Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Tumor Cell-mediated Induction of the Stromal Factor Stromelysin-3 Requires Heterotypic Cell Contact-dependent Activation of Specific Protein Kinase C Isoforms

2004; Elsevier BV; Volume: 280; Issue: 2 Linguagem: Inglês

10.1074/jbc.m405482200

ISSN

1083-351X

Autores

Krystel Louis, Nathalie C. Guérineau, Olivia Fromigué, Virginie Defamie, Alejandra Collazos, Patrick Anglard, Margaret A. Shipp, Patrick Auberger, Dominique Joubert, Bernard Mari,

Tópico(s)

Marine Biology and Environmental Chemistry

Resumo

Stromelysin-3 (ST3, MMP-11) has been shown to be strongly overexpressed in stromal fibroblasts of most invasive human carcinomas. However, the molecular mechanisms leading to ST3 expression in nonmalignant fibroblasts remain unknown. The aim of the present study was to analyze the signaling pathways activated in normal pulmonary fibroblasts after their interaction with non-small cell lung cancer (NSCLC) cells and leading to ST3 expression. The use of selective signaling pathway inhibitors showed that conventional and novel protein kinase Cs (PKC) were required for ST3 induction, whereas Src kinases exerted a negative control. We observed by both conventional and real time confocal microscopy that green fluorescent protein-tagged PKCα and PKCϵ, but not PKCδ, transfected in fibroblasts, accumulate selectively at the cell-cell contacts between fibroblasts and tumor cells. In agreement, RNAi-mediated depletion of PKCα and PKCϵ, but not PKCδ significantly decreased co-culture-dependent ST3 production. Finally, a tetracycline-inducible expression model allowed us to confirm the central role of these PKC isoforms and the negative regulatory function of c-Src in the control of ST3 expression. Altogether, our data emphasize signaling changes occurring in the tumor microenvironment that may define new stromal targets for therapeutic intervention. Stromelysin-3 (ST3, MMP-11) has been shown to be strongly overexpressed in stromal fibroblasts of most invasive human carcinomas. However, the molecular mechanisms leading to ST3 expression in nonmalignant fibroblasts remain unknown. The aim of the present study was to analyze the signaling pathways activated in normal pulmonary fibroblasts after their interaction with non-small cell lung cancer (NSCLC) cells and leading to ST3 expression. The use of selective signaling pathway inhibitors showed that conventional and novel protein kinase Cs (PKC) were required for ST3 induction, whereas Src kinases exerted a negative control. We observed by both conventional and real time confocal microscopy that green fluorescent protein-tagged PKCα and PKCϵ, but not PKCδ, transfected in fibroblasts, accumulate selectively at the cell-cell contacts between fibroblasts and tumor cells. In agreement, RNAi-mediated depletion of PKCα and PKCϵ, but not PKCδ significantly decreased co-culture-dependent ST3 production. Finally, a tetracycline-inducible expression model allowed us to confirm the central role of these PKC isoforms and the negative regulatory function of c-Src in the control of ST3 expression. Altogether, our data emphasize signaling changes occurring in the tumor microenvironment that may define new stromal targets for therapeutic intervention. Matrix metalloproteinases (MMPs) 1The abbreviations used are: MMP, matrix metalloproteinases; CM, conditioned medium; EGF, epithelial growth factor; MAPK, mitogen-activated protein kinase; MMP, matrix metalloproteinase; NSCLC, non-small cell lung cancer; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; ST3, stromelysin-3; Tet, tetracycline; TIMP, tissue inhibitor of matrix metalloproteinases; C/EBP, CCAAT/enhancer-binding protein; Ab, antibody; siRNA, small interfering RNA; cPKC, conventional