Novel Cav2.1 Splice Variants Isolated from Purkinje Cells Do Not Generate P-type Ca2+ Current
2002; Elsevier BV; Volume: 277; Issue: 9 Linguagem: Inglês
10.1074/jbc.m108222200
ISSN1083-351X
AutoresTaiji Tsunemi, Hironao Saegusa, Kinya Ishikawa, Shin Nagayama, Takayuki Murakoshi, Hidehiro Mizusawa, Tsutomu Tanabe,
Tópico(s)Neuroscience and Neuropharmacology Research
ResumoThe α12.1 (α1A) subunits of P-type and Q-type Ca2+ channels are encoded by a single gene, Cacna1a. Although these channels differ in the inactivation kinetics and sensitivity to ω-agatoxin IVA, the mechanism underlying these differences remains to be clarified. Alternative splicings of the Cacna1a transcript have been postulated to contribute to the respective properties, however, the splice variants responsible for P-type Ca2+ channels have not been identified. To explore P-type-specific splice variants, we aimed at cloning α12.1 from isolated mouse Purkinje cells using single-cell reverse transcription-PCR, because in Purkinje cells P-type currents dominate over the whole currents (>95%) with Q-type currents undetected. As a result, two novel splice variants were cloned. Compared with the previously cloned mouse α12.1, two novel variants had additional 48 amino acids at the amino termini, six single amino acid changes, and splicing variations at the exon 46/47 boundary, which produced different carboxyl termini. Furthermore, one variant had one RNA editing site. However, electrophysiological and pharmacological studies indicated that these variants did not generate P-type current in cultured cells. These results suggest that P-type-specific splice variants may exist but that post-translational processing or modification by uncharacterized interacting proteins is also required for generating the P-type current. The α12.1 (α1A) subunits of P-type and Q-type Ca2+ channels are encoded by a single gene, Cacna1a. Although these channels differ in the inactivation kinetics and sensitivity to ω-agatoxin IVA, the mechanism underlying these differences remains to be clarified. Alternative splicings of the Cacna1a transcript have been postulated to contribute to the respective properties, however, the splice variants responsible for P-type Ca2+ channels have not been identified. To explore P-type-specific splice variants, we aimed at cloning α12.1 from isolated mouse Purkinje cells using single-cell reverse transcription-PCR, because in Purkinje cells P-type currents dominate over the whole currents (>95%) with Q-type currents undetected. As a result, two novel splice variants were cloned. Compared with the previously cloned mouse α12.1, two novel variants had additional 48 amino acids at the amino termini, six single amino acid changes, and splicing variations at the exon 46/47 boundary, which produced different carboxyl termini. Furthermore, one variant had one RNA editing site. However, electrophysiological and pharmacological studies indicated that these variants did not generate P-type current in cultured cells. These results suggest that P-type-specific splice variants may exist but that post-translational processing or modification by uncharacterized interacting proteins is also required for generating the P-type current. Voltage-dependent Ca2+ channels (VDCCs) 1VDCCsvoltage-dependent Ca2+ channelsω-Aga IVAω-agatoxin IVASCA6spinocerebellar ataxia type 6RTreverse transcriptionACSFartificial cerebrospinal fluid3′-RACE3′ rapid amplification of cDNA endntnucleotide(s)HEKhuman embryonic kidney have diverse functions and play important roles in many physiological activities such as secretion, contraction, migration, excitation, and gene expression (1Catterall W.A. Cell Calcium. 1998; 24: 307-323Crossref PubMed Scopus (322) Google Scholar, 2Dunlap K. Luebke J.I. Turner T.J. Trends Neurosci. 