OS-9 Regulates the Transit and Polyubiquitination of TRPV4 in the Endoplasmic Reticulum
2007; Elsevier BV; Volume: 282; Issue: 50 Linguagem: Inglês
10.1074/jbc.m703903200
ISSN1083-351X
AutoresYan Wang, Xiao Fu, Stephanie Gaiser, Michael Köttgen, Albrecht Kramer-Zucker, Gerd Walz, Tomasz Węgierski,
Tópico(s)Plant Stress Responses and Tolerance
ResumoTransient receptor potential (TRP) proteins constitute a family of cation-permeable channels that are formed by homo- or heteromeric assembly of four subunits. Despite recent progress in the identification of protein domains required for the formation of tetramers, the mechanisms governing TRP channel assembly, and biogenesis in general, remain largely elusive. In particular, little is known about the involvement of regulatory proteins in these processes. Here we report that OS-9, a ubiquitously expressed endoplasmic reticulum (ER)-associated protein, interacts with the cytosolic N-terminal tail of TRPV4. Using a combination of co-expression and knockdown approaches we have found that OS-9 impedes the release of TRPV4 from the ER and reduces its amount at the plasma membrane. Consistent with these in vitro findings, OS-9 protected zebrafish embryos against the detrimental effects of TRPV4 expression in vivo. A detailed analysis of the underlying mechanisms revealed that OS-9 preferably binds TRPV4 monomers and other ER-localized, immature variants of TRPV4 and attenuates their polyubiquitination. Thus, OS-9 regulates the secretory transport of TRPV4 and appears to protect TRPV4 subunits from the precocious ubiquitination and ER-associated degradation. Our data suggest that OS-9 functions as an auxiliary protein for TRPV4 maturation. Transient receptor potential (TRP) proteins constitute a family of cation-permeable channels that are formed by homo- or heteromeric assembly of four subunits. Despite recent progress in the identification of protein domains required for the formation of tetramers, the mechanisms governing TRP channel assembly, and biogenesis in general, remain largely elusive. In particular, little is known about the involvement of regulatory proteins in these processes. Here we report that OS-9, a ubiquitously expressed endoplasmic reticulum (ER)-associated protein, interacts with the cytosolic N-terminal tail of TRPV4. Using a combination of co-expression and knockdown approaches we have found that OS-9 impedes the release of TRPV4 from the ER and reduces its amount at the plasma membrane. Consistent with these in vitro findings, OS-9 protected zebrafish embryos against the detrimental effects of TRPV4 expression in vivo. A detailed analysis of the underlying mechanisms revealed that OS-9 preferably binds TRPV4 monomers and other ER-localized, immature variants of TRPV4 and attenuates their polyubiquitination. Thus, OS-9 regulates the secretory transport of TRPV4 and appears to protect TRPV4 subunits from the precocious ubiquitination and ER-associated degradation. Our data suggest that OS-9 functions as an auxiliary protein for TRPV4 maturation. Transient receptor potential (TRP) 3The abbreviations used are:TRPtransient receptor potentialENaCepithelial sodium channelERendoplasmic reticulumERADendoplasmic reticulum-associated degradationWTwild-typeGFPgreen fluorescent proteinshRNAshort hairpin RNABDbinding domainTMtransmembraneaaamino acid(s)HAhemagglutininPBSphosphate-buffered salineBS3bis(Sulfosuccinimidyl)suberate. 