PKC; nPKC, novel PKC; JNK, c-Jun N-terminal kinase; CA, constitutively active; DN, dominant negative; GFP green fluorescent protein. are zinc-dependent endopeptidases primarily involved in extracellular matrix degradation and tissue remodeling (1Vu T.H. Werb Z. Genes Dev. 2000; 14: 2123-2133Crossref PubMed Scopus (1056) Google Scholar, 2Sternlicht M.D. Werb Z. Annu. Rev. Cell Dev. Biol. 2001; 17: 463-516Crossref PubMed Scopus (3256) Google Scholar). The expression and activity of these extracellular enzymes are controlled at different levels, including transcription, secretion, zymogen activation, and inhibition of their active forms by a family of natural tissue inhibitors of metalloproteinases (TIMPs). Imbalance between MMPs and TIMPs has been implicated in various physiological but also in pathological tissue remodeling processes, notably in multiple steps of tumorigenesis (3Egeblad M. Werb Z. Nat. Rev. Cancer. 2002; 2: 161-174Crossref PubMed Scopus (5169) Google Scholar). MMPs represent promising therapeutic targets for cancer therapy but additional studies are required to identify the regulatory mechanisms that control MMPs synthesis and activity in the tumor microenvironment (4Coussens L.M. Fingleton B. Matrisian L.M. Science. 2002; 295: 2387-2392Crossref PubMed Scopus (2390) Google Scholar, 5Overall C.M. Lopez-Otin C. Nat. Rev. Cancer. 2002; 2: 657-672Crossref PubMed Scopus (1143) Google Scholar). Most MMPs that have been identified in human carcinomas are expressed by the stroma, including fibroblasts, vascular, and inflammatory cells, rather than by tumor cells (6Lynch C.C. Matrisian L.M. Differentiation. 2002; 70: 561-573Crossref PubMed Scopus (316) Google Scholar). Among these MMPs, stromelysin-3 (ST3, MMP-11) has received much attention as its expression is elevated at early stages in virtually all invasive human primary carcinomas and in a large part of their associated metastases. Moreover, high ST3 levels have been shown to be associated with poor clinical outcome in various human carcinomas (7Engel G. Heselmeyer K. Auer G. Backdahl M. Eriksson E. Linder S. Int. J. Cancer. 1994; 58: 830-835Crossref PubMed Scopus (77) Google Scholar, 8Chenard M.P. O'Siorain L. Shering S. Rouyer N. Lutz Y. Wolf C. Basset P. Bellocq J.P. Duffy M.J. Int. J. Cancer. 1996; 69: 448-451Crossref PubMed Scopus (96) Google Scholar, 9Porte H. Triboulet J.P. Kotelevets L. Carrat F. Prevot S. Nordlinger B. DiGioia Y. Wurtz A. Comoglio P. Gespach C. Chastre E. Clin. Cancer Res. 1998; 4: 1375-1382PubMed Google Scholar). ST3 has therefore been proposed as an attractive target for therapeutic approaches directed against the stromal compartment of human carcinomas (8Chenard M.P. O'Siorain L. Shering S. Rouyer N. Lutz Y. Wolf C. Basset P. Bellocq J.P. Duffy M.J. Int. J. Cancer. 1996; 69: 448-451Crossref PubMed Scopus (96) Google Scholar, 10Rouyer N. Wolf C. Chenard M.P. Rio M.C. Chambon P. Bellocq J.P. Basset P. Invasion Metastasis. 1994; 14: 269-275PubMed Google Scholar). However, this enzyme exhibits specific properties and both its regulation and its specific function at the tumor-stroma interface remain largely unknown. Although ST3 possesses the characteristic structure of MMPs, it does not degrade classic ECM components (11Noel A. Santavicca M. Stoll I. L'Hoir C. Staub A. Murphy G. Rio M.C. Basset P. J. Biol. Chem. 1995; 270: 22866-22872Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar) and its only known substrates are serine protease inhibitors (12Pei D. Majmudar G. Weiss S.J. J. Biol. Chem. 1994; 269: 25849-25855Abstract Full Text PDF PubMed Google Scholar) and the insulin-like growth factor-binding protein-1 (13Manes S. Mira E. Barbacid M.M. Cipres A. Fernandez-Resa P. Buesa J.M. Merida I. Aracil M. Marquez G. Martinez A.C. J. Biol. Chem. 1997; 272: 25706-25712Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). Moreover, unlike most of others MMPs that are secreted as inactive zymogens, the ST3 prodomain contains a recognition site for furin convertase, resulting in the secretion of a 45-kDa active enzyme (14Pei D. Weiss S.J. Nature. 