1995; 18: 89-98Abstract Full Text PDF PubMed Scopus (873) Google Scholar). VDCCs are composed of multiple subunits, designated α1, β, α2δ, and γ. Among them, the α1 subunit is the largest and constitutes an ion-conduction pore, voltage sensor, and gating apparatus. Although the other auxiliary subunits modulate channel properties, the diversity of VDCCs comes primarily from the existence of multiple forms of the α1 subunits. Electrophysiologically and pharmacologically, VDCCs are divided into six types (L, N, P, Q, R, and T), and ten genetically different cDNAs, which encode the α1 subunit, have been identified. They are grouped into three families based on the similarities of deduced amino acid sequences (3Ertel E.A. Campbell K.P. Harpold M.M. Hofmann F. Mori Y. Perez-Reyes E. Schwartz A. Snutch T.P. Tanabe T. Birnbaumer L. Tsien R.W. Catterall W.A. Neuron. 2000; 25: 533-535Abstract Full Text Full Text PDF PubMed Scopus (806) Google Scholar). The Cav1 family (Cav1.1 through Cav1.4) includes channels containing α1S, α1C, α1D, and α1F, which constitute l-type Ca2+ channels. The Cav2 family (Cav2.1 through Cav2.3) includes channels containing α1A, α1B, and α1E, which constitute P/Q-type, N-type, and R-type Ca2+ channels, respectively. The Cav3 family (Cav3.1 through Cav3.3) includes channels containing α1G, α1H, and α1I, which mediate T-type Ca2+ currents. P/Q-type Ca2+ channels are expressed mainly in the central nervous system and contribute to neurotransmitter release (4Takahashi T. Momiyama A. Nature. 1993; 366: 156-158Crossref PubMed Scopus (620) Google Scholar, 5Mintz I.M. Adams M.E. Bean B.P. Neuron. 1992; 9: 85-95Abstract Full Text PDF PubMed Scopus (641) Google Scholar, 6Wheeler D.B. Randall A. Tsien R.W. Science. 1994; 264: 107-111Crossref PubMed Scopus (842) Google Scholar). P-type Ca2+ channels were originally identified in cerebellar Purkinje cells (7Llinás R. Sugimori M. Lin J.-W. Cherksey B. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1689-1693Crossref PubMed Scopus (502) Google Scholar), and Q-type Ca2+ channels were first described in cerebellar granule cells (8Randall A. Tsien R.W. J. Neurosci. 1995; 15: 2995-3012Crossref PubMed Google Scholar). Native P-and Q-type Ca2+ channels differ in inactivation kinetics and sensitivity to ω-agatoxin IVA (ω-Aga IVA) (8Randall A. Tsien R.W. J. Neurosci. 1995; 15: 2995-3012Crossref PubMed Google Scholar, 9Wheeler D.B. Randall A. Sather W.A. Tsien R.W. Prog. Brain Res. 1995; 105: 65-78Crossref PubMed Scopus (44) Google Scholar). Recently, much attention has been paid to P/Q-type Ca2+ channels, because mutations in the α12.1 subunit were reported to cause several neurological disorders such as familial hemiplegic migraine, episodic ataxia type 2, and spinocerebellar ataxia type 6 (SCA6) (10Ophoff R.A. Terwindt G.M. Vergouwe M.N. van Eijk R. Oefner P.J. Hoffman S.M.G. Lamerdin J.E. Mohrenweiser H.W. Bulman D.E. Ferrari M. Haan J. Lindhout D. van Ommen G.-J.B. Hofker M.H. Ferrari M.D. Frants R.R. Cell. 1996; 87: 543-552Abstract Full Text Full Text PDF PubMed Scopus (2136) Google Scholar,11Zhuchenko O. Bailey J. Bonnen P. Ashizawa T. Stockton D.W. Amos C. Dobyns W.B. Subramony S.H. Zoghbi H.Y. Lee C.C. Nat. Genet. 1997; 15: 62-69Crossref PubMed Scopus (1441) Google Scholar). Clinically, SCA6 is characterized by pure progressive cerebellar ataxia (12Ishikawa K. Tanaka H. Saito M. Ohkoshi N. Fujita T. Yoshizawa K. Ikeuchi T. Watanabe M. Hayashi A. Takiyama Y. Nishizawa M. Nakano I. Matubayashi K. Miwa M. Shoji S. Kanazawa I. Tsuji S. Mizusawa H. Am. J. Hum. Genet. 