3The abbreviations used are:TRPtransient receptor potentialENaCepithelial sodium channelERendoplasmic reticulumERADendoplasmic reticulum-associated degradationWTwild-typeGFPgreen fluorescent proteinshRNAshort hairpin RNABDbinding domainTMtransmembraneaaamino acid(s)HAhemagglutininPBSphosphate-buffered salineBS3bis(Sulfosuccinimidyl)suberate. proteins constitute a family of cation channels that are primarily responsible for Ca2+ influx in non-excitable cells (1Montell C. Birnbaumer L. Flockerzi V. Cell. 2002; 108: 595-598Abstract Full Text Full Text PDF PubMed Scopus (723) Google Scholar). Based on sequence similarity, this family can be further divided into several subfamilies, including TRPC (canonical), TRPV (vanilloid), TRPM (melastatin), and TRPP (polycystin) subfamilies (2Clapham D.E. Nature. 2003; 426: 517-524Crossref PubMed Scopus (2138) Google Scholar). All TRP channels are predicted to share the same topology: six transmembrane (TM) segments, a pore-loop situated between TM5 and TM6, and intracellular N- and C-terminal tails. Depending on the subfamily, the cytosolic tails contain common conserved motifs such as ankyrin, PDZ, and coiled-coil domains (2Clapham D.E. Nature. 2003; 426: 517-524Crossref PubMed Scopus (2138) Google Scholar). Similarly to voltage-gated K+ channels, functional TRP channels are formed by homo- or heteromeric assembly of four subunits (3Schaefer M. Pflugers Arch. 2005; 451: 35-42Crossref PubMed Scopus (122) Google Scholar). Despite noticeable sequence similarity, TRP channels differ considerably in their selectivity and activation mechanisms even within subfamilies (1Montell C. Birnbaumer L. Flockerzi V. Cell. 2002; 108: 595-598Abstract Full Text Full Text PDF PubMed Scopus (723) Google Scholar). TRPV4, a member of the vanilloid group that preferentially forms homotetramers (4Hellwig N. Albrecht N. Harteneck C. Schultz G. Schaefer M. J. Cell Sci. 2005; 118: 917-928Crossref PubMed Scopus (245) Google Scholar), was initially identified as a channel activated by hypotonic cell swelling (5Liedtke W. Choe Y. Marti-Renom M.A. Bell A.M. Denis C.S. Sali A. Hudspeth A.J. Friedman J.M. Heller S. Cell. 2000; 103: 525-535Abstract Full Text Full Text PDF PubMed Scopus (1070) Google Scholar, 6Strotmann R. Harteneck C. Nunnenmacher K. Schultz G. Plant T.D. Nat. Cell Biol. 2000; 2: 695-702Crossref PubMed Scopus (790) Google Scholar, 7Wissenbach U. Bodding M. Freichel M. Flockerzi V. FEBS Lett. 2000; 485: 127-134Crossref PubMed Scopus (256) Google Scholar). Subsequently, it was shown to respond to other stimuli as well, including phorbol esters (8Watanabe H. Davis J.B. Smart D. Jerman J.C. Smith G.D. Hayes P. Vriens J. Cairns W. Wissenbach U. Prenen J. Flockerzi V. Droogmans G. Benham C.D. Nilius B. J. Biol. Chem. 2002; 277: 13569-13577Abstract Full Text Full Text PDF PubMed Scopus (495) Google Scholar), arachidonic acid (9Watanabe H. Vriens J. Prenen J. Droogmans G. Voets T. Nilius B. Nature. 2003; 424: 434-438Crossref PubMed Scopus (795) Google Scholar), heat (10Guler A.D. Lee H. Iida T. Shimizu I. Tominaga M. Caterina M. J. Neurosci. 2002; 22: 6408-6414Crossref PubMed Google Scholar), and mechanosensation (11Gao X. Wu L. O'Neil R.G. J. Biol. Chem. 2003; 278: 27129-27137Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar, 12Liedtke W. Tobin D.M. Bargmann C.I. Friedman J.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 14531-14536Crossref PubMed Scopus (282) Google Scholar). Studies using knockout mice have revealed that TRPV4 is involved in the regulation of systemic tonicity and mechanosensation (13Mizuno A. Matsumoto N. Imai M. Suzuki M. Am. J. Physiol. 2003; 285: C96-C101Crossref PubMed Scopus (292) Google Scholar, 14Suzuki M. Mizuno A. Kodaira K. Imai M. J. Biol. Chem. 2003; 278: 22664-22668Abstract Full Text Full Text PDF PubMed Scopus (585) Google Scholar, 15Liedtke W. Friedman J.