinatorial libraries, displayed an imperfect stem-loop structure and presented a consensus motif 5′ACTCCCAT in the apical loop. The six central bases of the consensus were complementary to the TAR apical region, giving rise to the formation of RNA-DNA kissing complexes, without disrupting the secondary structure of TAR. The RNA-DNA kissing complex was a poor substrate for Escherichia coli RNase H, likely due to steric and conformational constraints of the DNA/RNA heteroduplex. 2′-O-Methyl derivatives of a selected aptamer were binders of lower efficiency than the parent aptamer in contrast to regular sense/antisense hybrids, indicating that the RNA/DNA loop-loop region adopted a non-canonical heteroduplex structure. These results, which allowed the identification of a new type of complex, DNA-RNA kissing complex, demonstrate the interest of in vitro selection for identifying non-antisense oligonucleotide ligands of RNA structures that are of potential value for artificially modulating gene expression. In vitro selection was performed in a DNA library, made of oligonucleotides with a 30-nucleotide random sequence, to identify ligands of the human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element. Aptamers, extracted after 15 rounds of selection-amplification, either from a classical library of sequences or from virtual combinatorial libraries, displayed an imperfect stem-loop structure and presented a consensus motif 5′ACTCCCAT in the apical loop. The six central bases of the consensus were complementary to the TAR apical region, giving rise to the formation of RNA-DNA kissing complexes, without disrupting the secondary structure of TAR. The RNA-DNA kissing complex was a poor substrate for Escherichia coli RNase H, likely due to steric and conformational constraints of the DNA/RNA heteroduplex. 2′-O-Methyl derivatives of a selected aptamer were binders of lower efficiency than the parent aptamer in contrast to regular sense/antisense hybrids, indicating that the RNA/DNA loop-loop region adopted a non-canonical heteroduplex structure. These results, which allowed the identification of a new type of complex, DNA-RNA kissing complex, demonstrate the interest of in vitro selection for identifying non-antisense oligonucleotide ligands of RNA structures that are of potential value for artificially modulating gene expression. In the antisense strategy, a DNA oligonucleotide is designed to hybridize to an RNA sequence, in order to inhibit specifically the reading of the encoded genetic information (1Hélène C. Toulmé J.J. Biochim. Biophys. Acta. 1990; 1049: 99-125Crossref PubMed Scopus (844) Google Scholar). Although RNA is a single chain nucleic acid, it adopts secondary and tertiary structures, which can prevent the hybridization of the antisense sequence. This is one of the likely explanations of the poor inhibition efficiency, if any, induced by some antisense oligonucleotides. The aptamer strategy has been successfully used for the selection of ligands against a large range of targets, such as proteins and small molecules (nucleotides, amino acids, dyes) (see Ref. 2Gold L. Polisky B. Uhlenbeck O. Yarus M. Annu. Rev. Biochem. 1995; 64: 763-797Crossref PubMed Scopus (739) Google Scholar for a review). This methodology offers an alternative way for designing nucleic acid ligands against an RNA structure. Indeed, we previously demonstrated that in vitroselection of DNA ligands (aptamers) against DNA secondary structures led to the identification of sequences able to recognize the DNA targets through base pair formation and additional unidentified interactions (3Mishra R.K. Le Tinévez R. Toulmé J.