Cyclin-Dependent Kinase 5 Is a Regulator of Podocyte Differentiation, Proliferation, and Morphology
2004; Elsevier BV; Volume: 165; Issue: 4 Linguagem: Inglês
10.1016/s0002-9440(10)63378-0
ISSN1525-2191
AutoresSiân Griffin, Keiju Hiromura, Jeffrey W. Pippin, Arndt T. Petermann, Mary Blonski, Ron Krofft, Satoru Takahashi, Ashok B. Kulkarni, Stuart J. Shankland,
Tópico(s)Microtubule and mitosis dynamics
ResumoPodocytes are highly specialized and terminally differentiated glomerular cells that play a vital role in renal physiology, including the prevention of proteinuria. Cyclin-dependent kinase 5 (CDK5) has been shown to influence several cellular processes in other terminally differentiated cells, in particular neurons. In this study, we examined the role of CDK5 in podocyte differentiation, proliferation, and morphology. In conditionally immortalized mouse podocytes in culture, CDK5 increased in association with podocyte differentiation. During mouse glomerulogenesis in vivo, CDK5 expression was predominantly detected in podocytes from the capillary loop stage to maturation and persisted in the podocytes of adult glomeruli. In contrast, CDK5 was markedly decreased in the proliferating and dedifferentiated podocytes of mice with anti-glomerular basement membrane nephritis and in human immunodeficiency virus transgenic mice. p35, the activator of CDK5, was also detected in podocytes and the p35/CDK5 complex was active. Cell fractionation studies showed that active p35/CDK5 was mainly localized to the plasma membrane. Specific inhibition of CDK5 in differentiated cultured podocytes, either pharmacologically or with siRNA, induced shape changes, with cellular elongation and loss of process formation compared to the characteristic arborized phenotype. These data suggest a role for CDK5 as a regulator of podocyte differentiation, proliferation, and morphology. Podocytes are highly specialized and terminally differentiated glomerular cells that play a vital role in renal physiology, including the prevention of proteinuria. Cyclin-dependent kinase 5 (CDK5) has been shown to influence several cellular processes in other terminally differentiated cells, in particular neurons. In this study, we examined the role of CDK5 in podocyte differentiation, proliferation, and morphology. In conditionally immortalized mouse podocytes in culture, CDK5 increased in association with podocyte differentiation. During mouse glomerulogenesis in vivo, CDK5 expression was predominantly detected in podocytes from the capillary loop stage to maturation and persisted in the podocytes of adult glomeruli. In contrast, CDK5 was markedly decreased in the proliferating and dedifferentiated podocytes of mice with anti-glomerular basement membrane nephritis and in human immunodeficiency virus transgenic mice. p35, the activator of CDK5, was also detected in podocytes and the p35/CDK5 complex was active. Cell fractionation studies showed that active p35/CDK5 was mainly localized to the plasma membrane. Specific inhibition of CDK5 in differentiated cultured podocytes, either pharmacologically or with siRNA, induced shape changes, with cellular elongation and loss of process formation compared to the characteristic arborized phenotype. These data suggest a role for CDK5 as a regulator of podocyte differentiation, proliferation, and morphology. Podocytes, also called visceral glomerular epithelial cells, are terminally differentiated cells overlying the outer aspect of the glomerular basement membrane of renal glomeruli. Podocytes have several key functions, including the prevention of proteinuria, synthesis of basement membrane components, regulation of glomerular filtration, and counteraction of the intraglomerular hydrostatic pressure.1Pavenstadt H Kriz W Kretzler M Cell biology of the glomerular podocyte.Physiol Rev. 2003; 83: 253-307PubMed Google Scholar Injury to podocytes is associated with proteinuria and progressive glomerulosclerosis.2Kriz W Podocyte is the major culprit accounting for the progression of chronic renal disease.Microsc Res Tech. 2002; 57: 189-195Crossref PubMed Scopus (150) Google Scholar Podocytes derive from epithelial cells originating in the metanephric mesenchyme, which develop into postmitotic terminally differentiated cells,3Kreidberg JA Podocyte development and glomerulogenesis.J Am Soc Nephrol. 