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 13698-13703Crossref PubMed Scopus (629) Google Scholar). transient receptor potential epithelial sodium channel endoplasmic reticulum endoplasmic reticulum-associated degradation wild-type green fluorescent protein short hairpin RNA binding domain transmembrane amino acid(s) hemagglutinin phosphate-buffered saline bis(Sulfosuccinimidyl)suberate transient receptor potential epithelial sodium channel endoplasmic reticulum endoplasmic reticulum-associated degradation wild-type green fluorescent protein short hairpin RNA binding domain transmembrane amino acid(s) hemagglutinin phosphate-buffered saline bis(Sulfosuccinimidyl)suberate Most TRP channels are believed to function at the plasma membrane to mediate Ca2+ entry. Similarly to other membrane proteins, they are co-translationally translocated into the endoplasmic reticulum (ER), in the first stage of their secretory transport. Proteins transiting the ER undergo diverse modifications, such as glycosylation and disulfide bond formation. Importantly, the ER is also the place of protein folding and assembly of subunits into multimeric complexes (16Ellgaard L. Helenius A. Nat. Rev. Mol. Cell Biol. 2003; 4: 181-191Crossref PubMed Scopus (1672) Google Scholar). These processes are aided by numerous ER chaperones. Properly folded cargo proteins leave this compartment in COPII-coated vesicles. In contrast, non-native proteins are recognized by quality-control proteins and retained in the ER (16Ellgaard L. Helenius A. Nat. Rev. Mol. Cell Biol. 2003; 4: 181-191Crossref PubMed Scopus (1672) Google Scholar). Eventually, terminally misfolded cargo is degraded by the ER-associated degradation (ERAD) pathway. In this process, the cargo is retrotranslocated from the ER, polyubiquitinated, and degraded in the proteasome (17Meusser B. Hirsch C. Jarosch E. Sommer T. Nat. Cell Biol. 2005; 7: 766-772Crossref PubMed Scopus (999) Google Scholar). Proteins with lesions in the luminal domains are recognized and processed by the ERAD-L (luminal) machinery, whereas membrane proteins with defective cytosolic domains become substrates of the ERAD-C (cytosolic) pathway (18Vashist S. Ng D.T. J. Cell Biol. 2004; 165: 41-52Crossref PubMed Scopus (362) Google Scholar). At present, the mechanisms governing selection of ERAD-L substrates are understood to some extent, but the recognition of cytosolic lesions remains rather obscure. One possible mechanism could involve retention of faulty proteins by exposure of short amino acid motifs, such as di-arginine motifs, that are normally hidden in the mature structure (19Zerangue N. Schwappach B. Jan Y.N. Jan L.Y. Neuron. 1999; 22: 537-548Abstract Full Text Full Text PDF PubMed Scopus (901) Google Scholar). In general, the quality control in the ER is a very precise process that, for certain proteins, is responsible for the degradation of the majority of synthesized polypeptides due to folding and assembly defects (16Ellgaard L. Helenius A. Nat. Rev. Mol. Cell Biol. 2003; 4: 181-191Crossref PubMed Scopus (1672) Google Scholar, 20Kopito R.R. Physiol. Rev. 1999; 79: S167-S173Crossref PubMed Scopus (375) Google Scholar). Recent studies have shown that the cytosolic tails of TRP channels, and in particular the ankyrin repeats and coiled-coil domains, are important for subunit interactions and the assembly of mature tetramers (21Arniges M. Fernandez-Fernandez J.M. Albrecht N. Schaefer M. Valverde M.A. J. Biol. Chem. 2006; 281: 1580-1586Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 22Erler I. Hirnet D. Wissenbach U. Flockerzi V. Niemeyer B.A. J. Biol. Chem. 2004; 279: 34456-34463Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 23Erler I. Al-Ansary D.M. Wissenbach U. Wagner T.F. Flockerzi V. Niemeyer B.A. J. Biol. Chem. 2006; 281: 38396-38404Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar, 24Tsuruda P.R. Julius D. Minor Jr., D.L. Neuron. 