1997; 61: 336-346Abstract Full Text PDF PubMed Scopus (132) Google Scholar). Pathologically, SCA6 is marked by the severe loss of Purkinje cells, where only P-type Ca2+ channels are expressed, and relatively intact cerebellar granule cells, where both P- and Q-type Ca2+ channels are expressed (13Gomez C.M. Thompson R.M. Gammack J.T. Perlman S.L. Dobyns W.B. Truwit C.L. Zee D.S. Clark H.B. Anderson J.H. Ann. Neurol. 1997; 42: 933-950Crossref PubMed Scopus (246) Google Scholar, 14Ishikawa K. Watanabe M. Yoshizawa K. Fujita T. Iwamoto H. Yoshizawa T. Harada K. Nakamagoe K. Komatsuzaki Y. Satou A. Doi M. Ogata T. Kanazawa I. Shoji S. Mizusawa H. J. Neurol. Neurosurg. Psychiatry. 1999; 67: 86-89Crossref PubMed Scopus (100) Google Scholar). Although the relationship between P/Q-type Ca2+ channels' function and the pathophysiology underlying SCA6 has been extensively studied (15Matsuyama Z. Wakamori M. Mori Y. Kawakami H. Nakamura S. Imoto K. J. Neurosci. 1999; 19: 1-5Crossref PubMed Google Scholar, 16Toru S. Murakoshi T. Ishikawa K. Saegusa H. Fujigasaki H. Uchihara T. Nagayama S. Osanai M. Mizusawa H. Tanabe T. J. Biol. Chem. 2000; 275: 10893-10898Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 17Restituito S. Thompson R.M. Eliet J. Raike R.S. Riedl M. Charnet P. Gomez C.M. J. Neurosci. 2000; 20: 6394-6403Crossref PubMed Google Scholar), the mechanisms relating Ca2+ channels' function to SCA6 are still unclear. To determine the relationship, it is important to elucidate the mechanism for the generation of P- and Q-type currents. voltage-dependent Ca2+ channels ω-agatoxin IVA spinocerebellar ataxia type 6 reverse transcription artificial cerebrospinal fluid 3′ rapid amplification of cDNA end nucleotide(s) human embryonic kidney It has been hypothesized that the differences in the properties between P- and Q-type Ca2+ channels originate from alternative splicings of the pre-mRNA encoding α12.1 subunit (1Catterall W.A. Cell Calcium. 1998; 24: 307-323Crossref PubMed Scopus (322) Google Scholar,18Bourinet E. Soong T.W. Sutton K. Slaymaker S. Mathews E. Monteil A. Zamponi G.W. Nargeot J. Snutch T.P. Nat. Neurosci. 1999; 2: 407-415Crossref PubMed Scopus (366) Google Scholar). In fact, the Ca v 2.1 gene encodes both P- and Q-type Ca2+ channels. This was confirmed by two recent findings: 1) antisense oligonucleotide blocked both P- and Q-type currents (19Gillard S.E. Volsen S.G. Smith W. Beattie R.E. Bleakman D. Lodge D. Neuropharmacology. 1997; 36: 405-409Crossref PubMed Scopus (42) Google Scholar, 20Pinto A. Gillard S. Moss F. Whyte K. Brust P Williams M. Stauderman K. Harpold M. Lang B. Newson-Davis J. Bleakman D. Lodge D. Boot J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8328-8333Crossref PubMed Scopus (99) Google Scholar); 2) both P- and Q-type currents were eliminated in α12.1-deficient mice (21Jun K. Piedras-Renterı́a E.S. Smith S.M. Wheeler D.B. Lee S.B. Lee T.G. Chin H. Adams M.E. Scheller R.H. Tsien R.W. Shin H.-S. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 15245-15250Crossref PubMed Scopus (397) Google Scholar). Many Cav2.1 splice variants have been cloned by screening of mammalian cDNA libraries (11Zhuchenko O. Bailey J. Bonnen P. Ashizawa T. Stockton D.W. Amos C. Dobyns W.B. Subramony S.H. Zoghbi H.Y. Lee C.C. Nat. Genet. 1997; 15: 62-69Crossref PubMed Scopus (1441) Google Scholar, 16Toru S. Murakoshi T. Ishikawa K. Saegusa H. Fujigasaki H. Uchihara T. Nagayama S. Osanai M. Mizusawa H. Tanabe T. J. Biol. Chem. 2000; 275: 10893-10898Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 18Bourinet E. Soong T.W. Sutton K. Slaymaker S. Mathews E. Monteil A. Zamponi G.W. Nargeot J. Snutch T.P. Nat. Neurosci. 1999; 2: 407-415Crossref PubMed Scopus (366) Google Scholar, 22Mori Y. Friedrich T. Kim M.-S. Mikami A. Nakai J. Ruth P. Bosse E. Hofmann F. Flockerzi V. Furuichi T. Mikoshiba K. Imoto K. Tanabe T. Numa S. Nature. 