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10679-10684Crossref PubMed Scopus (23) Google Scholar, 4Boiziau C. Dausse E. Mishra R.M. Ducongé F. Toulmé J.J. Antisense Nucleic Acid Drug Dev. 1997; 7: 369-380Crossref PubMed Scopus (12) Google Scholar). This might be of high potential interest, as numerous RNA structures display a regulatory function through interaction either with proteins (such as the iron-responsive element interacting with the iron-responsive element-binding protein (5Stripecke R. Oliveira C.C. Mccarthy J.E.G. Hentze M.W. Mol. Cell. Biol. 1994; 14: 5898-5909Crossref PubMed Scopus (133) Google Scholar), the HIV trans-activation-responsive (TAR) 1The abbreviations used are: TAR, trans-activation-responsive; HIV, human immunodeficiency virus; nt, nucleotides; PCR, polymerase chain reaction; EMSA, electrophoretic mobility shift assay; DEPC, diethyl pyrocarbonate; FI, FII, FIII, and FIV, Family I, II, III, and IV, respectively1The abbreviations used are: TAR, trans-activation-responsive; HIV, human immunodeficiency virus; nt, nucleotides; PCR, polymerase chain reaction; EMSA, electrophoretic mobility shift assay; DEPC, diethyl pyrocarbonate; FI, FII, FIII, and FIV, Family I, II, III, and IV, respectivelyelement binding to the viral protein Tat (6Gait M.J. Karn J. Trends Biochem. Sci. 1993; 18: 255-259Abstract Full Text PDF PubMed Scopus (125) Google Scholar), or the HIV Rev-responsive element promoting the export of retroviral RNA from the nucleus due to the binding with the viral protein Rev (6Gait M.J. Karn J. Trends Biochem. Sci. 1993; 18: 255-259Abstract Full Text PDF PubMed Scopus (125) Google Scholar)) or with nucleic acids (like the dimerization-initiating sequence of HIV (7Paillart J.C. Marquet R. Skriptin E. Ehresmann C. Ehresmann B. Biochimie (Paris). 1996; 78: 639-653Crossref PubMed Scopus (117) Google Scholar)). The binding of an oligonucleotide to such structures could prevent the interaction of the RNA with the regulatory partner, hence controlling the expression of the target gene.We used the aptamer strategy to identify DNA ligands of the TAR RNA element; this RNA structure is a 59-nucleotide-long stem loop present at the 5′ end of HIV-1 RNA. TAR RNA mediates thetrans-activation of transcription through the binding (i) of the viral protein Tat to a three nucleotide bulge in the upper part of the stem (6Gait M.J. Karn J. Trends Biochem. Sci. 1993; 18: 255-259Abstract Full Text PDF PubMed Scopus (125) Google Scholar), and (ii) of cellular proteins to the upper region of the hairpin (8Gatignol A. Duarte M. Daviet L. Chang Y.N. Jeang K.T. Gene Expr. 1996; 5: 217-228PubMed Google Scholar). The resulting RNA-protein complex increases the processivity of the RNA polymerase, allowing the high yield synthesis of the full-length retroviral genome (9Graeble M.A. Churcher M.J. Lowe A.D. Gait M.J. Karn J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6184-6188Crossref PubMed Scopus (63) Google Scholar). We hypothesized that oligonucleotides able to bind to TAR with a high affinity might compete with the TAR-binding proteins, thus preventing the transcription process.A DNA library comprising more than 1012 different sequences was screened on the basis of oligonucleotide ability to bind to TAR. We identified DNA sequences (aptamers) displaying a binding constant of about 108m−1. In contrast to antisense oligonucleotides, the selected aptamers did not invade the TAR stem-loop structure but rather fitted to the existing RNA structure. The selected aptamers could fold into imperfect stem-loop structures, displaying a consensus sequence in the aptamer loop, complementary to TAR loop. Therefore, TAR-aptamer interactions give rise to so-called "kissing complexes," previously demonstrated to be involved in different natural RNA-RNA complexes (see Ref. 10Wagner E.G.H. Simons R.W. Annu. Rev. Microbiol. 1994; 48: 713-742Crossref PubMed Scopus (364) Google Scholar for a review). The binding properties of the DNA aptamers were analyzed as follows: we demonstrated that bases outside the loop play a key role in the binding to TAR, even though they do not directly interact with the RNA target. The upper part of the aptamer stem likely pre-organizes the loop to minimize the distortion required for loop-loop complex formation.MATERIALS AND METHODSLibraries of CandidatesOligonucleotidesFour DNA libraries were investigated each one having a random sequence of 30 nucleotides (nt), flanked by 18-nt-long conserved sequences used for PCR amplification. Families I, II, and III were obtained by in situ chemical (FI) or enzymatic (FII, FIII) ligation of so-called "half-candidates" from two different sub-libraries, 5′GCAGTCTCGTCGACACCC(N)15 and 5′P-(N)15GTGCTGGATCCGACGCAG (N represents any of the four natural nucleic acid