2006; 51: 201-212Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 25Engelke M. Friedrich O. Budde P. Schafer C. Niemann U. Zitt C. Jungling E. Rocks O. Luckhoff A. Frey J. FEBS Lett. 2002; 523: 193-199Crossref PubMed Scopus (52) Google Scholar, 26Garcia-Sanz N. Fernandez-Carvajal A. Morenilla-Palao C. Planells-Cases R. Fajardo-Sanchez E. Fernandez-Ballester G. Ferrer-Montiel A. J. Neurosci. 2004; 24: 5307-5314Crossref PubMed Scopus (162) Google Scholar, 27Mei Z.Z. Xia R. Beech D.J. Jiang L.H. J. Biol. Chem. 2006; 281: 38748-38756Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). For example, TRPV4 splice variants lacking parts of ankyrin repeats are retained in the ER as a result of their inability to oligomerize (21Arniges M. Fernandez-Fernandez J.M. Albrecht N. Schaefer M. Valverde M.A. J. Biol. Chem. 2006; 281: 1580-1586Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). However, much less is known about the auxiliary proteins regulating TRP channel maturation and their transit through the ER. Here we report a novel interaction between TRPV4 and human OS-9, a ubiquitous protein originally identified as being amplified in certain osteosarcomas (28Su Y.A. Hutter C.M. Trent J.M. Meltzer P.S. Mol. Carcinog. 1996; 15: 270-275Crossref PubMed Scopus (55) Google Scholar). Interestingly, its closest relative in the yeast Saccharomyces cerevisiae, termed Yos9p, localizes to the ER lumen and plays an important role in the selection of substrates for the ERAD-L pathway (29Cormier J.H. Pearse B.R. Hebert D.N. Mol. Cell. 2005; 19: 717-719Abstract Full Text Full Text PDF PubMed Scopus (12) Google Scholar, 30Friedmann E. Salzberg Y. Weinberger A. Shaltiel S. Gerst J.E. J. Biol. Chem. 2002; 277: 35274-35281Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). In contrast, mammalian OS-9 localizes to the cytoplasmic side of the ER (31Litovchick L. Friedmann E. Shaltiel S. J. Biol. Chem. 2002; 277: 34413-34423Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). In this work, we have found that human OS-9 binds the juxtamembrane region in the N-terminal tail of TRPV4, preferentially associating with TRPV4 monomers rather than tetramers. OS-9 prevents the polyubiquitination of TRPV4 at the ER and retards its transport through this compartment. Our data point to a role of OS-9 in the regulation of TRPV4 biogenesis by holding and protecting its monomers from a premature polyubiquitination and proteasomal degradation. Yeast Two-hybrid Screen—The screen was performed using the Matchmaker 3 system (Clontech) according to the manufacturer's protocol. The yeast strain AH109 expressing the N-terminal tail of mouse TRPV4 fused to the GAL4 DNA-binding domain (BD) was transformed with the human adult kidney cDNA library (Clontech) constructed in the pACT2 vector. Approximately 5 × 106 transformants were screened on plates lacking histidine, adenine, and supplemented with 8 mm 3-aminotriazole. The cDNA clones isolated from growing colonies were subsequently reintroduced into the same yeast strain, and the strength of interactions was tested on plates containing as much as 25 mm 3-aminotriazole. The colony-lift filter assay was used to determine the β-galactosidase activity, and to confirm the interactions in an independent way. The clones were also tested for specificity by transforming them into an AH109 strain expressing GAL4 DNA-BD alone or DNA-BD/p53 fusion. Plasmids—All plasmids containing mouse TRPV4 sequences were generated from the pcDNA3-TRPV4 plasmid provided by U. Wissenbach (7Wissenbach U. Bodding M. Freichel M. Flockerzi V. FEBS Lett. 2000; 485: 127-134Crossref PubMed Scopus (256) Google Scholar). The following plasmids used in this work were described previously: FLAG-N-TRPV4 (also named F9-N-TRPV4), TRPV4-FLAG, TRPV4-V5/His, TRPC4-V5/His, TRPV1-V5/His, TRPP2-V5/His, and