Molecular Analysis and Characterization of Zebrafish Keratocan (zKera) Gene
2007; Elsevier BV; Volume: 283; Issue: 1 Linguagem: Inglês
10.1074/jbc.m707656200
ISSN1083-351X
AutoresLung‐Kun Yeh, Chia‐Yang Liu, C. L. Chien, Richard Converse, Winston W.‐Y. Kao, Muh‐Shy Chen, Fung‐Rong Hu, Fon‐Jou Hsieh, I‐Jong Wang,
Tópico(s)Collagen: Extraction and Characterization
ResumoCorneal small leucine-rich proteoglycans play a pivotal role in maintaining corneal transparency and function. In this study, we isolated and characterized the zebrafish (Danio rerio) keratocan (zKera) gene. The human keratocan sequence was used to search zebrafish homologues. The zKera full-length genomic DNA and cDNA were generated via PCR of zebrafish genomic DNA and reverse transcription-PCR of total zebrafish eye RNA, respectively. The zKera spanning 3.5 kilobase pairs consists of two exons and one intron and a TATA-less promoter. The zKera encodes 341 amino acids with 59% identity to its human counterpart and 57% identity to that of mouse keratocan. Like mouse and chick keratocan, zKera mRNA is selectively expressed in the adult cornea; however, during embryonic development, zKera mRNA is expressed in both the brain and the cornea. Interestingly, it is expressed mainly in corneal epithelium but also in the stroma. A pseudogene was proved by introducing a zKera promoter-driven enhanced green fluorescence protein reporter gene into fertilized zebrafish eggs. Using morpholino-antisense against zKera to knock down zKera resulted in a lethal phenotype due to massive caspase-dependent apoptosis, which was noted by a significant increase of active caspase-3 and caspase-8 in the developing forebrain area, including the eyes. This is different from mouse, for which keratocan-deficient mice are viable. Taken together, our data indicate that mammalian keratocan is conserved in zebrafish in terms of gene structure, expression pattern, and promoter function. Corneal small leucine-rich proteoglycans play a pivotal role in maintaining corneal transparency and function. In this study, we isolated and characterized the zebrafish (Danio rerio) keratocan (zKera) gene. The human keratocan sequence was used to search zebrafish homologues. The zKera full-length genomic DNA and cDNA were generated via PCR of zebrafish genomic DNA and reverse transcription-PCR of total zebrafish eye RNA, respectively. The zKera spanning 3.5 kilobase pairs consists of two exons and one intron and a TATA-less promoter. The zKera encodes 341 amino acids with 59% identity to its human counterpart and 57% identity to that of mouse keratocan. Like mouse and chick keratocan, zKera mRNA is selectively expressed in the adult cornea; however, during embryonic development, zKera mRNA is expressed in both the brain and the cornea. Interestingly, it is expressed mainly in corneal epithelium but also in the stroma. A pseudogene was proved by introducing a zKera promoter-driven enhanced green fluorescence protein reporter gene into fertilized zebrafish eggs. Using morpholino-antisense against zKera to knock down zKera resulted in a lethal phenotype due to massive caspase-dependent apoptosis, which was noted by a significant increase of active caspase-3 and caspase-8 in the developing forebrain area, including the eyes. This is different from mouse, for which keratocan-deficient mice are viable. Taken together, our data indicate that mammalian keratocan is conserved in zebrafish in terms of gene structure, expression pattern, and promoter function. Keratocan, lumican, and mimecan/osteoglycin are extracellular keratan sulfate proteoglycans (KSPGs) 4The abbreviations used are:KSPGkeratan sulfate proteoglycanSLRPsmall leucine repeat proteoglycanEGFPepidermal growth factorESTexpressed