1995; 375: 244-247Crossref PubMed Scopus (534) Google Scholar, 15Santavicca M. Noel A. Angliker H. Stoll I. Segain J.P. Anglard P. Chretien M. Seidah N. Basset P. Biochem. J. 1996; 315: 953-958Crossref PubMed Scopus (73) Google Scholar). The near uniform expression of ST3 in early stage tumors strongly suggested that it might participate in the initial development of carcinomas. In agreement with this hypothesis, ST3 expression has been associated with increased tumor take and incidence (16Noel A.C. Lefebvre O. Maquoi E. VanHoorde L. Chenard M.P. Mareel M. Foidart J.M. Basset P. Rio M.C. J. Clin. Investig. 1996; 97: 1924-1930Crossref PubMed Scopus (82) Google Scholar, 17Masson R. Lefebvre O. Noel A. Fahime M.E. Chenard M.P. Wendling C. Kebers F. LeMeur M. Dierich A. Foidart J.M. Basset P. Rio M.C. J. Cell Biol. 1998; 140: 1535-1541Crossref PubMed Scopus (257) Google Scholar, 18Noel A. Boulay A. Kebers F. Kannan R. Hajitou A. Calberg-Bacq C.M. Basset P. Rio M.C. Foidart J.M. Oncogene. 2000; 19: 1605-1612Crossref PubMed Scopus (65) Google Scholar) and a diminution of tumor cell apoptosis (19Boulay A. Masson R. Chenard M.P. Fahime ElM. Cassard L. Bellocq J.P. Sautes-Fridman C. Basset P. Rio M.C. Cancer Res. 2001; 61: 2189-2193PubMed Google Scholar, 20Wu E. Mari B.P. Wang F. Anderson I.C. Sunday M.E. Shipp M.A. J. Cell. Biochem. 2001; 82: 549-555Crossref PubMed Scopus (45) Google Scholar) in various experimental models of tumorigenesis. Our recent data have further confirmed and extended this new function by showing that active ST3 increases tumor cell survival via activation of the p42/p44 MAPK pathway (21Fromigue O. Louis K. Wu E. Belhacene N. Loubat A. Shipp M. Auberger P. Mari B. Int. J. Cancer. 2003; 106: 355-363Crossref PubMed Scopus (23) Google Scholar). In addition, other studies have recently shown that while ST3 promotes cancer cell implantation in connective tissue, its expression is also associated with a decrease in metastatic incidence, illustrating a dual role of this paracrine factor (22Andarawewa K.L. Boulay A. Masson R. Mathelin C. Stoll I. Tomasetto C. Chenard M.P. Gintz M. Bellocq J.P. Rio M.C. Cancer Res. 2003; 63: 5844-5849PubMed Google Scholar). At a molecular level, ST3 is induced by phorbol esters (23Luo D. Guerin E. Ludwig M.G. Stoll I. Basset P. Anglard P. J. Biol. Chem. 1999; 274: 37177-37185Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar), basic fibroblast growth factor, EGF and platelet-derived growth factor (24Basset P. Bellocq J.P. Wolf C. Stoll I. Hutin P. Limacher J.M. Podhajcer O.L. Chenard M.P. Rio M.C. Chambon P. Nature. 1990; 348: 699-704Crossref PubMed Scopus (1011) Google Scholar, 25Anderson I.C. Sugarbaker D.J. Ganju R.K. Tsarwhas D.G. Richards W.G. Sunday M. Kobzik L. Shipp M.A. Cancer Res. 1995; 55: 4120-4126PubMed Google Scholar), thyroid hormone (26Puzianowska-Kuznicka M. Damjanovski S. Shi Y.B. Mol. Cell. Biol. 1997; 17: 4738-4749Crossref PubMed Scopus (85) Google Scholar), transforming growth factor-β (27Delany A.M. Canalis E. Endocrinology. 