TRPV4-V5 loop (32Wegierski T. Hill K. Schaefer M. Walz G. EMBO J. 2006; 25: 5659-5669Crossref PubMed Scopus (72) Google Scholar). TRPV4-V5/His Δ226-437, Δ40-235, and Δ40-112 are derivatives of TRPV4-V5/His and lack the indicated regions. Human α-subunit of ENaC was C-terminally tagged with V5/His in the pcDNA6 vector (Invitrogen). FLAG-tagged N-terminal fragments of TRPV4 (D1-D5) are derivatives of FLAG-N-TRPV4. The fusion of GAL4 DNA-BD with TRPV4 (aa 61-467) was created in the pGBKT7 vector (Clontech). Fragments C1 (aa 307-667, Δ456-470) and C3 (aa 430-667) of human OS-9, isolated in the two-hybrid screen, were recloned into pcDNA3 vector (Invitrogen) with N-terminal FLAG tag. Isoform 1 of mouse OS-9 with a C-terminal V5 tag was constructed in the pcDNA3 vector. For generation of cell lines stably expressing TRPV4, a retroviral plasmid was prepared in which TRPV4-V5 loop sequence was cloned into the pLXSN vector (Clontech). For knockdown experiments, the OS-9 targeting sequence AACATCATCCAGGAGACAGAG or the control sequence ACGCATGCATGCTTGCTTT was cloned into the pLVTH vector (Addgene plasmid 12262) (33Wiznerowicz M. Trono D. J. Virol. 2003; 77: 8957-8961Crossref PubMed Scopus (623) Google Scholar). These two plasmids were used to create additional knockdown constructs, in which the original GFP coding sequence was exchanged for TRPV4-V5/His Δ40-235. Plasmids coding for isoform 1 and 2 of mouse OS-9 were kindly provided by L. Litovchick (31Litovchick L. Friedmann E. Shaltiel S. J. Biol. Chem. 2002; 277: 34413-34423Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar) and HA-tagged ubiquitin by D. Bohmann (34Treier M. Staszewski L.M. Bohmann D. Cell. 1994; 78: 787-798Abstract Full Text PDF PubMed Scopus (846) Google Scholar). Cell Cultures, Transfections, and Viral Gene Transfers—Human embryonic kidney (HEK 293T) and HeLa cells were grown in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum. The human sarcoma cells SJSA-1 were cultured in RPMI 1640 with 10% fetal bovine serum. Transient transfections were carried out using the calcium phosphate method or FuGENE 6 reagent (Roche Applied Science). Stable polyclonal cell lines were created by transduction of SJSA-1 cells with retroviruses or lentiviruses, produced in HEK 293T cells, in the presence of 8 μg/ml Polybrene (Sigma-Aldrich). Cells stably expressing TRPV4-V5 loop protein were selected with 0.25 mg/ml Geneticin (Invitrogen). Reagents—MG132 (Calbiochem) was used at 5 μg/ml. The rabbit α-TRPV4 polyclonal antibody was described previously (32Wegierski T. Hill K. Schaefer M. Walz G. EMBO J. 2006; 25: 5659-5669Crossref PubMed Scopus (72) Google Scholar). The guinea pig α-OS-9 antibody was kindly provided by L. Litovchick (31Litovchick L. Friedmann E. Shaltiel S. J. Biol. Chem. 2002; 277: 34413-34423Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). The following commercially available antibodies were used: α-FLAG M2 and α-actin (Sigma-Aldrich), α-V5 (Serotec), α-GFP (Santa Cruz Biotechnology, Santa Cruz, CA), α-ubiquitin P4D1 (Covance), rabbit α-OS-9 (Protein Tech Group), α-transferrin receptor (Zymed Laboratories), α-Golgin-97 (Molecular Probes, Madison, WI), α-calnexin (Stressgen), and α-HA 12CA5 (Roche Applied Science). Secondary horseradish peroxidase-coupled antibodies against guinea pig, rabbit, and mouse IgG were from Dako and GE Healthcare. Cy3-, Cy5-, and Alexa488-conjugated antibodies were from Jackson ImmunoResearch and Molecular Probes. Alkaline phosphatase-conjugated α-mouse antibody was from Sigma-Aldrich. Co-immunoprecipitation Assay—Thirty-six hours after transfection, HEK 293T cells were lysed in the immunoprecipitation buffer (1% Triton X-100, 1% sodium deoxycholate, 150 mm NaCl, 