sequence tagRACErapid amplification of cDNA endshpfhours postfertilizationGFPgreen fluorescent proteinRTreverse transcriptionDIGdigoxigeninPBSphosphate-buffered salineCHAPS3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acidMOmorpholino-antisense oligonucleotidesRSrandom sequenceTUNELterminal deoxynucleotidyl transferase-mediated nick end-labelingAOacridine orangeaaamino acidKSkeratan sulfate belonging to the small leucine repeat proteoglycan (SLRP) family. These molecules fold into a horseshoe-shaped structure and bind to collagen molecules, facilitate formation of uniform collagen fibril diameters and interfibrillar spacing in extracellular matrix, modulate hydration of corneal stroma, and regulate corneal transparency (1Iozzo R.V. J. Biol. Chem. 1999; 274: 18843-18846Abstract Full Text Full Text PDF PubMed Scopus (577) Google Scholar, 2Ernst B. Hart G.W. Sinay P. Carbohydrates in Chemistry and Biology. 1st Ed. Wiley-VCH, Indianapolis, IN2000: 717-727Crossref Scopus (2) Google Scholar, 3Weinheim W. Chakravarti S. Exp. Eye Res. 2001; 73: 411-419Crossref PubMed Scopus (24) Google Scholar). Unlike lumican and mimecan, which are expressed in various tissues, keratocan gene expression is much more restricted to the cornea in adult mice (4Liu C.-Y. Shiraishi A. Kao C.W. Converse R.L. Funderburgh J.L. Corpuz L.M. Conrad G.W. Kao W.W.-Y. J. Biol. Chem. 1998; 273: 22584-22588Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). So far, only keratocan has been shown to be directly associated with an inherited human disease, cornea plana, that manifests itself via reduced visual acuity, a flattened corneal curvature, corneal parenchymal opacity, and a thin corneal stroma (5Pellegata N.S. Dieguez-Lucena J.L. Joensuu T. Lau S. Montgomery K.T. Krahe R. Kivela T. Kucherlapati R Forsius H. De la Chapelle A. Nat. Genet. 2000; 25: 91-95Crossref PubMed Scopus (124) Google Scholar). It has been shown that the similar phenotype of a flattened corneal curvature, as well as a thin corneal stroma, is present in keratocan knock-out mice (6Liu C.-Y. Birk D.E. Hassell J.R. Kane B. Kao W.W.-Y. J. Biol. Chem. 2003; 278: 21672-21677Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar), suggesting that this mouse line can serve as a model of corneal plana. keratan sulfate proteoglycan small leucine repeat proteoglycan epidermal growth factor expressed sequence tag rapid amplification of cDNA ends hours postfertilization green fluorescent protein reverse transcription digoxigenin phosphate-buffered saline 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid morpholino-antisense oligonucleotides random sequence terminal deoxynucleotidyl transferase-mediated nick end-labeling acridine orange amino acid keratan sulfate Zebrafish is a popular vertebrate model to study the biology and molecular genetics of development (7Udvadia A.J. Linney E. Dev. Biol. 2003; 256: 1-17Crossref PubMed Scopus (161) Google Scholar, 8Xu Y.-S. Kantorow M. Davis J. Piatigorsky J. J. Biol. Chem. 2000; 275: 24645-24652Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 9Soules K.A. Link B.A. BMC Dev. Biol. 2005; 5: 12-27Crossref PubMed Scopus (122) Google Scholar, 10Chen T.T. Vrolijk N.H. Lu J.K. Lin C.M. Reimschuessel R. Dunham R.A. Biotechnol. Annu. Rev. 1996; 2: 205-236Crossref PubMed Scopus (32) Google Scholar, 11Hackett P.B. Alvarez M.C. Milton Fingerman Recent Advances in Marine Biotechnology. 