2001; 142: 1561-1566Crossref PubMed Scopus (27) Google Scholar), and retinoic acid (28Guerin E. Ludwig M.G. Basset P. Anglard P. J. Biol. Chem. 1997; 272: 11088-11095Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar), a compound that usually represses the expression of other MMPs. The ST3 promoter strongly differs from that of other MMPs and contains three conserved regulatory elements including a C/EBP binding site (23Luo D. Guerin E. Ludwig M.G. Stoll I. Basset P. Anglard P. J. Biol. Chem. 1999; 274: 37177-37185Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar), several retinoic acid responsive elements, and a thyroid responsive element (29Ludwig M.G. Basset P. Anglard P. J. Biol. Chem. 2000; 275: 39981-39990Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). However, aside from thyroid and retinoic acid receptors that appear to control the expression of ST3 during the developmental processes associated with apoptosis (26Puzianowska-Kuznicka M. Damjanovski S. Shi Y.B. Mol. Cell. Biol. 1997; 17: 4738-4749Crossref PubMed Scopus (85) Google Scholar, 30Dupe V. Ghyselinck N.B. Thomazy V. Nagy L. Davies P.J. Chambon P. Mark M. Dev. Biol. 1999; 208: 30-43Crossref PubMed Scopus (96) Google Scholar), the factors regulating its expression in other physiological and pathological processes have not been identified. Tumor-stroma co-culture assays allow analysis of such a complex regulation in a model that resembles the in vivo situation observed in human carcinoma. Using such assays, we and others have demonstrated that the fibroblastic expression of ST3 required a direct contact between fibroblasts and tumor epithelial cells. In addition, its expression was not affected by neutralizing antibodies (Ab) directed against several growth factors including basic fibroblast growth factor, platelet-derived growth factor, EGF, and transforming growth factor-β (31Mari B.P. Anderson I.C. Mari S.E. Ning Y. Lutz Y. Kobzik L. Shipp M.A. J. Biol. Chem. 1998; 273: 618-626Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 32Wang C.S. Tetu B. Int. J. Cancer. 2002; 99: 792-799Crossref PubMed Scopus (23) Google Scholar), indicating that these growth factors are not involved. The nature of the tumor-associated factors initiating the stromal response, as well as the signaling pathways activated in fibroblasts and implicated in the induction of ST3 are still unknown. In the present study, we have therefore analyzed the signaling pathways activated in human fibroblasts following their interaction with cancer epithelial cells and we have shown that both classical and novel PKCs are central regulators of ST3 expression. Cell Culture and Treatments—The human fibroblast-like cells CCD-19Lu (CCL-210), derived from normal lung tissue, the human NSCLC cell line A549 and the rhabdomyosarcoma tumor cell line RD (CCL 136) were obtained from the American Type Culture Collection (Manassas, VA) and routinely cultured as previously described (23Luo D. Guerin E. Ludwig M.G. Stoll I. Basset P. Anglard P. J. Biol. Chem. 1999; 274: 37177-37185Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar). Direct co-culture was carried out as previously described (31Mari B.P. Anderson I.C. Mari S.E. Ning Y. Lutz Y. Kobzik L. Shipp M.A. J. Biol. Chem. 1998; 273: 618-626Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). PMA (Sigma) was used at 20 ng/ml. For inhibitory studies, drugs were added 15 min before treatments at the following concentrations: cycloheximide (Sigma), 10 μm; GF109203X (Calbiochem), 5 μm; Gö6976 (Calbiochem), 2–5 μm; PD98059 (Calbiochem), 15 μm; PP2 (Calbiochem), 10 μm; SB202190 (Calbiochem), 30 μm; SB203580 (Calbiochem), 15 μm; LY294002 (Calbiochem), 10 μm; U0126 (Promega), 10 μm. Northern Blot Analysis—Total RNAs were extracted by phenol/chloroform, separated on a 1% agarose/formaldehyde gel, transferred, and hybridized with [α-32P]dATP probes as previously described (33Fromigue O. Louis K. Dayem M. Milanini J. Pages G. Tartare-Deckert S. Ponzio G. Hofman P. Barbry P. Auberger P. Mari B. Oncogene. 