1991; 350: 398-402Crossref PubMed Scopus (709) Google Scholar). However, these variants have never shown native P-type-like currents when expressed in cultured cells (16Toru S. Murakoshi T. Ishikawa K. Saegusa H. Fujigasaki H. Uchihara T. Nagayama S. Osanai M. Mizusawa H. Tanabe T. J. Biol. Chem. 2000; 275: 10893-10898Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 18Bourinet E. Soong T.W. Sutton K. Slaymaker S. Mathews E. Monteil A. Zamponi G.W. Nargeot J. Snutch T.P. Nat. Neurosci. 1999; 2: 407-415Crossref PubMed Scopus (366) Google Scholar, 22Mori Y. Friedrich T. Kim M.-S. Mikami A. Nakai J. Ruth P. Bosse E. Hofmann F. Flockerzi V. Furuichi T. Mikoshiba K. Imoto K. Tanabe T. Numa S. Nature. 1991; 350: 398-402Crossref PubMed Scopus (709) Google Scholar, 24Krovetz H.S. Helton T.D. Crews A.L. Horne W.A. J. Neurosci. 2000; 20: 7564-7570Crossref PubMed Google Scholar, 25Hans M. Urrutia A. Deal C. Brust P.F. Stauderman K. Ellis S.B. Harpold M.M. Johnson E.C. Williams M.E. Biophys. J. 1999; 76: 1384-1440Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 26Sather W.A. Tanabe T. Zhang J.-F. Mori Y. Adams M.E. Tsien R.W. Neuron. 1993; 11: 291-303Abstract Full Text PDF PubMed Scopus (382) Google Scholar). One of the reasons why the possible P-type-specific splice variants have not been cloned may be that the amount of P-type splice variants is quite small in the cDNA libraries. It is difficult to obtain cDNAs from specific cells by screening of a conventional cDNA library, because it is made up of cDNAs derived from heterogeneous cells. Recently single-cell reverse transcription-polymerase chain reaction (RT-PCR) was developed to investigate the expression of genes in a specific cell and has proven to be a useful tool for the identification of ion channel subunits (27Lambolez B. Audinat E. Bochet P. Crepel F. Rossier J. Neuron. 1992; 9: 247-258Abstract Full Text PDF PubMed Scopus (434) Google Scholar, 28Miera E.V.-S. Rudy B. Sugimori M. Llinás R. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7059-7064Crossref PubMed Scopus (81) Google Scholar). In this study, we applied the single-cell RT-PCR to cloning of α12.1 subunit from isolated mouse single Purkinje cells, where almost all the Ca2+ currents are P-type and no Q-type currents are recorded. C57BL/6N mice were anesthetized with methoxyflurane and decapitated, and the brains were quickly removed. Then cerebral cortices and cerebella were dissected. Total RNA was obtained from mouse cerebral cortices and cerebella using the standard acid guanidinium thiocyanate-phenol-chloroform extraction method (29Chomczynski P. Sacchi N. Anal. Biochem. 1987; 167: 156-159Crossref Scopus (63232) Google Scholar). To obtain a single Purkinje cell or granule cells, a mouse cerebellum was cut into 300-μm slices in artificial cerebrospinal fluid (ACSF) saturated with 95% O2-5% CO2, and then the slices were incubated for 2 h at room temperature in the saturated ACSF to allow recovery from the injury due to slicing. The ACSF consisted of (in millimolar) 137 NaCl, 2.5 KCl, 0.58 NaH2PO4, 1.2 MgCl2, 2.5 CaCl2, 21 NaHCO3, and 10 glucose. A single Purkinje cell was identified morphologically and then aspirated into a glass micropipette by applying negative pressure. Granule cells were also collected in a group using the same procedure. Aspirated single Purkinje cells or granule cells were directly expelled into thin-walled plastic tubes (PerkinElmer Life Sciences, Norwalk, CT) containing 5× First Strand buffer (4 μl), dNTP mixture (4 μl, 2.5 mm), RNase inhibitor (0.5 μl, 28,000 units/ml), dithiothreitol (2 μl, 0.1 m), and random hexamer (0.5 μl, 5 ng/μl) (PerkinElmer Life Sciences, Pomona, CA). The reaction mixture was incubated at 70 °C for 10 min and then placed on ice. SuperScript II reverse transcriptase (1 μl, 200 