50 mm Tris, pH 8.0) supplemented with protease inhibitor mixture (Roche Applied Science). The lysates were cleared by centrifugation at 15,000 × g for 15 min at 4 °C. The supernatants were incubated for 1 h at 4 °C with an appropriate antibody, and subsequently with 30 μl of Protein G-Sepharose beads for ∼3 h. The beads were washed extensively with the immunoprecipitation buffer, and the retained proteins were analyzed by Western blotting. Cross-linking—Cells were lysed in the buffer containing 90 mm NaCl, 50 mm NaF, 5 mm Na4P2O7, 1% Triton X-100, 20 mm Hepes, pH 7.5, supplemented with protease inhibitor mixture (Roche Applied Science), and the lysates were cleared by centrifugation. The proteins were cross-linked with amine-reactive BS3 (Pierce) at a final concentration of 75-200 μm for 30 min at room temperature. The reaction was quenched with 40 mm Tris (pH 7.5) for 15 min. Ubiquitination Assay—Transfected HEK 293T or SJSA-1 cells were washed with PBS and lysed in buffer A (8 m urea, 100 mm NaH2PO4, 1% Triton X-100, 10 mm Tris, pH 8.0; all steps were performed at room temperature). The supernatant obtained after centrifugation of the lysates at 75,000 × g was incubated with Ni2+-nitrilotriacetic acid-agarose (Qiagen) for 1 h. The beads were washed twice with buffer A and twice with buffer B (same as A, except for 0.5% Triton X-100 and pH 6.3). Bound proteins were eluted with buffer C (same as A, except for 0.1% Triton X-100 and pH 4.5). Immunofluorescence—Cells were fixed in 3.7% paraformaldehyde in PBS for 10 min, permeabilized with 0.05% Triton X-100, and blocked in PBS containing 1% horse serum. Immunostainings were performed sequentially with appropriate primary antibodies and fluorescently labeled secondary antibodies. All images were obtained with an LSM 510 confocal microscope (Zeiss, Germany). Enzyme-linked Immunosorbent Assay—The assay was performed essentially as described in a previous study (32Wegierski T. Hill K. Schaefer M. Walz G. EMBO J. 2006; 25: 5659-5669Crossref PubMed Scopus (72) Google Scholar). The cells split in parallel were lysed with a lysis solution (Tropix, Bedford, MA) to measure the β-galactosidase activity with o-nitrophenyl-β-d-galactopyranoside as the substrate. This reaction was performed to control the transfection efficiency and normalize the alkaline phosphatase activity. Biotinylation Assay—Transfected HEK 293T cells were washed three times with ice-cold PBS (pH 8.0) and collected by centrifugation at 1500 rpm for 5 min. Surface proteins were biotinylated with 1 mg/ml sulfo-NHS-LC-biotin (Pierce) in PBS (pH 8.0) at room temperature for 30 min, according to the manufacturer's recommendations. Subsequently, the cells were lysed at 4 °C for 1 h in PBS (pH 8.0) containing 1% Triton X-100, 5 mm EDTA, and protease inhibitors (Roche Applied Science). Cell lysates were incubated with 30 μl of streptavidin beads (Pierce) at 4 °C overnight. The beads were washed twice with 1 m KCl, twice with 0.1 m Na2CO3, and once with PBS. Biotinylated proteins were eluted with SDS-PAGE loading buffer and analyzed by immunoblotting with anti-V5 and anti-transferrin receptor antibodies. Zebrafish Experiments—Wild-type zebrafish ABTL strain was maintained as described before (35Westerfield M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio). 