2003; 22: 8487-8497Crossref PubMed Scopus (39) Google Scholar). Following exposure of the membranes to storage phosphorscreen, images were quantified using ImageQuant™ software (Amersham Biosciences). Western Blot Analysis—Conditioned media (CM) were concentrated 20-fold by ultrafiltration (Ultrafree 5K, Millipore Corp.). Cell monolayers were lysed in 50 mm HEPES, pH 7.4, 150 mm NaCl, 20 mm EDTA, 10 mm sodium orthovanadate, 100 mm NaF, 1% Triton X-100 for 30 min under agitation, and centrifuged for 10 min at 12,000 × g at 4 °C. Western blot analysis was performed as previously described (21Fromigue O. Louis K. Wu E. Belhacene N. Loubat A. Shipp M. Auberger P. Mari B. Int. J. Cancer. 2003; 106: 355-363Crossref PubMed Scopus (23) Google Scholar). Anti-ST3 mAb was described elsewhere (clone 1G4) (20Wu E. Mari B.P. Wang F. Anderson I.C. Sunday M.E. Shipp M.A. J. Cell. Biochem. 2001; 82: 549-555Crossref PubMed Scopus (45) Google Scholar). Isozyme-specific anti-PKC Ab were from Transduction Laboratories. Ab raised against phospho-p42/p44 came from New England Biolabs. Anti-c-Src Ab was from Santa Cruz Biotechnology. Anti-Myc mAb (clone 9E10) was provided by UBI. Other Abs were purchased from Cell Signaling. Transient Transfection and Cell Fractionation—Transient transfection of CCL-210 by constructs coding for hPKCα-GFP, hPKCϵ-GFP, and hPKCδ-GFP was performed with Exgen 500 (Euromedex, France) in 6-well plates as previously described (34Vallentin A. Prevostel C. Fauquier T. Bonnefont X. Joubert D. J. Biol. Chem. 2000; 275: 6014-6021Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar) (2 μg of ADN and 10 μl of Exgen/well). Twenty-four hours after transfection, 3 × 105 A549 tumor cells or PMA were added for different incubation times. Cells were washed with cold phosphate-buffered saline followed by scraping into homogenization buffer (10 mm Tris, pH 7.4, 2 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, and 1 μg/ml pepstatin). Cells were then sonicated at 4 °C (10 s, 3 times) and centrifuged for 30 min at 13,000 rpm. Supernatants were collected and correspond to the soluble fractions. Pellets, corresponding to the membrane fraction, were resuspended in homogenization buffer supplemented with 1% Nonidet P-40 and incubated for 45 min on ice. Both fractions were subjected to SDS-PAGE and Western blotting using an anti-GFP mAb (Roche Molecular Biochemicals). Transient Transfection and Observation of Fusion Protein Localization in Living Cells—CCL-210 cells were seeded on 12-mm round coverslips in 24-well plates and transfected with hPKC-GFP constructs as described elsewhere (0.5 μg of DNA and 2.5 μl of Exgen-500/well). Twenty-four hours later, cells were stimulated with either PMA or addition of 106 A549 tumor cells. The localization of fusion proteins in living cells was examined by conventional or confocal fluorescence microscopy at different times following stimulation as previously described (35Vallentin A. Lo T.C. Joubert D. Mol. Cell. Biol. 2001; 21: 3351-3363Crossref PubMed Scopus (31) Google Scholar). siRNA Transfections—Cells were transfected with siRNAs duplexes at a final concentration of 100 nm in 6-well plates using the siImporter reagent (Upstate) 48 h before treatment, according to the manufacturer recommendations. PKCα and PKCϵ siRNAs were purchased from Upstate. PKCδ siRNA duplex (5′-CGACAAGAUCAUCGGCAGATT-3′) (36Irie N. Sakai N. Ueyama T. Kajimoto T. Shirai Y. Saito N. Biochem. Biophys. Res. Commun. 2002; 298: 738-743Crossref PubMed Scopus (48) Google Scholar) was synthesized and purified by Eurogentec. Construction of Plasmids Encoding Constitutively Active (CA)/Dominant Negative (DN) PKC Isoforms and CA c-Src—cDNAs coding for rat CA PKCϵA159E and DN PKCϵK436R (37Maulon L. Mari B. Bertolotto C. Ricci J.E. Luciano F. Belhacene N. Deckert M. Baier G. Auberger P. Oncogene. 