units/μl) (Invitrogen, Gaithersburg, MD) was added to the mixture, and then the reaction mixture was incubated at 25 °C for 10 min, 42 °C for 50 min, and 70 °C for 15 min. After the treatment, 1 μl of RNase H was added, and the sample was incubated at 37 °C for 15 min. Primers were designed in reference to the sequence of the previously reported mouse α12.1 cDNA (30Fletcher C.F. Lutz C.M. O'Sullivan T.N. Shaughnessy J.D., Jr. Hawkes R. Frankel W.N. Copeland N.G. Jenkins N.A. Cell. 1996; 87: 607-617Abstract Full Text Full Text PDF PubMed Scopus (661) Google Scholar) and of the 5′-upstream region of mouse Ca v 2.1 gene (31Takahashi E. Murata Y. Oki T. Miyamoto N. Mori Y. Takada N. Wanifuchi H. Wanifuchi N. Yagami K. Niidome T. Tanaka I. Katayama K. Biochem. Biophys. Res. Commun. 1999; 260: 54-59Crossref PubMed Scopus (14) Google Scholar) (TableI). To discriminate PCR products derived from the genomic DNA, all the primer pairs were designed so that each primer was located in different exons. Nested PCR was carried out to amplify α12.1 cDNA from single Purkinje cells. Single-cell cDNA (2.5 μl) was used as a template for the first PCR amplification. The reaction mixture contained: PCR-grade H2O (7.5 μl), 5× Advantage-GC PCR Buffer (5 μl), dNTP mixture (2.5 μl, 2.5 mm), GC Melt (2.5 μl, 5 m), each primer (2 μl, 2.5 μm), and 50× Advantage-GC cDNA polymerase mix (1 μl) (CLONTECH, Palo Alto, CA). The thermal cycling program for the first PCR was 35 cycles of 96 °C for 4 min, 60 °C (56 °C for some primers) for 1 min, and 72 °C for 3 min. The first PCR product (2.5 μl) was used as a template for the second PCR. The reaction mixture contained: PCR-grade H2O (10 μl), 10× Cloned Pfu DNA polymerase reaction buffer (2.5 μl), dimethyl sulfoxide (2.5 μl), dNTP mixture (2.5 μl, 2.5 mm), each primer (2 μl, 2.5 μm), andPfuTurbo DNA polymerase (1 μl, 2.5 units/μl) (Stratagene, La Jolla, CA). The second PCR program was the same as the first except that the number of PCR cycles was 20 or 25. To obtain the 3′-downstream region, 3′ rapid amplification of cDNA end (3′-RACE) was performed initially with 1 μg of poly(A)+ RNA from mouse cerebellum using a Marathon cDNA amplification kit (CLONTECH) according to the manufacturer's instructions. The reaction products were subcloned into pCR 2.1 (Invitrogen, San Diego, CA) and sequenced using an ABI Prism 310 genetic analyzer (PerkinElmer Life Sciences). Then reverse primers were designed so that they were located downstream from the termination codons of any reading frames (Ma1A3′R3 and Ma1A3′R4; Table I). With these primers, nested PCR was also performed with a single Purkinje cell as described above. All PCR products were gel-purified and subcloned into the HincII site of pUC18 and sequenced. We used two independent Purkinje cells to avoid possible PCR errors.Table IPrimer setsRegion, fragment sizeForward primerReverse primerPrimer name Primer sequences (5′→3′)Primer name Primer sequences (5′→3′)exon 1–6, 1001 bpOuter primersMaIA-5′-F1ACAGCCCGGCCAGCCTGAGCAMalA-R1AGGAGATCAGTCCAGCCTTCCATInner primersMalA-5′-F2AAGCTTTCGCCGCAGCAACAGCAGCCGMalA-R2CACTGGAAAACAGTGAGCACAGCexon 6–12, 785 bpOuter primersMalA-F5ACGACATCCAGGGTGAGTCGCMalA-R5AAGAGTGGAAGTAAGGCCGCGTInner primersMalA-F6GACAGAGGAGCCTGCCCGCAMalA-R6AACATTTCGGACATAAAGAGTCCTAAexon 11–19, 831 bpOuter primersMalA-F7GGTCTCCCTTCGCCAGAGCCAMalA-R7ACGGCTATGGACATGTTGGCTGInner primersMalA-F8TCACAAGAAGGAGAGAAGAATGCGMalA-R8TACCTCCTTGGCTTTCTGTAGAGexon 16–25, 1806 bpOuter primersMalA-ex16-F2TTTCAGATCCTGACTGGCGAAGATMalA-ex25R2CTTCAGCTTTGGCAGCCGCTTGInner primersMalA-ex16-F1CGGCATGGTGTTCTCCATCTAMalA-ex25-RAATGTCCTTTCCTTTGCTATTGCCAexon 23–29, 997 bpOuter primersMalA-F13TGCTGCGATATTTTGACTATGTTTTTMalA-R13GTACTCTTCCATCATCTTGTCTCCInner primersMalA-F14CAGGCGTGTTTACCTTTGAGATGMalA-R14CTGAAAGGTGATGATGATCAAGGCexon 