2003; 14: 806-814Crossref PubMed Scopus (82) Google Scholar and therefore have similarities to neurons.4Kobayashi N Mechanism of the process formation; podocytes vs. neurons.Microsc Res Tech. 2002; 57: 217-223Crossref PubMed Scopus (61) Google Scholar During glomerulogenesis, podocytes proliferate until the S-shape body stage, and exit the cell cycle at the capillary loop stage.5Combs HL Shankland SJ Setzer SV Hudkins KL Alpers CE Expression of the cyclin kinase inhibitor p27kip1 in developing and mature human kidney.Kidney Int. 1998; 53: 892-896Crossref PubMed Scopus (64) Google Scholar, 6Nagata M Shibata S Shigeta M Yu-Ming S Watanabe T Cyclin-dependent kinase inhibitors: p27kip1 and p57kip2 expression during human podocyte differentiation.Nephrol Dial Transplant. 1999; 14: 48-51Crossref PubMed Scopus (9) Google Scholar Podocytes then acquire their fully differentiated phenotype, a process that in the mouse is not complete until 1 week after birth. Mature podocytes tightly regulate and maintain their quiescent and differentiated phenotype, and therefore the majority of diseases involving podocytes are not associated with proliferation and an increase in cellularity. Indeed, studies have shown that the inability to proliferate contributes to glomerular scarring.7Mundel P Shankland SJ Podocyte biology and response to injury.J Am Soc Nephrol. 2002; 13: 3005-3015Crossref PubMed Scopus (573) Google Scholar In contrast, podocytes may dedifferentiate, and proliferate, in human immunodeficiency virus (HIV)-associated nephropathy, which is characterized by a rapid decline in renal function, emphasizing the importance of podocyte quiescence for glomerular function.8Barisoni L Kriz W Mundel P D'Agati V The dysregulated podocyte phenotype: a novel concept in the pathogenesis of collapsing idiopathic focal segmental glomerulosclerosis and HIV-associated nephropathy.J Am Soc Nephrol. 1999; 10: 51-61Crossref PubMed Scopus (4) Google Scholar These studies show that the state of podocyte differentiation is closely linked with its proliferative potential. Studies have also shown that podocyte morphology is critical for normal function.9Shirato I Podocyte process effacement in vivo.Microsc Res Tech. 2002; 57: 241-246Crossref PubMed Scopus (40) Google Scholar, 10Kriz W Kretzler M Provoost AP Shirato I Stability and leakiness: opposing challenges to the glomerulus.Kidney Int. 1996; 49: 1570-1574Crossref PubMed Scopus (43) Google Scholar After injury, flattening and effacement of podocytes leads to loss of normal function. Proliferation and differentiation are controlled by specific cell cycle regulatory proteins.11Griffin SV Pichler R Wada T Vaughan M Durvasula R Shankland SJ The role of cell cycle proteins in glomerular disease.Semin Nephrol. 2003; 23: 569-582Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar Cyclins bind to and activate their partner cyclin-dependent kinases (CDK). Cyclin-CDK complexes are inhibited by CDK inhibitors. In contrast to the classical, cell cycle-associated CDKs, CDK5 accumulates in postmitotic cells.12Dhavan R Tsai LH A decade of cdk5.Nat Rev Mol Cell Biol. 2001; 2: 749-759Crossref PubMed Scopus (931) Google Scholar CDK5 was originally isolated on the basis of its close primary sequence homology to the human Cdc2 serine threonine kinase.13Tsai LH Takahashi T Caviness Jr, VS Harlow E Activity and expression pattern of cyclin-dependent kinase 5 in the embryonic mouse nervous system.Development. 1993; 119: 1029-1040Crossref PubMed Google Scholar The brain has the highest levels of CDK5 activity, because of the expression of its regulatory partner, p35.14Lew J Huang QQ Qi Z Winkfein RJ Aebersold R Hunt T Wang JH A brain-specific activator of cyclin-dependent kinase 5.Nature. 1994; 371: 423-426Crossref PubMed Scopus (536) Google Scholar Although CDK5 activity does not promote cell cycle progression,13Tsai LH Takahashi T Caviness Jr, VS Harlow E Activity and expression pattern of cyclin-dependent kinase 5 in the embryonic mouse nervous system.Development. 