4. Springer-Verlag New York Inc., New York2000: 77-145Google Scholar). Transgenic technology is a powerful tool for studying gene functions via strategies of gain of function and/or dominant negative mutations. In the zebrafish model, tissue-specific promoters have been examined with enhanced green fluorescence protein (EGFP) reporter gene (7Udvadia A.J. Linney E. Dev. Biol. 2003; 256: 1-17Crossref PubMed Scopus (161) Google Scholar). In addition, the transgenic zebrafish model provides advantages (e.g. shorter embryonic development time) (72 h), and transparent embryos allow easy observation with an optical device and easier treatment schemes in comparison with transgenic mice. In eye research, zebrafish have been proven an excellent model system for retinal development, degeneration, and glaucoma study; however, few corneal studies have been undertaken (8Xu Y.-S. Kantorow M. Davis J. Piatigorsky J. J. Biol. Chem. 2000; 275: 24645-24652Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 9Soules K.A. Link B.A. BMC Dev. Biol. 2005; 5: 12-27Crossref PubMed Scopus (122) Google Scholar, 12Kennedy B.N. Vihtelic T.S. Checkley L. Vanghan K.T. Hyde D.R. J. Biol. Chem. 2001; 276: 14037-14043Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Zebrafish have transparent corneas, implying that KSPGs may also play a significant role in regulating corneal transparency in the zebrafish similar to what has been described in mammals. In this study, we take the first step toward the possibility of using zebrafish as a model system for corneal development and disease. The ultrastructure of zebrafish corneal tissue is studied by transmission electron microscopy. We also characterize the zebrafish Kera gene and its expression pattern in adults and during embryonic development. To investigate, the functionality of the zebrafish Kera promoter, we have employed 1.7- and 1.3-kb genomic DNA fragments 5′ of zKera to drive the EGFP reporter gene in zebrafish via transgenic approaches. Furthermore, keratocan gene knockdown via morpholino-antisense resulted in embryonic lethality, which can be attributed in part to a significant increase in the level of caspase-dependent apoptosis in the brain. The observation suggests that zKera may have a critical function(s) for normal zebrafish development other than serving as a regulatory molecule of extracellular matrix formation. Raising, maintaining, and spawning of adult zebrafish were performed as described in Ref. 13Westerfield M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish Danio rerio. University of Oregon Press, Eugene, OR1995Google Scholar. Adult zebrafish and embryos were maintained at 28.5 °C on a 14-h light and 10-h dark cycle. All procedures were approved by the Institutional Animal Care and Use Committee of National Taiwan University. Basic Local Alignment Search Tool (BLAST) analysis of the GenBank™ data base using the full-length human keratocan cDNA sequence identified a zebrafish expressed sequence tag clone encoding a putative protein sharing high sequence similarity with the human and mouse SLRP family proteins. A ∼3.5-kb NotI/MluI zebrafish genomic DNA fragment containing the 5′ portion of the zebrafish keratocan gene was amplified by PCR and subcloned into the pBluescript SK vector (Stratagene, La Jolla, CA). The complete nucleotide sequence of the insert was determined, using T3, T7, and walk-in primers, by the DNA core at the National Taiwan University College of Medicine. The 5′-end of zKera mRNA was amplified using the 5′-RACE System, version 2.0 (Invitrogen) according to the manufacturer's instructions. Briefly, one μg of total RNA from zebrafish eyes was reverse-transcribed with a keratocan-specific primer (5′-TGGAGTTGAGACATCAGGTGCTCA-3′) corresponding to a sequence in exon 2 of the zKera gene. The RNA templates were degraded by treatment with an RNase mix. A poly-dCTP tail was added to the 3′-end of the cDNAs with terminal deoxynucleotidyltransferase. Amplification of the cDNA was carried out with a second gene-specific primer (5′-TCATCAGAGTGGACTTG GCTG-3′) corresponding