28–36, 900 bpOuter primersMalA-F11GGTCCTCAAGCACTCAGTGGATMalA-R11CAGAAACGAGCACAGGAAGATGAAInner primersMalA-F12CATGGAGATGTCCATCTTCTACGTMalA-R12GTTGCCGCAGTCTGCCGTGAGexon 34–42, 959 bpOuter primersMalA-F9GTGTTTGGCAACATCGGCATTGAMalA-R9AGGCATGTCGATGGGTGGCCCInner primersMalA-F10GAGGATGAATTCCAAATCACGGAGMalA-R10GCTCCAGGTGCCAGTCTTCTGexon 41–47, 1364/1506 bpOuter primersMalA-F3AACCGGACACCACTCATGTTCCAMalA-3′-R3TAATAAGCTTGGCGTGGCCCInner primersMalA-F4ATGGAGCCTCCATCACCAACACAMalA-3′-R4TCTAGATAGCACTCCCGTGGGTCTGAexon 41–46, 821 bpOuter primersMalA-F3AACCGGACACCACTCATGTTCCAMalA-3′-R3TAATAAGCTTGGCGTGGCCCInner primersMalA-F4ATGGAGCCTCCATCACCAACACAMalA-R4TCTAGACTACTGTCTGTGTGTThe exon numbers are deduced from those of human CACNA1Agene (10Ophoff R.A. Terwindt G.M. Vergouwe M.N. van Eijk R. Oefner P.J. Hoffman S.M.G. Lamerdin J.E. Mohrenweiser H.W. Bulman D.E. Ferrari M. Haan J. Lindhout D. van Ommen G.-J.B. Hofker M.H. Ferrari M.D. Frants R.R. Cell. 1996; 87: 543-552Abstract Full Text Full Text PDF PubMed Scopus (2136) Google Scholar). The sequences which are exhibited asbold letters are added to the primers for subcloning. Open table in a new tab The exon numbers are deduced from those of human CACNA1Agene (10Ophoff R.A. Terwindt G.M. Vergouwe M.N. van Eijk R. Oefner P.J. Hoffman S.M.G. Lamerdin J.E. Mohrenweiser H.W. Bulman D.E. Ferrari M. Haan J. Lindhout D. van Ommen G.-J.B. Hofker M.H. Ferrari M.D. Frants R.R. Cell. 1996; 87: 543-552Abstract Full Text Full Text PDF PubMed Scopus (2136) Google Scholar). The sequences which are exhibited asbold letters are added to the primers for subcloning. Eight independent nested PCR reactions were designed so that the resulting PCR products covered the entire coding region of the mouse α12.1 subunit. The adjacent PCR products possessed overlapping sequences in which unique restriction sites occurred, making it easy to connect all the fragments to construct expression vectors (pcDNAI/Amp, Invitrogen, was used as the backbone vector). With regard to the most 3′ region, two fragments with different sizes (1364 and 1506 bp) were amplified (TableI). The α12.1 with the shorter 3′ sequence was designed MPI and the longer MPII. Thus, MPI and MPII differed only in their 3′ sequence corresponding to the exon 41–47 (Fig. 1 C). PKCRα2 and PKCRβ that encode α2δ and β1a subunits, respectively, were described previously (32Zong S. Zhou J. Tanabe T. Biochem. Biophys. Res. Commun. 1994; 201: 1117-1123Crossref PubMed Scopus (32) Google Scholar). The expression vector for the β2a or β3 subunit was constructed by subcloning the inserted fragment of pBH19 or pBH23 (33Hullin R. Singer-Lahat D. Freichel M. Biel M. Dascal N. Hofmann F. Flockerzi V. EMBO J. 1992; 11: 885-890Crossref PubMed Scopus (280) Google Scholar) into pKCRH2 (34Mishina M. Kurosaki T. Tobimatsu T. Morimoto Y. Noda M. Yamamoto T. Terao M. Lindstrom J. Takahashi T. Kuno M. Numa S. Nature. 1984; 307: 604-608Crossref PubMed Scopus (248) Google Scholar), respectively. The expression vector for the β4 subunit was constructed by subcloning the inserted fragment of β k213 (35Castellano A. Wei X. Birnbaumer L. Perez-Reyes E. J. Biol. Chem. 1993; 268: 12359-12366Abstract Full Text PDF PubMed Google Scholar) into pcDNAI/Amp. We also constructed a plasmid carrying the mouse α12.1 whose coding region terminated in the end of exon 46 and designated this version of α12.1 as MPc. A stop codon (TAG) was artificially introduced immediately after the end of exon 46 by PCR using MPII as a template and primer MalAF4 and MalAR4 (Table I) as a mutagenic primer. Then MPc was constructed by connecting the artificially made exon 41–46 fragment together with the seven same fragments that were used to construct MPI or MPII. Fragments with