1993; 119: 1029-1040Crossref PubMed Google Scholar it has a crucial role in the direction of neuronal migration in the developing central nervous system.12Dhavan R Tsai LH A decade of cdk5.Nat Rev Mol Cell Biol. 2001; 2: 749-759Crossref PubMed Scopus (931) Google Scholar Dysregulation of CDK5 activity has been closely linked to specific neurodegenerative diseases, including Alzheimer's disease and amyotrophic lateral sclerosis.15Patrick GN Zukerberg L Nikolic M de la Monte S Dikkes P Tsai LH Conversion of p35 to p25 deregulates Cdk5 activity and promotes neurodegeneration.Nature. 1999; 402: 615-622Crossref PubMed Scopus (1297) Google Scholar, 16Nguyen MD Lariviere RC Julien JP Deregulation of Cdk5 in a mouse model of ALS: toxicity alleviated by perikaryal neurofilament inclusions.Neuron. 2001; 30: 135-147Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar Although CDK5 function was originally thought to be restricted to the nervous system, several groups have recently demonstrated that CDK5 is also active in nonneuronal tissue, including muscle, lens, and hematopoietic cells.12Dhavan R Tsai LH A decade of cdk5.Nat Rev Mol Cell Biol. 2001; 2: 749-759Crossref PubMed Scopus (931) Google Scholar In these cells, CDK5 activity is critical for development and differentiation. In the current study we measured the expression and role of active CDK5/p35 in podocytes in vitro and in vivo. Our results show that CDK5 increases in podocytes during differentiation in culture, and in developing fetal kidneys. CDK5 declines in experimental diseases associated with podocyte proliferation. The CDK5 activator p35 is also expressed in podocytes, and the active complex is principally localized to the plasma membrane. Finally, we demonstrate that a novel role for CDK5 is to maintain podocyte morphology. Mouse monoclonal anti-CDK5 antibody (Ab-4; NeoMarkers, Fremont, CA) was used for immunohistochemical (1:50) and immunofluorescent (1:20) studies and Western blot analysis (1:500). Rabbit polyclonal anti-CDK5 antibody (C-8, 1:50; Santa Cruz Biotechnology, Santa Cruz, CA) was used for the histone H1 kinase assay. Rabbit polyclonal anti-p35 antibody (C-19; Santa Cruz Biotechnology) was used for immunohistochemical (1:500) and immunofluorescent (1:100) studies and histone H1 kinase assay (1:50). Mouse monoclonal anti-actin (Chemicon, Temecula, CA) was used for immunofluorescent studies (1:200) and Western blot analysis (1:4000). Mouse monoclonal anti-cyclin B1 antibody (GNS1, 1:200; Santa Cruz Biotechnology), rabbit polyclonal anti-cyclin A antibody (C-19, 1:1000; Santa Cruz Biotechnology), and monoclonal anti-GAPDH antibody (6C5, 1:8000, Abcam, Cambridge, UK) were used for Western blotting. To determine the expression and potential role of CDK5 in podocytes in vitro, we used a conditionally immortalized mouse podocyte cell line that was isolated from the kidneys of H-2Kb-tsA58 transgenic mice as previously described.17Mundel P Reiser J Zuniga Mejia Borja A Pavenstadt H Davidson GR Kriz W Zeller R Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte lines.Exp Cell Res. 1997; 236: 248-258Crossref PubMed Scopus (754) Google Scholar In this cell line, a temperature-sensitive SV40 large T-cell antigen (tsA58 Tag) is controlled by a γ-interferon inducible H-2Kb promoter. To induce proliferation (and therefore dedifferentiation), cells were grown on collagen I (BD Biosciences, Bedford, MA)-coated plastic plates (Primaria tissue culture dish, 100 × 20 mm; Becton Dickinson Labware, Franklin Lakes, NJ), at 33°C in RPMI 1640 culture medium (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% fetal calf serum (Summit Biotechnology, Ft. Collins, CO), 2 mmol/L glutamine (Sigma, St. Louis, MO), 10 mmol/L HEPES (Sigma), 1 mmol/L sodium pyruvate (Irvine Scientific, Santa Ana, CA), and 100 U/ml penicillin and 100 μg/ml streptomycin (Irvine Scientific), to which recombinant mouse γ-interferon 10 U/ml (Coulter, Hialeah, FL) was added (growth permissive conditions). To induce quiescence and the differentiated phenotype, cells were grown at 37°C in the same medium with no γ-interferon (growth restrictive