2001; 20: 1964-1972Crossref PubMed Scopus (31) Google Scholar) (kindly provided by Dr. Gottfried Baier) were amplified with the following synthetic oligonucleotide primers (sense: 5′-ACCATGGTAGTGTTCAATGGCCTT-3′; antisense: GGGCATCAGGTCTTCACCAAA), subcloned into PCRscript, digested by KpnI/NotI, and finally subcloned into the Tet-inducible vector pCDNA4/TO (Invitrogen). Plasmid containing human PKCα-EGFP cDNA (PKCα-EGFP Mercury™ probe, Clontech) was digested with SacII/XhoI to extract PKCα and the resulting insert was cloned into the pCDNA4/TO vector. Single mutations were introduced to generate CA PKCαA25E and DN PKCαK368R with the QuikChange™ site-directed mutagenesis kit (Stratagene) using the following mutation oligonucleotides primers: CA PKCα, sense: 5′-CCCGCAAAGGGGAGCTGAGGCAGAAG-3′, antisense: 5′-CTTCTGCCTCAGCTCCCCTTTGCGGG-3′; DN PKCα, sense: 5′-GAACTGTATGCAATCAGAATCCTGAAGAAGGATGTGG-3′, antisense: 5′-CCACATCCTTCTTCAGGATTCTGATTGCATACAGTTC-3′. cDNA coding for PKCδ was amplified by reverse transcriptase-PCR from RD cells mRNA using the following primers (sense: 5′-ACCATG-GCGCGTTCCTGCGCATC-3′; antisense: 5′-ATCTTCCAGGAGGTGCT-CGAATTT-3′), ligated into the PCRscript plasmid, digested with Eco-RV/NotI, and finally subcloned into pcDNA4/TO plasmid. Single mutations were introduced to generate CA PKCδA148E and DN PKCδK379R as described above using the following mutation oligonucleotide primers: CA PKCδ, sense, 5′-GAACCGCCGCGGAGAAATCAAACAGGCCA-AAATCC-3′, antisense, 5′-GGATTTTGGCCTGTTTGATTTCTCCGCG-GCGGTTC-3′; DN PKCδ, sense, 5′-GTACTTTGCCATCAGGGCCCTC-AAGAAGG-3′, antisense, 5′-CCTTCTTGAGGGCCCTGATGGCAAAG-TAC-3′. All constructions were entirely sequenced. c-Src cDNA was extracted with XbaI from pSG5 plasmid containing chicken CA c-Src Y527F cDNA (kindly provided by Sarah Courtneidge, San Francisco, CA), ligated into PCRscript plasmid, digested by EcoRI and finally subcloned into pcDNA4/TO plasmid. Generation of Stable RD Transfectants Expressing Tetracycline-inducible CA/DN Forms of PKCs and c-Src—T-REX™ system (Invitrogen Corp.) was used to obtain a Tet-induced expression system in RD cells. We first established a stable cell line that constitutively expressed the Tet repressor by RD cells electroporation (400 V, 125 μF) with the pcDNA6/TR plasmid followed by selection with 10 μg/ml blasticidin. Twenty independent subclones were expanded and tested for Tet-inducible gene expression by transient transfection with a positive control plasmid expressing β-galactosidase. The clone with the lowest level of basal transcription and the highest level of β-galactosidase expression after addition of Tet was selected for subsequent transfection with the different expression plasmids (RD-TR cells). RD-TR cells were electroporated with the different kinase constructs described above and a second selection was performed using 5 μg/ml blasticidin and 200 μg/ml Zeocin. Following selection, positive clones were routinely cultured in Dulbecco's modified Eagle's medium, 10% fetal calf serum supplemented with 2.5 μg/ml blasticidin and 200 μg/ml Zeocin and expanded. In all experiments, at least two independent clones were analyzed for each construct. Stimulation of Stable RD Transfectants Expressing Tetracycline-inducible Kinases—RD-TR clones expressing the CA or DN forms of kinases were stimulated by either 20 ng/ml PMA, 4 μg/ml Tet, or a combination of the 2 drugs in the absence of serum. At different times following stimulation, CM were harvested and cells were lysed as described elsewhere. Transient Transfection of RD-TR Cells and Luciferase Assay— RD-TR cells at 80% confluence in 6-well dishes were transiently transfected with Exgen-500 using luciferase reporter plasmid 2.5-ST3-LUC (–2447 to +15) (23Luo D. Guerin E. Ludwig M.G. Stoll I. Basset P. Anglard P. J. Biol. Chem. 1999; 274: 37177-37185Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar) or a control pGL3-Basic reporter plasmid. Eighteen hours after transfection, cells were washed twice with phosphate-buffered saline and stimulated by either 20 ng/ml PMA, 4 μg/ml Tet, or a combination of the 2 drugs in the absence of serum for 32 h before determination of luciferase activity, as previously described (21Fromigue O. Louis K. Wu E. Belhacene N. Loubat A. Shipp M. Auberger P. Mari B. Int. J. Cancer. 