to sequence from the junction between exons 1 and 2 in conjunction with the abridged anchor primer (5′-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3′) provided by the manufacturer. The 34 cycles of PCR were performed at 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 3 min followed by a 10-min extension at 72 °C at the end of these cycles. The resulting PCR products were diluted 100-fold and used as template to be reamplified with a third gene-specific primer (5′-CACAAATGCTACCAAGAGTACCT-3′) in conjunction with the universal amplification primer (5′-CUACUACUACUAGGCCACGCGTCGACTAGTAC-3′). Finally, the PCR product was gel-purified, and the sequence was determined by dideoxy sequencing. The transcription initiation site of the zKera gene was determined by a sequence comparison between genomic DNA and the 5′-RACE product. Genomic DNA of 1.7 and 1.3 kb from the 5′-untranslated region of the zKera gene was amplified by specific PCR primers and inserted into the multiple cloning site of pEGFP-N1 (Clontech), respectively. The recombinant plasmid was propagated in Escherichia coli DH5α and purified by the Qiagen Plasmid Purification Maxi kit (Qiagen, Hilden, Germany). Purified plasmid DNA was adjusted to 50 ng/μl in distilled water and microinjected into one-cell-stage zebrafish embryos under a dissecting microscope. The living embryos with GFP expression were observed and imaged under fluorescence microscope. The sequence alignments were performed using the ClustalW program (available on the World Wide Web). Putative transcription factor binding sites were searched using the "TFSEARCH" program (available on the World Wide Web) with a default threshold score (of 90.0). The Cladogram was constructed using TreeView software. Total RNA extracted from eye, brain, heart, liver, gut, muscle, and fin by using TRIZOL® reagent (Invitrogen) was electrophoresed in 1.3% agarose containing 2 m formaldehyde buffered with Tris acetate-EDTA and blotted onto Magna-Charge™ membrane (Osmonics, Inc., Westborough, MA) and hybridized with 32P-labeled zebrafish keratocan cDNA in a hybridization solution containing 50% formamide at 42 °C overnight as previously described (4Liu C.-Y. Shiraishi A. Kao C.W. Converse R.L. Funderburgh J.L. Corpuz L.M. Conrad G.W. Kao W.W.-Y. J. Biol. Chem. 1998; 273: 22584-22588Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). The excess 32P-probe was removed by stringent washing three times with 0.1× SSC and 1% SDS at 65 °C for 30 min each. Hybridization signals were detected with a PhosphorImager (Amersham Biosciences). RT-PCR was performed as described previously with some modifications (14Liu C.-Y. Zhu G. Converse R. Kao C.W.-C. Nakamura H. Tseng S.C.G. Mui M.-M. Seyer J. Justice M.J. Stech M.E. Hansen G.M. Kao W.W.-Y. J. Biol. Chem. 1994; 269: 24627-24636Abstract Full Text PDF PubMed Google Scholar). Reagents used in this procedure, unless specified, were purchased from Promega (Madison, WI). The RevertAid™ H Minus First Strand cDNA synthesis kit was purchased from Fermentas (MBI Fermentas, Hanover, MD). The zebrafish cDNA was synthesized by using 40 μl of 5× reverse transcription buffer, 20 μl of 0.1 m dithiothreitol, 8 μl of 25 mm dNTPs, 10 μl of RNasin (40 units/μl), 10 μl of 50 mm random hexamer (Amersham Biosciences Inc.), 10 μl of avian myeloblastosis virus reverse transcriptase (9.5 units/μl), and 1 μg of heat-denatured corneal poly(A)+ RNA. Diethylpyrocarbonate-treated water was added to bring the final reaction volume to 200 μl, and the reaction was incubated at room temperature for 10 min, 42 °C for 90 min, 100 °C for 2 min, and 0 °C for 5 min. Each 20 μl of the above RT reactions was added to 80 μl of a PCR mixture containing the following: 8 μl of 10× PCR