bases). Family IV was 5′GCAGTCTCGTCGACACCC(N)30GTGCTGGATCCGACGCAG. Oligonucleotide primers were P1, 5′GCAGTCTCGTCGACACCC, and P2, 5′CTGCGTCGGATCCAGCAC.Chemical Ligation (FI)The mixture of half-candidates (100 pmol of each) was heated for 1 min at 80 °C and then cooled down in 5 min from 80 to 40 °C. 2 pmol of TAR in a final volume of 10 μl of 50 mm sodium cacodylate buffer, pH 7.0, containing 50 mm NaCl, 10 mm MgCl2 were then added to the candidates. A further linear decrease of temperature from 40 to 20 °C for 2 h, followed by a decrease from 20 to 4 °C at −1.5 °C/h, allowed the candidates to equilibrate in the presence of TAR. 10 μl of 400 mm imidazole, pH 7.0, 200 mm NiCl2, 100 mm BrCN were then added at 4 °C, and the ligation reaction was allowed to proceed for 24 h at 4 °C.Enzymatic Ligations (FII and FIII)The same TAR/candidate mixing and annealing conditions as above were used, except the buffer (50 mm Tris-HCl, pH 7.8, containing 10 mmMgCl2, 10 mm β-mercaptoethanol, and 1 mm ATP). At the end of the annealing step, the ligation was performed with 4 units of T4 RNA ligase, either for 10 h as the temperature decreased from 20 to 4 °C, and was then maintained at 4 °C for 14 h (Family II), or for 24 h at 4 °C (Family III). All reactions were stopped by freezing at −20 °C.2′-O-Methyl oligonucleotides were synthesized on a solid phase from base-protected 1-(2-O-methyl-3-O-(2-cyanoethoxy(diisopropylamino)-phosphino)-5-(4,4′-dimethoxytrityl)-β-d-nucleoside by using 1H-tetrazole as activator. TAR RNA was synthesized either enzymatically or chemically. 3′-Biotinylation was performed following the procedure described in Ref. 11von Ahsen U. Noller H.F. Science. 1995; 267: 234-237Crossref PubMed Scopus (96) Google Scholar.In Vitro Selection15 rounds of selection/amplification were performed with each family.Selection10–75 pmol of single-stranded PCR-amplified candidates were incubated for 2 h at 4 °C in the presence of 1 pmol of 3′ end-biotinylated TAR, in D buffer (10 mmTris-HCl, pH 7.5, 10 mm MgCl2, 50 mm NaCl, and 1 mm dithioerythritol), in a final volume of 20 μl. TAR candidates were captured by magnetic streptavidin-coated beads (Promega), and the bound candidates were then eluted with water.AmplificationDouble-stranded amplification was performed in 50 μl with 25% of the TAR-bound candidates as template and 50 pmol of each primer, using Taq polymerase (0.5 units from Promega). Single-stranded candidates were then produced from the previous reaction by 30 PCR cycles, using 100 pmol of P1. The single-stranded candidates were phenol-extracted, ethanol-precipitated, and used for the next selection round without any further treatment.CloningAfter the 15th round of selection, the candidates were further amplified with primers P1clon(5′AATTCCTGCAGTCTCGTCGACACCC) and P2clon(5′GCCGCTCTAGACTGCGTCGGATCCAGCAC) and cloned in pBluescript. Inserts were sequenced by the Sanger method, either with T7 sequencing kit (Amersham Pharmacia Biotech) or by automatic sequencing with dye terminators (Perkin-Elmer).Identification of Positive Clones, Electrophoretic Mobility Shift AssayTransfected bacteria were lysed by 5 min heating at 96 °C and then mixed with 50 pmol of each primer P1 and 5′-phosphorylated primer P2. After PCR amplification, single-stranded candidates were obtained by incubation for 2 h at 37 °C with 3 units of λ exonuclease (Life Technologies, Inc.) in a 67 mm glycine, NaOH buffer, pH 9.4, containing 2.5 mm MgCl2, in order to selectively remove the phosphorylated strand. Candidates were phenol-extracted, precipitated, and evaluated for TAR binding by electrophoretic mobility shift assay (EMSA); 50 nm32P-5′-end-labeled TAR were incubated with candidates in D buffer for 2 h at 4 °C. The mixture was then loaded on a 10% polyacrylamide gel containing 50 mm Tris acetate, pH 7.5, and 10 mm magnesium acetate, run at 4 °C for 18 h at 10 V/cm. For the subsequent analysis of chemically synthesized aptamers, the same procedure was used, except that the oligonucleotide of interest (5 nm) was labeled.FootprintsIn all experiments, 50 nm 5′-end-radiolabeled oligonucleotide (either TAR or the candidate) was preincubated for 20 min at 4 °C with 200 nm of the partner, in 8 μl (final