2003; 106: 355-363Crossref PubMed Scopus (23) Google Scholar). Statistical Analysis—Results are expressed as mean ± S.D. and statistical analysis was performed using the Student's t test with a statistical significance of at least p < 0.05. Time Course of ST3 Induction in Normal Human Pulmonary Fibroblasts following Co-culture with NSCLC A549 Cells— Using a co-culture assay in which A549 cells are grown on a monolayer of normal pulmonary fibroblasts, we had previously shown that direct contact between the two cell types specifically induces ST3 mRNA in fibroblasts (31Mari B.P. Anderson I.C. Mari S.E. Ning Y. Lutz Y. Kobzik L. Shipp M.A. J. Biol. Chem. 1998; 273: 618-626Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). To determine the mechanism leading to ST3 expression in these conditions, the induction kinetic of ST3 mRNA in co-culture was compared with that of fibroblasts treated with the phorbol ester (PMA), whose AP1-independent transcriptional activation has been demonstrated (23Luo D. Guerin E. Ludwig M.G. Stoll I. Basset P. Anglard P. J. Biol. Chem. 1999; 274: 37177-37185Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar). As shown in Fig. 1A, the induction pattern of ST3 was similar in both conditions, with no detectable levels of mRNA before 24 h and a stable expression of the transcript after 32 h. Because PMA-mediated induction of ST3 is dependent on de novo protein synthesis (23Luo D. Guerin E. Ludwig M.G. Stoll I. Basset P. Anglard P. J. Biol. Chem. 1999; 274: 37177-37185Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar), we examined the effect of cycloheximide on ST3 induction in the tumor-stroma co-culture. As shown in Fig. 1B, cycloheximide totally blocked ST3 transcript induction in both co-culture and PMA conditions, indicating that the fibroblastic induction of ST3 by cancer cells also requires protein neosynthesis. Effect of Major Signaling Pathways Inhibitors on PMA- and Co-culture-mediated ST3 Induction—To determine the potential role of specific signaling pathways in PMA or co-culture-mediated ST3 induction, we tested known inhibitors of kinases for their ability to affect ST3 expression (Fig. 2). TIMP-1, a gene constitutively expressed in both fibroblasts and A549, was used as an internal control and its expression was evaluated by Northern blot analysis together with that of ST3 (Fig. 2A). The induction of ST3, observed after 32 h stimulation by PMA or co-culture, was totally abolished by GF109203X, an inhibitor of both conventional (cPKC) and novel PKCs (nPKC) but only partially by the cPKC inhibitor Gö6976 (Fig. 2, A and B). SB203580, a selective inhibitor of p38 MAPK had a low but significant inhibitory effect on ST3 induction, an effect that was more pronounced with SB202190, a dual inhibitor of p38 and JNK kinases. No alteration of ST3 expression was observed in the presence of the MEK inhibitor PD98059, indicating that p42/p44 MAPK was not involved in this process. Similar findings were obtained in the presence of the selective phosphoinositide 3-kinase inhibitor LY294002. Interestingly, treatment with the Src kinase inhibitor PP2 led to a significant increase in ST3 transcript in co-culture (+80%, Fig. 2B). Concerning TIMP-1 transcript level, GF109203X abrogated PMA-mediated induction, whereas other inhibitors had no significant effect (Fig. 2A, left panel). As previously described, the level of the TIMP-1 transcript did not vary in co-culture conditions (33Fromigue O. Louis K. Dayem M. Milanini J. Pages G. Tartare-Deckert S. Ponzio G. Hofman P. Barbry P. Auberger P. Mari B. Oncogene. 