buffer without MgCl2, 8 μl of 25 mm MgCl2, 10 μl of 20 ng/μl primers, 0.5 μl of Taq polymerase (5 units/μl), and 45.5 μl of distilled H2O. The PCR was done by using 35 cycles of 94 °C for 1 min, 57 °C for 1 min, and 72 °C for 1 min, followed by a 15-min extension at 72 °C at the end of these cycles. Primers were CCGCTCGAGCGGCTGCCAACGTTTTCAAACAA (forward 5′-XhoI restriction site) and TCCCCGCGGGGAAGTTAGGTTTAACCTAAAGAATC (reverse 3′-SacII restriction site). The PCR product was confirmed by an appropriate restriction enzyme digestion and analyzed by electrophoresis through a 1.5% agarose gel. Sense and antisense digoxigenin (DIG)-labeled oligonucleotide probes were synthesized by Bio Basic Inc. The oligonucleotide sequence (5′-3′) was CTCATTACCATCGAGACGAAGGTAGCGGAGACGTGGACTCTTCTCCTCCAGGTGATCATC. The embryos were sorted at the stages required for the experiment and staged according to Kimmel et al. (15Kimmel C.B. Ballard W.W. Kimmel S.R. Ullmann B. Schilling T.F. Dev. Dyn. 1995; 203: 253-310Crossref PubMed Scopus (8862) Google Scholar). Chorions were removed by manually with Dumont Watchmaker's Forceps No. 5. The embryos were fixed in 4% paraformaldehyde in 1× PBS overnight at 4 °C, rinsed with PBS three times, transferred into 100% methanol (MeOH), and stored at -20 °C until use. The embryos raised to time points beyond 24 hpf were treated with 0.003% phenylthiourea to prevent melanization. Whole mount in situ hybridization was performed according to the manufacturer's instructions (Roche Applied Science) with some modifications. Briefly, they were treated with cold methanol and rehydrated through a descending methanol series in PBS. The samples were permeabilized by protease K treatment (25 μg/ml) for 25 min and hybridized with the appropriate probe at 65 °C, followed by incubation with an anti-DIG antibody conjugated with alkaline phosphatase and stained with substrate nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate to produce purple insoluble precipitates. Furthermore, paraffin sections (5 μm thick) of adult zebrafish eyes mounted on Superfrost Plus slides (Fisher) were deparaffinized and processed for in situ hybridization with sense (control) and antisense probes of zKera keratocan mRNA. To remove nonspecific binding, slides were subjected to a stringent wash with 0.5× SSC at 65 °C and treated with 20 μg/ml RNase (Sigma) at room temperature for 1 h, followed by washing with 0.2× SSC at 65 °C. The hybridization signals were visualized with anti-DIG antibody-alkaline phosphatase conjugates using procedures recommended by Roche Applied Science. Finally, the sections were counterstained with 0.5% neutral red and mounted. Images were obtained using an AxioCam digital camera (Zeiss) on a Stemi SV11 Apo (Zeiss) dissection microscope. Rabbit antiserum was prepared with a synthetic oligopeptide, CDNKGLKSIPVIPPYTWY, corresponding to the N-terminal amino acid residues deduced from zKera cDNA. The peptides were conjugated to keyhole limpet hemocyanin for antibody production in rabbits. The antisera were further purified through a peptide-conjugated Sulfolink gel column (Pierce) according to the manufacturer's instructions. Fractions containing purified anti-keratocan antibody were pooled and concentrated, and the protein concentration was measured by spectrophotometry at A280. Human corneal tissue and adult mouse corneal tissue were homogenized separately with 4 m guanidine HCl solution containing 10 mm sodium acetate, 10 mm sodium EDTA, 5 mm aminobenzamidine, and 0.1 m ϵ-amino-n-caproic acid. After it was dialyzed exhaustively overnight against distilled water, the insoluble pellet was dissolved in 6 m urea containing 0.1 m Tris acetate solution (pH 6.0), 0.1% CHAPS, and 0.15 m NaCl (Sigma). The immunoblot of proteins from the two corneal extracts were then probed with a rabbit polyclonal antibody (0.1 μg/ml) raised against human keratocan and mouse keratocan separately. Adult zebrafish eye tissue was homogenized with lysis buffer containing 200 mm HEPES/KOH (1 ml) (pH 7.5), 200 mm sucrose (0.86 g), 50 mm KCl (0.04 g), 2.5 mm MgCl2 (0.005 g), 100 mm dithiothreitol (100 μl) in a total 10-ml solution. To remove keratan sulfate chains, protein aliquots were incubated with 0.1 unit/ml endo-β-galactosidase (Sigma) and 1 unit/ml keratanase (Sigma) at 37 °C overnight. The immunoblot of proteins were then probed with a rabbit polyclonal antibody (0.1 μg/ml) raised against zebrafish keratocan or monoclonal anti-keratan sulfate antibody (Seikagaku, Tokyo, Japan). These immunocomplexes were visualized by adding alkaline phosphatase-conjugated secondary goat anti-rabbit IgG (1:2500; Novagen) and Western Blue® stabilized substrate (Promega, Madison, WI). Both zebrafish larvae and adult zebrafish corneal tissue fixed with 4% paraformaldehyde in PBS were used for immunohistochemical analysis of the keratocan protein. Deparaffinized sections (5 μm) of adult zebrafish corneal tissue were placed on slides and processed for immunohistochemistry. Before immunostaining, they were incubated with 0.1 unit/ml endo-β-galactosidase and 0.5 unit/ml keratanase at 37 °C overnight. After blocking with hydrogen peroxide for 30 min, the whole mount and corneal sections were incubated with the affinity-purified primary anti-keratocan antibody (0.1 μg/ml) or monoclonal anti-keratan sulfate antibody, washed in PBS, and then incubated with a biotinylated secondary antibody (goat anti-rabbit IgG). After washing in PBS, sections were incubated with streptavidin-horseradish peroxidase (DAKO Corp., Carpenteria, CA) and then washed in PBS and incubated with the 3′3-diaminobenzidine chromogen for 5-10 min. Negative controls were obtained by omitting the primary antibody. For transmission electron microscopy, the adult fish corneal tissues were fixed in 50 mm phosphate buffer (pH 7.2) containing 2.5% glutaraldehyde and 2% paraformaldehyde for 24 h at room temperature. After refixation in 1% osmium tetraoxide for 4 h at room temperature, the samples were washed in phosphate buffer, dehydrated, and embedded in Epon 812 epoxy resin. Ultrathin 50-nm sections were collected on 75-mesh copper grids and stained with uranyl acetate and lead citrate, and images were photographed with a Hitachi 7000 Transmission Electron Microscope. Antisense MOs (Gene Tools, Philomath, OR) were designed to target at the 5′-untranslated region or flanking region, including the initiation codon of the respective genes. The MO sequence was as follows: zKera-MO, 5′-AATGCTACCAAGAGTACCTCCATAG. This oligonucleotide complements the sequence from -2 through +23 relative to the initiation codon. A random sequence (RS) MO served as a control for zKera-MO: 5′-CCTCTTACCTCAGTTACAATTTATA-3′. This MO is offered by Gene Tools as a negative control oligonucleotide that should have no target specificity. A search of the data base did not identify any sequence similarity to known zebrafish genes with the zKera-MO. Solutions were prepared and injected at the 1-4-cell stage as described (16Nasevicius A. Ekker S.C. Nat. Genet. 2000; 26: 216-220Crossref PubMed Scopus (2137) Google Scholar). Injected embryos were maintained at 28 °C until analyzed. TUNEL Staining and Acridine Orange Staining—Dechorionated embryos were fixed in 4% cold paraformaldehyde in PBS for 6 h and dehydrated in a graded ethanol series (50, 70, 85, 95, 100%), followed by 20 min in acetone at -20 °C The embryos were further permeabilized by incubating in PBS with 0.5% Triton X-100 and 0.1% sodium citrate for 15 min and in 20 μg/ml Proteinase K for 10 min. The samples were refixed with 4% paraformaldehyde before incubation with terminal deoxynucleotidyltransferase solution according to the manufacturer's instructions (In Situ cell death detection kit (Roche Applied Science). For detection of apoptotic cells in live embryos, acridine orange (AO) was performed. For AO staining, samples were incubated in 5 μg/ml AO (Sigma) in E3 medium (5 mm NaCl, 0.17 mm KCl, 0.33 mm CaCl2, 0.33 mm MgSO4) for 30 min and observed by fluorescent microscopy. Caspase-3, Caspase-8, and Mitochondrial Apoptosis—To detect active caspase enzymes and loss of mitochondrial membrane potential during apoptosis, the image-iT LIVE Green caspase-3 and -7 detection kit, image-iT LIVE Green caspase-8 detection kit, and MitoTracker Red CMXRos (Molecular Probes, Inc., Eugene, OR) were performed in live embryos according to the manufacturer's instructions. Briefly, samples were incubated in 1× FLICA reagent working solution for 30 min and protected from light. Thereafter, samples were washed with 1× wash buffer and observed under a fluorescent microscopy. Primary Structure of the zKera Gene and Comparison of Deduced Amino Acid Sequence of Zebrafish Keratocan with Other Species—We identified the zKera gene by performing a BLAST search of the publicly available zebrafish data bases against the human KERA gene. The entire DNA sequence of the zKera gene is shown in Fig. 1. As illustrated in Figs. 1 and 2A, the entire DNA sequence of the zKera gene spans ∼3.5 kb (3589 bp) and contains two exons, one intron, and the promoter region. Comparing DNA sequence from the cDNA and the genomic DNA of the zKera gene, we found that exon 1 is 1373 bp and encodes an N-terminal domain and central leucine-rich repeats, and exon 2 contains 161 bp of coding sequence and 138 bp of 3′-untranslated sequence. The transcription initiation site marked +1 was determined via 5′-RACE as described under "Experimental Procedures." The first translation initiation ATG codon is located at the 511th base from the beginning of exon 1. Therefore, exon 1 contains 511 bp of 5′-untranslated sequence. There is no TATA consensus sequence found in the ∼2.2 kb of the proximal 5′-flanking region of the zKera gene, which was utilized as the promoter region. The cDNA clone (∼1.9 kb) contains a 1023-bp open reading frame encoding zebrafish keratocan (341 amino acid (aa) residues). Like other SLRP core proteins (i.e. lumican (17Funderburgh J.L. Funderburgh M.L. Brown S.J. Vergnes J.P. Hassell J.R. Mann M.M. Conrad G.W. J. Biol. Chem. 1993; 268: 11874-11880Abstract Full Text PDF PubMed Google Scholar), mimecan (18Funderburgh J.L. Corpuz L.M. Roth M.R. Funderburgh M.L. Tasheva E.S. Conrad G.W. J. Biol. Chem. 1997; 272: 28089-28095Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar), and keratocan (4Liu C.-Y. Shiraishi A. Kao C.W. Converse R.L. Funderburgh J.L. Corpuz L.M. Conrad G.W. Kao W.W.-Y. J. Biol. Chem. 1998; 273: 22584-22588Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar), zebrafish keratocan shows three distinct domains: a highly conserved central leucine-rich repeat region, flanked by hypervariable N- and C-terminal regions (Fig. 1). As shown in Fig. 1, after the signal peptide (Met-His; the first 20 aa), the N-terminal region contains a consensus YE motif for protein sulfation, which indicates the possible presence of sulfotyrosine(s) in zKera (19Antonsson P. Heinegard D. Oldberg A. J. Biol. Chem. 1991; 266: 16859-16861Abstract Full Text PDF PubMed Google Scholar). A central leucine-rich domain contains ten tandem repeats of the sequence LXXLXLXXNX(L/I). In addition, another genomic DNA sequence similar to the normal zKera gene with a 724-bp deletion