a size of 780 bp containing nucleotide (nt) 6358 were PCR-amplified from cDNAs that were prepared from single Purkinje cells, cerebellar granule cells, or cerebral cortex. The primers used were Ma1A-F4 (Table I) as a forward primer and MalA-RE (5′-TGGGCGAGCGGGACCAGCG-3′) as a reverse primer. Each PCR product was subjected to both direct sequencing and subcloning into pCR 2.1. For control experiments, we used two plasmids that contained the exon 41–47 fragment of MPI and MPII. The Escherichia colicolonies were transferred to nylon membranes (Hybond-N+, Amersham Biosciences, Inc., Uppsala, Sweden). The membranes were hybridized with 18-mer oligonucleotide probe 6358C (5′-AGAACCAACGGTACCACC-3′) or 6358T (5′-AGAACCAATGGTACCACC-3′). The probes were 32P-end-labeled using [γ-32P]ATP (>5000 Ci/mmol) and T4 polynucleotide kinase (New England BioLabs, Beverly, MA). Hybridization was performed at 37 °C for 16 h in 4× SSC containing 0.1% SDS, 1× Denhardt's reagent, and 50 μg/ml herring sperm DNA (Roche Molecular Biochemicals, Mannheim, Germany). After hybridization, the membranes were washed in 1× SSC with 0.1% SDS at 37 °C for 20 min. Autoradiography was performed with Hyperfilm-ECL (Amersham Biosciences, Inc.) at −80 °C using an intensifying screen. The procedures of cell culture and transfection were the same as those previously described (16Toru S. Murakoshi T. Ishikawa K. Saegusa H. Fujigasaki H. Uchihara T. Nagayama S. Osanai M. Mizusawa H. Tanabe T. J. Biol. Chem. 2000; 275: 10893-10898Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). In brief, human embryonic kidney (HEK) 293 cells were grown in Dulbecco's modified Eagle's medium/F-12 medium (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen) and 50 μg/ml gentamicin (Invitrogen). The α12.1 subunits were transiently co-expressed with α2δ and one of the β subunits, and pEGFP-C2 (CLONTECH) was used as a transfection marker. Transfection was performed with a calcium phosphate precipitation method (Mammalian Transfection kit, Stratagene). Electrophysiological analysis was performed 36–72 h after transfection. Patch pipettes were pulled from borosilicate glass (GC150F-4, Warner, Instruments, Hamden, CT) and filled with a solution consisting of (in millimolar) 140 CsCl, 2 MgCl2, 10 EGTA, 10 HEPES, 3 ATP·Mg (pH 7.4 with CsOH). Pipette resistance ranged from 2 to 4 MΩ. The external solution consists of (in millimolar) 15 BaCl2, 145 tetraethylammonium chloride, 10 HEPES, and 10 glucose (pH 7.4 with tetraethylammonium-OH). Barium currents were recorded at room temperature (22–25 °C) under a whole-cell mode of the patch clamp recording with an amplifier (EPC-9, HEKA, Lambrecht/Pfalz, Germany). The holding potential was −80 mV unless otherwise stated. Series resistance was electronically compensated by 50–80%. All illustrated and analyzed currents were corrected for remaining capacitance and leakage currents using the −P/4 method. Data were filtered at 3 kHz (four-pole Bessel filter) and sampled at 10 kHz. The software (Pulse+PulseFit 8.09, HEKA) was used for data acquisition and analysis. In the experiments with ω-Aga IVA (Peptide Institute, Inc., Osaka, Japan), the external solution was supplemented with 0.1 mg/ml cytochrome c to prevent nonspecific binding of the toxin. All data were presented as mean ± S.E. Statistical analysis was performed using an unpaired Student'st test. We cloned two novel splice variants of α12.1 subunit from the mouse Purkinje cell using the single-cell RT-PCR technique. Compared with the sequences of rabbit α12.1 subunit (BI-1) or rat α12.1 (rbA-1), the previously reported mouse α12.1 lacked 46 or 48 amino acids in the amino terminus, respectively (30Fletcher C.F. Lutz C.M. O'Sullivan T.N. Shaughnessy J.D., Jr. Hawkes R. Frankel W.N. Copeland