2003; 22: 8487-8497Crossref PubMed Scopus (39) Google Scholar) and none of these inhibitors significantly affected its level, thereby indicating that these drugs had no toxic effect under these conditions (Fig. 2A, right panel). To test the effect of these various kinase inhibitors at the protein level, analysis of conditioned media from 48-h stimulated fibroblasts was performed by Western blot in the same conditions (Fig. 2C). No ST3 secretion was detected in the medium of the NSCLC cell line cultured alone (data not shown). Consistent with the transcriptional activation of the ST3 gene observed in Fig. 2A, a major secreted ST3 species of 45 kDa was detected in fibroblasts exposed to PMA or to the NSCLC cancer epithelial cells. This 45-kDa secreted ST3 results from the intracellular cleavage of the inactive ST3 precursor pro-enzyme by furin (14Pei D. Weiss S.J. Nature. 1995; 375: 244-247Crossref PubMed Scopus (534) Google Scholar). Its activity was previously demonstrated for the purified recombinant enzyme (11Noel A. Santavicca M. Stoll I. L'Hoir C. Staub A. Murphy G. Rio M.C. Basset P. J. Biol. Chem. 1995; 270: 22866-22872Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 12Pei D. Majmudar G. Weiss S.J. J. Biol. Chem. 1994; 269: 25849-25855Abstract Full Text PDF PubMed Google Scholar, 13Manes S. Mira E. Barbacid M.M. Cipres A. Fernandez-Resa P. Buesa J.M. Merida I. Aracil M. Marquez G. Martinez A.C. J. Biol. Chem. 1997; 272: 25706-25712Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar), as well as for the enzyme secreted in the same co-cultures as those used in the present study (31Mari B.P. Anderson I.C. Mari S.E. Ning Y. Lutz Y. Kobzik L. Shipp M.A. J. Biol. Chem. 1998; 273: 618-626Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). The secretion of this active 45-kDa ST3 enzyme (E) was significantly inhibited by PKC inhibitors and to a lesser extent by stress kinase inhibitors in co-culture conditions, whereas it was induced by the Src kinase inhibitor PP2 (Fig. 2C), demonstrating that alteration of the ST3 transcript level also results in a similar modification of the amount of active enzyme in conditioned media. Altogether, these data indicate that PMA and co-culture-dependent ST3 induction require common signaling pathways, involving essentially c- and nPKCs and stress-activated kinases, whereas Src kinases exerted an inhibitory action. Finally, similar results were obtained by using other tumor cell types (breast tumor cell line MCF-7, squamous tumor of the tongue CAL-33) or other fibroblasts (fetal human fibroblasts CCL-153, infiltrated fibroblasts from the CAL 33 carcinoma) (data not shown), indicating that this mechanism is not restricted to a specific type of cancer cells or fibroblasts. Specific Accumulation of Fibroblast PKCα- and PKCϵ-GFP at the Cell-Cell Contact with Tumor Cells—Because activation of c- and nPKCs isoforms is likely to represent an early and central event in the control of ST3 expression, we analyzed the expression and the potential relocalization of several PKC isoforms in normal fibroblasts cultured alone or co-cultured with NSCLC cells. Western blot analysis using specific Abs directed against the main isoforms of c- and nPKCs indicated that PKCα, PKCϵ, and PKCδ are constitutively expressed in fibroblasts (Fig. 3A). These 3 isoforms are also present in the epithelial tumor cells A549, with PKCδ being mainly produced as a 42-kDa fragment that is likely to correspond to its C-terminal catalytic fragment (38Emoto Y. Manome Y. Meinhardt G. Kisaki H. Kharband

Referência(s)