volume) of the selection buffer. Radiolabeled TAR was then partially digested with either 2 ng of RNase A (Boehringer Mannheim) or 0.5 units of RNase T1 (Boehringer Mannheim) for 20 min at 4 °C. The 5′-end-radiolabeled DNA aptamer was digested by 200 units of S1 nuclease (Boehringer Mannheim) for 20 min at 4 °C. Diethyl pyrocarbonate (DEPC, 10%) reaction and potassium permanganate (KMnO4, 2 mm) modification were performed at 4 °C for 90 and 4 min, respectively. The DNA aptamer was then ethanol-precipitated and cleaved by 1 m piperidine, for 30 min at 90 °C. After DEPC modification, radiolabeled TAR was ethanol-precipitated, resuspended in 10 μl of Tris-HCl, 1m, pH 8. Following incubation for 30 min on ice in the dark with 10 μl of NaBH4 200 mm, it was ethanol-precipitated and cleaved with 1 m aniline acetate, pH 4.5, for 30 min at 60 °C in the dark.RNase H Assay50 nm32P-5′-end-labeled TAR were incubated for 3 h at 20 °C in 10 μl of D buffer in the presence of the desired aptamer (the concentration was adjusted to 50 times over the K d value at 4 °C) and of 1 unit ofEscherichia coli RNase H (Fermentas). The digested fragments were analyzed on a 20% polyacrylamide, 7 m urea gel.DISCUSSIONWe have selected aptamers against the HIV-1 TAR RNA element from DNA libraries containing candidates randomized at 30 positions. In order to take full advantage of the molecular diversity of such a population (>1018 different sequences) that surpasses by about 105 times the number of individuals that can be screened at a time in our in vitro selection experiment, we used a template-assisted combinatorial strategy for the first round of selection (15Huc I. Lehn J.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 2106-2110Crossref PubMed Scopus (411) Google Scholar). This approach relied on the spontaneous self-assembly on the surface of the target molecule, of short oligomers belonging to two different sub-libraries. The amplification by polymerase chain reaction (PCR) used to produce the second generation of candidates that will be screened at the next selection step requires a physical link between an oligomer from sub-library 1 and another one from sub-library 2. This link was provided by a ligation step prior to the PCR. Therefore, as any sub-library 1 sequence can potentially be combined to any sub-library 2 sequence, we can in principle explore the full diversity of this virtual library, i.e. 415 × 415 = 1018 entities. The general interest of such libraries over standard selection methods is discussed in detail in Ref. 15Huc I. Lehn J.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 2106-2110Crossref PubMed Scopus (411) Google Scholar. The ligation was ensured either chemically (FI) or enzymatically under two different conditions (FII and FIII), and the results of a 15-round selection with these three families were compared with that obtained with a conventional library with 30 random positions (FIV). The analysis of 76 clones belonging to the four families led to the identification of 20 sequences defining a single class of aptamers (class A) exhibiting affinity for TAR (the high background level is partly ascribed to the fact that the selection procedure was not stringent enough and that no counter selection step was introduced). The ligation step did not provide a clear benefit to the selection process. Indeed, winners (class A++ aptamers) were obtained from Families III and IV. At least four reasons might account for this outcome as follows. First, the template-assisted ligation of the candidates occurred only once at the first step of the process. Therefore, any further round will weaken the early potential enrichment of the library. Second, for our selected sequences, a limited number of residues actually contact the target: at most six bases engage direct interactions (hydrogen bonds) with the TAR RNA. Third, ligation occurred in the octameric consensus sequence, located in the loop-loop duplex, which can impede the enzyme or chemical reagent action. Finally, only combinations for which the 5′-phosphate group of one candidate is in contact with the 3′-OH end of another candidate can be ligated, thus restricting the selected sequences to a sub-class.In all