4th Ed. University of Oregon Press, Eugene, OR1995: 1.1-1.35Google Scholar). Embryos were kept in Danieau solution and staged according to hours post-fertilization. The capped RNAs, synthesized using the mMessage mMachine T7 kit (Ambion, Austin, TX), were microinjected into one-cell stage embryos in 100 mm KCl, 0.1% Phenol Red, and 10 mm HEPES at doses of 600 (TRPV4), 1000 (TRPC4), or 200 (OS-9) pg. Data were analyzed with the Cochran-Mantel-Haenszel test. OS-9 Is a Novel TRPV4-binding Protein—To identify new proteins interacting with the intracellular N-terminal tail of TRPV4 (N-TRPV4), we performed a yeast two-hybrid assay. Screening of a human adult kidney cDNA library resulted in the isolation of 16 clones that specifically provided adenine and histidine prototrophy to the yeast when co-expressed with the GAL4 DNA-binding domain fused to aa 61-467 of mouse TRPV4. Three of these clones contained overlapping fragments originating from the same cDNA sequence. The protein encoded by this cDNA was originally identified as amplified in osteosarcomas and termed OS-9 (28Su Y.A. Hutter C.M. Trent J.M. Meltzer P.S. Mol. Carcinog. 1996; 15: 270-275Crossref PubMed Scopus (55) Google Scholar). Three splicing isoforms of human OS-9 were initially described (36Kimura Y. Nakazawa M. Yamada M. J. Biochem. (Tokyo). 1998; 123: 876-882Crossref PubMed Scopus (41) Google Scholar). The longest isoform, 1, contains 667 aa, isoform 2 lacks aa 535-589, whereas isoform 3 lacks aa 456-470 and 535-589. All three clones isolated by us code for the C-terminal domain of OS-9, starting at different residues. Clone OS-9-C1 extended from aa 307, OS-9-C2 from aa 395, and OS-9-C3 from aa 430. The sequence analysis revealed that OS-9-C2 and OS-9-C3 represent isoform 1 of human OS-9, whereas clone OS-9-C1, lacking aa 456-470 but not aa 535-589, conforms to the recently discovered fourth isoform (GenBank™ accession number NP_001017958). To confirm that the interaction between OS-9 and TRPV4 also occurs in mammalian cells, OS-9-C1 and OS-9-C3 fragments were N-terminally fused to the FLAG tag, expressed in HEK 293T cells, and purified using anti-FLAG antibodies. The full-length TRPV4 co-immunoprecipitated with both proteins, but not with FLAG-tagged GFP (Fig. 1A). In a reverse approach, we found that the isoforms 1 and 2 of mouse OS-9 co-immunoprecipitated with FLAG-tagged full-length TRPV4 (TRPV4-FLAG) as well as with FLAG-tagged N-terminal tail of TRPV4 (FLAG-N-TRPV4 (Fig. 1B)). We subsequently decided to map the region of TRPV4 responsible for the interaction with OS-9. For this purpose, we generated additional FLAG-tagged N-terminal fragments of TRPV4 and found that a fragment covering all three ankyrin domains and the juxtamembrane region (fragment D5, aa 237-468) interacted most strongly with OS-9. Fragments containing aa 1-370 (D2) and aa 1-436 (D3) did not show any interaction (Fig. 1C). However, the co-immunoprecipitation of OS-9 was regained when the D2 fragment was extended by aa 438-468 (D4). This experiment indicates that the juxtamembrane region (aa 438-468) in TRPV4 is required, although not necessarily sufficient, for the interaction with OS-9. OS-9 was previously isolated in three two-hybrid screens using unrelated proteins as baits (31Litovchick L. Friedmann E. Shaltiel S. J. Biol. Chem. 2002; 277: 34413-34423Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar, 37Baek J.H. Mahon P.C. Oh J. Kelly B. Krishnamachary B. Pearson M. Chan D.A. Giaccia A.J. Semenza G.L. Mol. Cell. 2005; 17: 503-512Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar, 38Nakayama T. Yaoi T. Kuwajima G. Yoshie O. Sakata T. FEBS Lett. 1999; 453: 77-80Crossref PubMed Scopus (26) Google Scholar). Interestingly, we have found that all these proteins share a short stretch of limited sequence similarity in their predicted OS-9 interacting regions (Fig. 1D). For TRPV4, this region of similarity extends from aa 441 to 466 and may be part of the OS-9 binding interface. OS-9 Interacts with Other TRP Family Members—To determine whether OS-9 interacts with other channel proteins, we performed a co-immunoprecipitation assay in HEK 293T cells, using several V5/His-tagged TRP proteins (TRPV1, TRPV4, TRPC4, and TRPP2), as well as the identically tagged α-subunit of the epithelial sodium channel (αENaC). This experiment showed that OS-9 co-immunoprecipitated only with TRPV4 and TRPV1, but not with other tested TRP channels or αENaC (Fig. 2). Importantly, TRPV1 and TRPV4 show high sequence conservation (62% identity) within the proposed OS-9 binding region (Fig. 1D). Thus, OS-9 may specifically bind the TRP channels of the vanilloid subfamily. OS-9 Interacts with TRPV4 at the ER—The splice variants of TRPV4 that contain deletions within the ankyrin repeats are retained in the ER (21Arniges M. Fernandez-Fernandez J.M. Albrecht N. Schaefer M. Valverde M.A. J. Biol. Chem. 2006; 281: 1580-1586Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). In agreement with this report, we observed that a TRPV4 mutant missing all three repeats (Δ226-437) localized to the ER (Fig. 3A). The same localization was found for another TRPV4 mutant, in which a more proximal region was deleted (Δ40-235, Fig. 3A). In contrast, a TRPV4 variant with a shorter truncation (Δ40-112) did not accumulate in the ER but instead was detected at the cell periphery (Fig. 3A). Interestingly, both ER-retained mutants immunoprecipitated OS-9 more efficiently than the full-length TRPV4 did, suggesting that the interaction between the two proteins takes place at the ER (Fig. 3A). This hypothesis was supported by a previously reported finding that OS-9 associates with the cytoplasmic side of the ER (31Litovchick L. Friedmann E. Shaltiel S. J. Biol. Chem. 2002; 277: 34413-34423Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Thus, we decided to investigate whether OS-9 plays a role in the secretory transport of TRPV4 and affects its cellular distribution. Transiently expressed OS-9 extensively co-localized with the ER marker BAP31 in HeLa cells (Fig. 3B). Similar results were obtained for endogenous OS-9 in SJSA-1 cells (Fig. 3C), an osteosarcoma cell line that expresses high levels of OS-9 (36Kimura Y. Nakazawa M. Yamada M. J. Biochem. (Tokyo). 1998; 123: 876-882Crossref PubMed Scopus (41) Google Scholar). 4In Ref. 36Kimura Y. Nakazawa M. Yamada M. J. Biochem. (Tokyo). 1998; 123: 876-882Crossref PubMed Scopus (41) Google Scholar, the SJSA-1 cell line is called OsA-CL. Using a retroviral gene transfer, we prepared a polyclonal SJSA-1 cell line stably expressing full-length TRPV4 protein with a V5 tag engineered into its first extracellular loop (TRPV4-V5 loop) (32Wegierski T. Hill K. Schaefer M. Walz G. EMBO J. 2006; 25: 5659-5669Crossref PubMed Scopus (72) Google Scholar). In these cells, a substantial portion of TRPV4 accumulated in the ER, as demonstrated by its co-localization with OS-9 and BAP31 (Fig. 3D). Depletion of OS-9 Facilitates Release of TRPV4 from the ER—Next we investigated whether depletion of endogenous OS-9 by RNA interference affects the subcellular localization of TRPV4-V5 loop protein in SJSA-1 cells. We identified one shRNA clone that efficiently reduced OS-9 protein levels in a transient expression system (data not shown) and generated a lentivirus that directed the expression of this shRNA in combination with GFP. Transduction of SJSA-1 cells with this lentivirus resulted in a substantial reduction of OS-9 protein, as assessed by Western blot analysis (Fig. 4A), and attenuated the OS-9 immunoreactivity in GFP-positive (i.e. transduced) cells (Fig. 4B, upper panels). Transduction with the lentivirus expressing control shRNA had no effect on OS-9 levels (Fig. 4, A and B). We next analyzed the immunolocalization of TRPV4 in GFP-positive SJSA-1 cells (Fig. 4C). We found that TRPV4 did not substantially co-localize with the ER resident protein calnexin in cells expressing the OS-9 shRNA, bu
Referência(s)