from bp -690 to +34 was identified by different primer pairs, suggesting that there is a pseudogene of Kera that does not have an open reading frame and is designated as zKera′ in the zebrafish genome (Fig. 2, A and B). The zKera genomic DNA was subcloned and characterized by Southern blot hybridization, PCR, and DNA sequencing (data not shown). We have isolated clones representing the full open reading frame of zebrafish keratocan. A cDNA clone encoding the keratocan open reading frame was subcloned into the pBluescript SK vector (Stratagene, La Jolla, CA). The open reading frame of the zKera gene was 1023 bp long and encoded 341 amino acid residues.FIGURE 2Schematic representation of the organization of the zebrafish keratocan gene A pseudogene was proved by introduction into fertilized zebrafish eggs by an enhanced green fluorescence protein (EGFP) reporter gene driven by a 1.0-kb zKera promoter region.A, the figure shows the zebrafish keratocan gene drawn to scale. The blank boxes indicate the coding region of the mRNA. The translation start and stop codons are indicated by ATG and TAA, respectively. B, for detection of the pseudogene, primers used were as follows: primer A zKera forward, 5′-ATAAGAATGCGGCCGCGGGCAGGAGAGGCAGAGTAGC-3′; primer B zKera reverse, 5′-CGACGCGTAGTTAGGTTTAACCTAAAGAATCA-3′; primer C zKera reverse, 5′-AAATTGATCTGGATCAAGTTATT-3′; primer D zKera reverse, 5′-CCGGAATTCTTATATGACAACAGCCCTGAG-3′. Two different sizes of PCR products from zebrafish genomic DNA were obtained simultaneously by different primer pairs: primers A and B (lane 1); primers A and C (lane 2); primers A and D (lane 3). The deleted 724 bp of DNA sequences corresponding to the 5′-flanking region revealed that it was possibly derived from different loci and had no promoter function. C, generation of transgenic zebrafish harboring zKerapr1.7-EGFP SV40 (6.9 kb). It contains the 1.7-kb 5′-regulatory region of the zebrafish keratocan gene, untranslated region of exon 1 (511 bp), EGFP (∼700 bp), SV40 polyadenylation signal, and pEGFP-1 vector. D, generation of transgenic zebrafish harboring zKerapr1.3-EGFPbpA (6.3 kb). It contains the 1.3-kb 5′-regulatory region of the zebrafish keratocan gene, untranslated region of exon 1 (511 bp), EGFP (∼700 bp), bovine growth hormone polyadenylation signal (bpA), and pBSKcript-II vector. E, generation of transgenic zebrafish harboring zKerapr1.0-EGFP SV40 (∼6.2 kb, 724 bp deleted). It contains the 1.0-kb 5′-regulatory region of the zebrafish keratocan gene (690 bp deleted), untranslated region of exon 1 (477 bp), EGFP (∼700 bp), SV40 polyadenylation signal, and pEGFP-1 vector. F, EGFP expression was observed under a fluorescence microscope in transgenic zebrafish after injecting linearized zKerapr1.7-EGFP SV40 DNA fragment at the 72 hpf stage. G, in particular, strong EGFP expression was expressed selectively at corneal tissue at the 7 dpf stage. H, almost no EGFP expression was observed under the fluorescence microscope at the 5 dpf embryo stage in transgenic zebrafish after injecting linearized zKera pr1.3-EGFPbpA DNA fragment. I, no EGFP expression was observed under the fluorescence microscope at the 5 dpf embryo stage in transgenic zebrafish after injecting linearized zKera pr1.0-EGFP SV40 DNA fragment.View Large Image Figure ViewerDownload Hi-res image Download (PPT) For bioinformatics analysis in the promoter region, putative transcription factor binding sites were searched using the "TFSEARCH" program (available on the World Wide Web) with threshold score (default: 95.0). The results revealed several transcription factor-binding elements in the 2.2-kb (-1700 to +510) 5′-flanking region of the zKera gene. A MyoD binding site, agacaggtgttg (-1584 to -1
Referência(s)