families, the selected sequences showing binding ability for TAR displayed two important common features as follows: (i) a stem-loop structure and (ii) an octameric sequence in the loop, partly complementary to the TAR loop. We demonstrated that the TAR-aptamer complex involves loop-loop interactions, showing that kissing complexes constitute a valid recognition mode for RNA stem-loops by DNA sequences. Such interactions between two RNA stem-loops were previously extensively studied. It was demonstrated that kissing RNA complexes play a key role in the regulation of plasmid replication (16Tomizawa J.I. Cell. 1986; 47: 89-97Abstract Full Text PDF PubMed Scopus (103) Google Scholar) and in the dimerization of the retroviral genome (7Paillart J.C. Marquet R. Skriptin E. Ehresmann C. Ehresmann B. Biochimie (Paris). 1996; 78: 639-653Crossref PubMed Scopus (117) Google Scholar). But this is to our knowledge the first time that such a complex is described between DNA and RNA hairpins.The structure of the double-stranded region resulting from loop-loop interactions is unknown. Recent NMR studies have shown that kissing RNA hairpins form a quasi-continuous structure of three coaxially stacked helices (17Chang K.Y. Tinoco I. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8705-8709Crossref PubMed Scopus (93) Google Scholar, 18Marino J.P. Gregorian R.S.J. Csankovski G. Crothers D.M. Science. 1995; 268: 1448-1454Crossref PubMed Scopus (111) Google Scholar); the loop-loop helix is distorted compared with the A-form RNA and is bent toward the major groove. This reduces the distance between the two strands allowing a single phosphodiester bond to bridge the loops across the major groove. One such complex was formed between the HIV-1 TAR and TAR*, an RNA hairpin with a fully complementary loop (17Chang K.Y. Tinoco I. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8705-8709Crossref PubMed Scopus (93) Google Scholar). Our TAR-DNA aptamer kissing complexes can potentially involve six base pairs. This would require the disruption of the TAR C29–G36 base pair. Alternatively, only 5 base pairs can be formed, leaving an intact TAR stem (Fig. 3). TAR-DNA aptamer complexes will likely adopt a structure different from that of TAR-TAR*, as in the former case, loop-loop interactions will generate an RNA/DNA duplex flanked by double-stranded DNA (the aptamer stem) on one side and double-stranded RNA (the TAR stem) on the other side. RNA and DNA helices are A- and B-forms, respectively, whereas RNA/DNA hybrids adopt a different conformation for the two strands (19Fedoroff O.Y. Salazar M. Reid B.R. J. Mol. Biol. 1993; 233: 509-523Crossref PubMed Scopus (234) Google Scholar). This leads to substantially different groove widths and thus to different interstrand distances. Whereas the gap across the major groove is about 10 Å for a 6-base loop in the A-form geometry, it is about twice as large in the B-form geometry (20Haasnoot C.A.G. Hilbers C.W. Van der Marel G.A. Van Boom J.H. Singh U.C. Pattabiraman N. Kollman P.A. J. Biomol. Struct. & Dyn. 1986; 3: 843-855Crossref PubMed Scopus (152) Google Scholar). Stronger distortions and/or longer "connectors" will be required for the RNA/DNA than for the RNA-RNA kissing complex. Indeed, one or two bases (A32 of IV-04, C30 of TAR, and either C33 of IV-04 or C29 of TAR, see Fig. 3) are necessary to connect the stacked helices, in contrast to what has been previously described for the TAR-TAR* and the ColE1 complexes (17Chang K.Y. Tinoco I. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8705-8709Crossref PubMed Scopus (93) Google Scholar,18Marino J.P. Gregorian R.S.J. Csankovski G. Crothers D.M. Science. 