N.G. Jenkins N.A. Cell. 1996; 87: 607-617Abstract Full Text Full Text PDF PubMed Scopus (661) Google Scholar). However, α12.1 variants we cloned in this study commonly contained the 5′ sequences homologous to those of BI-1 and rbA-1, suggesting that the amino termini of our newly cloned α12.1 variants are longer by 48 amino acid residues than that of the previously reported mouse α12.1. Together with this difference, two novel α12.1 had single base substitutions at 16 sites located from exon 1 to exon 41 compared with the previously reported mouse α12.1. We confirmed these 16 single base substitutions in two independent Purkinje cells. Therefore, PCR errors are unlikely to be the cause of the substitutions. Ten of the 16 substitutions were silent polymorphisms leading to no amino acid changes, and the rest of them resulted in amino acid changes. Two altered amino acids found in II–III loop (L886P, D1085N) were identical to the sequence of rbA-1, and the remaining four found in repeat I (P79S, F82L) and repeat III (F1409L, F1433L) were conserved in BI-1, rbA-1, and human α12.1 subunit (Fig.1 A). In the human Ca v 2.1 gene, differential splice acceptor usage at the boundary of intron 46/exon 47 is known to yield an α12.1 variant with a longer carboxyl terminus (11Zhuchenko O. Bailey J. Bonnen P. Ashizawa T. Stockton D.W. Amos C. Dobyns W.B. Subramony S.H. Zoghbi H.Y. Lee C.C. Nat. Genet. 1997; 15: 62-69Crossref PubMed Scopus (1441) Google Scholar), because the stop codon in the beginning of exon 47 was no longer in-frame. The same kind of variant was also found in rat α12.1 (36Ligon B. Boyd III, A.E. Dunlap K. J. Biol. Chem. 1998; 273: 13905-13911Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). But the nucleotide sequence of mouse α12.1 corresponding to the variant with a longer carboxyl-tail has not been reported so far. This carboxyl-terminal sequence, which is thought to be encoded by exon 47, is expressed abundantly in rat Purkinje cell bodies and dendrites as revealed by an immunohistochemical study (17Restituito S. Thompson R.M. Eliet J. Raike R.S. Riedl M. Charnet P. Gomez C.M. J. Neurosci. 2000; 20: 6394-6403Crossref PubMed Google Scholar) and may affect channel properties. Therefore, we tried to clone the mouse exon 47 by 3′-RACE. Because a single Purkinje cell has an extremely small amount of RNA, it is expected to be difficult to apply 3′-RACE. Therefore, we first applied 3′-RACE to mouse cerebellar poly(A)+ RNA. As a result, a novel fragment with a size of 1504 bp was cloned, and sequence analysis revealed that there were termination codons in all the reading frames on the sequence. Then we designed reverse primers (Ma1A-3′-R3, Ma1A-3′-R4; Table I) to perform RT-PCR with single Purkinje cells. Two fragments with different sizes of 1364 and 1506 bp were amplified. We assigned the novel α12.1 with the shorter fragment MPI, and the α12.1 with the longer fragment MPII. The nucleotide sequences of MPI and MPII were completely the same except for these most 3′ sequences, where several distinctive features were found in the two variants (Fig. 1,B and C). First, a single nucleotide conversion (C to T) was observed at nt 6358 in MPI. This conversion led to an amino acid substitution from arginine to tryptophan (Fig. 1,B and C). Second, there were two variations at the beginning of exon 47. In MPI, 5 nucleotide residues (GGCAG) were inserted, whereas in MPII 3 nucleotide residues (TAG) were deleted, when compared with the previously published sequence (30Fletcher C.F. Lutz C.M. O'Sullivan T.N. Shaughnessy J.D., Jr. Hawkes R. Frankel W.N. Copeland N.G. Jenkins N.A. Cell. 1996; 87: 607-617Abstract Full Text Full Text PDF PubMed Scopus (661) Google Scholar) (Fig.1 B). These 5-bp insertion and 3
Referência(s)