conditions). All experiments were performed at least three times. Unless specified otherwise, all studies were performed on day 3 in cells growing under permissive (proliferating/dedifferentiated) conditions, and on days 10 to 14 for cells grown under restrictive (quiescent/differentiated) conditions. To inhibit CDK5 activity, selective and potent CDK5 inhibitors, roscovitine18Meijer L, Borgne A, Mulner O, Chong JP, Blow JJ, Inagaki N, Inagaki M, Delcros JG, Moulinoux JP: Biochemical and cellular effects of roscovitine, a potent and selective inhibitor of the cyclin dependent kinases cdc2, cdk2 and cdk5. Eur J Biochem, 243:527–536Google Scholar (50 μmol/L; Calbiochem Novabiochem, San Diego, CA) or alsterpaullone19Leost M Schultz C Link A Wu YZ Biernat J Mandelkow EM Bibb JA Snyder GL Greengard P Zaharevitz DW Gussio R Senderowicz AM Sausville EA Kunick C Meijer L Paullones are potent inhibitors of glycogen synthase kinase-3beta and cyclin-dependent kinase 5/p25.Eur J Biochem. 2000; 267: 5983-5994Crossref PubMed Scopus (333) Google Scholar (5 μmol/L; Alexis Biochemicals, San Diego, CA) were used. Double-stranded CDK5 small interfering RNA (siRNA) was synthesized by in vitro transcription using the Silencer siRNA construction kit (Ambion, Austin, TX) according to the manufacturer's instructions. All of the molecular biology reagents described below were supplied with this kit. The CDK5 target mRNA sequence was 5′ AATGGCCTGCCATGACCAAGC 3′. Sense and anti-sense siRNA oligonucleotide templates with a 3′ 8-nucleotide sequence complimentary to the T7 RNA polymerase promoter were obtained from Invitrogen (Carlsbad, CA) (sense: 5′ AAGCTTGGTCATGGCAGGCCACCTGTCTC 3′; anti-sense: 5′ AATGGCCTGCCATGACCCCGCCCTGTCTC 3′). Briefly, the oligonucleotide templates were hybridized to a T7 promoter primer, and the 3′ ends extended using Klenow. The sense and anti-sense siRNA templates were transcribed by T7 RNA polymerase and the resulting RNA transcripts hybridized to create dsRNA, consisting of 5′ terminal single-stranded leader sequences, a 19-nucleotide target-specific dsRNA, and 3′ terminal UUs. The leader sequences were removed by digestion with a single-strand-specific ribonuclease, and the DNA template digested by deoxyribonuclease. The resulting siRNA was purified by glass fiber filter binding and elution, and the concentration determined by measuring the absorbance at 260 nm. A scrambled siRNA sequence was included with the kit and used as a negative control to exclude nonspecific effects on gene expression. CDK5-specific and control siRNA were spiked with random 20-mer fluorescein isothiocyanate-conjugated oligonucleotides (TriLink BioTech, San Diego, CA) and transfected into 50% confluent conditionally immortalized mouse podocytes at day 3 of growth restriction using the n-fect transfection reagent, according to the manufacturer's instructions (Neuromics, Northfield, MN). After 48 hours, transfection was confirmed by uptake of fluorescein isothiocyanate-conjugated oligonucleotides, cell morphology analyzed by light microscopy before fixation, and protein harvested for Western blotting. To determine the temporal expression of CDK5 during podocyte development by immunostaining (see below), embryonal kidneys were harvested from gravid C57BL6 mice (Simonsen, Gilroy, CA) at embryonic (E) days 15 and 18 as previously described.20Hiromura K Haseley LA Zhang P Monkawa T Durvasula R Petermann AT Alpers CE Mundel P Shankland SJ Podocyte expression of the CDK-inhibitor p57 during development and disease.Kidney Int. 2001; 60: 2235-2246Crossref PubMed Scopus (80) Google Scholar Kidneys were also harvested from normal adult C57BL6 mice and Wistar rats (2 to 4 months old; Simonsen). To examine the role of CDK5 in renal development, kidneys were studied from CDK5−/− and CDK5+/+ mice at day E18. The generation of these mice has been reported previously.21Ohshima T Ward JM Huh CG Longenecker G Veeranna Pant HC Brady RO Martin LJ Kulkarni AB Targeted disruption of the cyclin-dependent kinase 5 gene results in abnormal corticogenesis, neuronal pathology and perinatal death.Proc Natl Acad Sci USA. 1996; 93: 11173-11178Crossref PubMed Scopus (798) Google Scholar Kidneys were fixed in 10% buffered formalin for immunohistochemistry (see below). To examine the expression of CDK5 in podocytes after injury, we studied three models of glomerular disease. 