1995; 268: 1448-1454Crossref PubMed Scopus (111) Google Scholar).The top of the stem of the aptamers seems to play a crucial role in the binding process. It is striking that the base pairs next to the loop are weak, A-T or G-T pairs (Fig. 2). Moreover, bulged bases or internal loops are frequently observed in the upper part of the stem. This suggests that a weak double-stranded structure in the vicinity of the binding loop was selected. Indeed, the removal of the bulged T41 in the aptamer IV-04 or the insertion of an A in the opposite strand, both modifications restoring perfect helicity in this region and consequently stabilizing the stem, led to a 25–40-fold increase in K d. The nature of the nucleic acid base was not important, as a non-nucleotide linker partly restored the affinity, indicating a structural role for this bulged residue. These imperfect structures are reminiscent of the kissing complexes formed by natural antisense RNAs involved in bacterial plasmid replication. In most of the cases where a single stem-loop is involved, the antisense RNA does not fold in a perfect hairpin structure. As demonstrated by Hjalt and Wagner (21Hjalt T.A.H. Wagner E.G.H. Nucleic Acids Res. 1995; 23: 580-587Crossref PubMed Scopus (72) Google Scholar), the deletion of the bulge and of the internal loop of the upper stem in CopA antisense RNA increased theK d of the kissing intermediate up to 14-fold, thus showing the structural role of these abnormalities in the helicity for kissing complexes. Therefore, secondary and tertiary structures in these regions are crucial for the proper presentation of the interacting loops in RNA-RNA as well as RNA-DNA loop-loop complexes.The E. coli ribonuclease H displayed a very low activity on the TAR RNA/IV-04 DNA hybrid (Fig. 7). Three explanations can be proposed as follows. (i) For the length of the heteroduplex, it was reported that heteroduplex as short as 4 base pairs are substrates for this enzyme (22Inoue H. Hayase Y. Imura A. Iwai S. Miura K. Ohtsuka E. Nucleic Acids Res. 1987; 15: 6131-6147Crossref PubMed Scopus (320) Google Scholar). Even though 6 bases of the IV-04 loop are complementary to the upper part of the TAR RNA element (including the last G residue next to the TAR loop), we do not know the actual number of paired bases. (ii) The formation of the kissing complex requires that the connecting residues between the 3′ ends of the loop-loop "helix" and either the TAR or the aptamer stems cross the grooves of the loop-loop region (18Marino J.P. Gregorian R.S.J. Csankovski G. Crothers D.M. Science. 1995; 268: 1448-1454Crossref PubMed Scopus (111) Google Scholar, 23Chang K.Y. Tinoco I. J. Mol. Biol. 1997; 269: 52-66Crossref PubMed Scopus (119) Google Scholar). These linkers might interfere with the RNase H binding and/or activity. Indeed, pseudo-half-knot antisense DNA-RNA hairpin complexes were reported to be cleaved with a reduced efficiency compared with a linear double-stranded RNA duplex, indicating that loop regions crossing either the major or the minor groove of the loop-loop helix interfered with RNase H (24Lima W.F. Mohan V. Crooke S.T. J. Biol. Chem. 1997; 272: 18191-18199Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). However, in both cases ("duplex length" and "limited access"), the IV-04 derivatives share the same loop region, i.e. form the same duplex region and have the same connector length. Therefore, we strongly favor the third parameter as the key determinant of low RNase H activity on RNA-aptamer complexes: (iii) the bent structure of the kissing complex. RNase H requires a nucleic acid region upstream (with respect to the RNA strand) from the cleaved region for binding, likely through electrostatic interactions (Fig.8 a) (25Morikawa K. Katayanagi K. Crouch R.J. Toulmé J.J. Crystal Structures of RNase H from Procaryotes, Ribonucleases H. Les Editions INSERM, Paris1998: 181-193Google Scholar). This means that, in IV-04·TAR complexes, the enzyme should interact with the aptamer stem in order, for the catalytic site, to be appropriately positioned on the loop-loop heteroduplex (Fig. 8 b). Therefore any distortion at the heteroduplex-aptamer stem junction will displace the catalytic site away from the substrate region. It is known that RNA-RNA hairpin complexes adopt a bent conformation in order to allow loop-loop interactions (18Marino J.P. Gregorian R.S.J. Csankovski G. Crothers D.M. Science. 1995; 268: 1448-1454Crossref PubMed Scopus (111) Google Scholar, 23Chang K.Y. Tinoco I. J. Mol. Biol. 1997; 269: 52-66Crossref PubMed Scopus (119) Google Scholar). A similar structure for aptamer-TAR complexes will preclude a good contact between the catalytic site and the loop-loop region once the enzyme is bound to the aptamer stem. The high efficiency of cleavage obtained with the short IV-0412derivative is in reasonable agreement with this hypothesis; in contrast to the bent rigid structure of TAR·IV-04 complex, the 3′ part of IV-0412 derivative will provide a flexible binding site for the enzyme compatible with catalytic site facing the TAR RNA hybridized loop (Fig. 8 c). When increasing the stem length, the complex is more stacked and constrained, hence more stable, but resulting in a worse substrate for RNase H. Different curvatures induced by different stems (for instance IV-0439(+A30) and IV-0439(−T41)) will generate various structures for the complexes that are sensed by RNase H, eventually leading to cuts outside the paired region (Fig. 8 d). Cleavages outside the RNA/DNA duplex were previously reported for regular (26Lima W.F. Crooke S.T. J. Biol. Chem. 1997; 272: 27513-27516Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 27Le Tinévez R. Mishra R.K. Toulmé J.J. Nucleic Acids Res. 1998; 26: 2273-2278Crossref PubMed Scopus (20) Google Scholar) and chemically modified duplexes (28Larrouy B. Boiziau C. Sproat B. Toulmé J.J. Nucleic Acids Res. 1995; 23: 3434-3440Crossref PubMed Scopus (40) Google Scholar, 29Toulmé J.J. Le Tinévez R. Brossalina E. Biochimie (Paris). 1996; 78: 663-673Crossref PubMed Scopus (24) Google Scholar).It is striking that a full-length (30-mer) antisense sequence corresponding to the random region of the library was not selected. This confirmed that antisense oligodeoxynucleotides are not good ligands for structured RNA regions. Indeed, it was demonstrated that anti-TAR DNA 17-mers, including a sequence complementary to the top part of the TAR element and which adopted a hairpin structure, had a poor affinity (30Ecker D.J. Vickers T.A. Bruice T.W. Freier S.M. Jenison R.D. Manoharan M. Zounes M. Science. 1992; 257: 958-961Crossref PubMed Scopus (86) Google Scholar); this oligomer was therefore not able to give rise to kissing complex formation.We selected DNA molecules that might inhibit TAR-dependent activation of transcription. It is expected that IV-04 will not directly interfere with the binding of Tat, as the binding sites of these two molecules on TAR are different. In contrast, the cellular proteins TRP 185 (31Wu F. Garcia J. Sigman D. Gaynor R. Genes Dev. 1991; 5: 2128-2140Crossref PubMed Scopus (114) Google Scholar), TRBP (32Gatignol A. Buckler-White A. Berkhout B. Jeang K.T. Science. 1991; 251: 1597-1600Crossref PubMed Scopus (327) Google Scholar), and the Tat·cyclin T·CDK9 complex (33Wei P. Garber M.E. Fang S.M. Fischer W.H. Jones K.A. Cell. 1998; 92: 451-462Abstract Full Text Full Text PDF PubMed Scopus (1041) Google Scholar) bind to TAR at the level of the loop. This could allow DNA aptamers to prevent the transcription activation controlled by these proteins. The competition between Tat or TRBP and the aptamers is presently under investigation. In the antisense strategy, a DNA oligonucleotide is designed to hybridize to an RNA sequence, in order to inhibit specifically the reading of the encoded genetic information (1Hélène C. Toulmé J.J. Biochim. Biophys. Acta. 1990; 1049: 99-125Crossref PubMed Scopus (844) Google Scholar). Although RNA is a single chain nucleic acid, it adopts secondary and tertiary structures, which can prevent the hybridization of the antisense sequence. This is one of the likely explanations of the poor inhibition efficiency, if any, induced by some antisense oligonucleotides. The aptamer strategy has been successfully used for the selection of ligands against a large range of targets, such as proteins and small molecules (nucleotides, amino acids, dyes) (see Ref. 2Gold L. Polisky B. Uhlenbeck O. Yarus M. Annu. Rev. Biochem. 1995; 64: 763-797Crossref PubMed Scopus (739) Google Scholar for a review). This methodology offers an alternative way for designing nucleic acid ligands against an RNA structure. Indeed, we previously demonstrated that in vitroselection of DNA ligands (aptamers) against DNA secondary structures led to the identification of sequences able to recognize the DNA targets through base pair formation and additional unidentified interactions (3Mishra R.K. Le Tinévez R. Toulmé J.J. Proc. Natl. Acad. Sci. U. S. A