1) Anti-glomerular basement membrane (GBM) glomerulonephritis, characterized by podocyte injury, was induced in p21−/− and p21+/+ mice as previously described.22Kim YG Alpers CE Brugarolas J Johnson RJ Couser WG Shankland SJ The cyclin kinase inhibitor p21CIP1/WAF1 limits glomerular epithelial cell proliferation in experimental glomerulonephritis.Kidney Int. 1999; 55: 2349-2361Crossref PubMed Scopus (71) Google Scholar In brief, a sheep anti-rabbit GBM antibody was injected intraperitoneally (0.5 ml/20 g body weight) on 2 consecutive days, and animals were studied on days 5 and 14 (n = 4 and n = 6). 2) HIV-1 transgenic mice (a gift of Dr. Jeffrey Kopp), characterized by HIV-associated nephropathy and podocyte injury, were created by introducing proviral HIV genome, lacking the gag and pol genes, into FVB/N mice, as previously described.23Kopp JB Klotman ME Adler SH Bruggeman LA Dickie P Marinos NJ Eckhaus M Bryant JL Notkins AL Klotman PE Progressive glomerulosclerosis and enhanced renal accumulation of basement membrane components in mice transgenic for human immunodeficiency virus type 1 genes.Proc Natl Acad Sci USA. 1992; 89: 1577-1581Crossref PubMed Scopus (276) Google Scholar Kidneys were examined at 10 weeks after birth (n = 4). 3) The Habu snake venom model of mesangial cell injury was induced in C57BL6/129SV mice by injection of Habu snake venom (4 mg/kg; Sigma) through the tail vein (n = 3).24Nakao N Hiraiwa N Yoshiki A Ike F Kusakabe M Tenascin-C promotes healing of Habu-snake venom-induced glomerulonephritis: studies in knockout congenic mice and in culture.Am J Pathol. 1998; 152: 1237-1245PubMed Google Scholar This disease model was used as a control, because podocytes are not the primary target of injury. To determine the expression of specific proteins by immunostaining, cultured podocytes were grown on eight-well Permanox chamber slides (Nalge Nunc, Naperville, IL) and fixed in methanol and acetone (1:1) at −20°C for 30 minutes. Cells were incubated overnight at 4°C with primary antibodies for CDK5, p35, or actin diluted in 1% bovine serum albumin in phosphate-buffered saline (PBS). A secondary biotinylated anti-mouse IgG or anti-rabbit IgG (Vector, Burlingame, CA) was incubated at room temperature for 30 minutes. Immunofluorescent staining was detected by streptavidin-Alexa Fluor 594 (Molecular Probes, Eugene, OR) for CDK5 and actin, and by streptavidin-fluorescein (Amersham Pharmacia Biotech, Piscataway, NJ) for p35. Indirect immunoperoxidase immunostaining was performed on formalin-fixed paraffin-embedded kidney specimens from embryonal, normal, and diseased mice as previously described.20Hiromura K Haseley LA Zhang P Monkawa T Durvasula R Petermann AT Alpers CE Mundel P Shankland SJ Podocyte expression of the CDK-inhibitor p57 during development and disease.Kidney Int. 2001; 60: 2235-2246Crossref PubMed Scopus (80) Google Scholar Briefly, 4-μm cut tissue sections were deparaffinized in Histo-Clear (National Diagnostics, Atlanta, GA) and rehydrated in graded ethanol. Antigen retrieval was performed by boiling tissues for 10 minutes in 10 mmol/L citric acid, and endogenous peroxidases were blocked with 3% hydrogen peroxide. Endogenous biotin was blocked using an Avidin/Biotin blocking kit (Vector). Sections were incubated overnight with the primary antibody diluted in 1% bovine serum albumin in PBS. The sections were washed repeatedly in PBS before incubation with the appropriate biotinylated secondary antibody (Vector), diluted in 1% bovine serum albumin in PBS, for 1 hour at room temperature. The ABC-Elite reagent (Vector) was used for signal amplification and 3,3′-diaminobenzidine (Sigma) with nickel enhancement was used as chromogen. Slides were counterstained with methyl green or hematoxylin and eosin, dehydrated, and coverslipped. Protein was extracted from cultured mouse podocytes20Hiromura K Haseley LA Zhang P Monkawa T Durvasula R Petermann AT Alpers CE Mundel P Shankland SJ Podocyte expression of the CDK-inhibitor p57 during development and disease.Kidney Int. 2001; 60: 2235-2246Crossref PubMed Scopus (80) Google Scholar and from glomeruli isolated from normal adult rats25Shankland SJ Hugo C Coats SR Nangaku M Pichler RH Gordon KL Pippin J Roberts JM Couser WG Johnson RJ Changes in cell-cycle protein expression during experimental mesangial proliferative glomerulonephritis.Kidney Int. 1996; 50: 1230-1239Crossref PubMed Scopus (103) Google Scholar using TG buffer (1% Triton, 10% glycerol, 20 mmol/L HEPES, 100 mmol/L NaCl) with protease inhibitors (Boehringer Mannheim, Indianapolis, IN), or buffer A (20 mmol/L Tris-HCl, pH 7.2, 2 mmol/L MgCl2, 0.5% Nonidet P-40, 150 mmol/L NaCl, 1 mmol/L dithiothreitol) with protease inhibitors. Rats were used instead of mice to yield a highly purified preparation of glomeruli with minimal tubular contamination, a frequent problem when isolating mouse glomeruli. Protein concentration was determined by the BCA protein assay (Pierce, Rockford, IL) according to the manufacturer's directions. To determine the subcellular localization of the active p35/CDK5 complex, proteins from the cytoplasmic and crude membrane fractions were isolated using a modification of a published method.26Nikolic M Tsai LH Activity and regulation of p35/Cdk5 kinase complex.Methods Enzymol. 2000; 325: 200-213Crossref PubMed Google Scholar, 27Nikolic M Chou MM Lu W Mayer BJ Tsai LH The p35/Cdk5 kinase is a neuron-specific Rac effector that inhibits Pak1 activity.Nature. 1998; 395: 194-198Crossref PubMed Scopus (350) Google Scholar Cells were harvested by trypsin digestion, rinsed with cold PBS, and placed on ice for 15 minutes in hypotonic buffer (10 mmol/L HEPES, pH 7.9, 10 mmol/L KCl, 0.1 mmol/L EDTA, 0.1 mmol/L EGTA, 1 mmol/L dithiothreitol, 0.5 mmol/L phenylmethyl sulfonyl fluoride) and protease inhibitors. After homogenization with a Dounce-type homogenizer 30 times, the lysate was centrifuged for 15 minutes at 4000 × g to discard nuclei and intact cells. To extract the cytoplasmic fraction, the supernatant was collected after a 60-minute centrifugation at 100,000 × g. The pellet was resolved in buffer A with protease inhibitors (as above) on ice, and was gently vortexed for 15 minutes. After centrifugation for 15 minutes at 15,000 × g, the supernatant was collected, representing the crude plasma membrane fraction. For Western blot analysis, 5 to 40 μg of protein extracts were separated under reduced conditions on 8 or 15% sodium dodecyl sulfate-polyacrylamide gels and transferred to polyvinyl difluoride membrane (Immobilon-P; Millipore, Bedford, MA) as we have reported previously.20Hiromura K Haseley LA Zhang P Monkawa T Durvasula R Petermann AT Alpers CE Mundel P Shankland SJ Podocyte expression of the CDK-inhibitor p57 during development and disease.Kidney Int. 2001; 60: 2235-2246Crossref PubMed Scopus (80) Google Scholar Membranes were incubated with primary antibodies overnight at 4°C, washed, and incubated with an alkaline phosphatase-conjugated anti-mouse IgG or anti-rabbit IgG antibody (Promega, Madison, WI) at room temperature for 1 hour. After further washing, detection of bound antibody was performed using the chromagen 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma). To determine CDK5 activity, co-immunoprecipitation followed by a histone H1 kinase assay was performed as previously described.26Nikolic M Tsai LH Activity and regulation of p35/Cdk5 kinase complex.Methods Enzymol. 2000; 325: 200-213Crossref PubMed Google Scholar, 28Hiromura K Pippin JW Fero ML Roberts JM Shankland SJ Modulation of apoptosis by the cyclin-dependent kinase inhibitor p27(Kip1).J Clin Invest. 1999; 103: 597-604Crossref PubMed Scopus (200) Google Scholar Briefly, 100 μg of total or fractionated protein (membrane and cytoplasm) extracted from cultured cells or isolated glomeruli was immunoprecipitated with primary antibodies for p35 or CDK5 in buffer A for 1 hour at 4°C, followed by incubation with protein A-Sepharose beads (RepliGen Corporation, Cambridge, MA) for 1 hour at 4°C. As a negative control, normal rabbit IgG was substituted for the specific antibody. To perform the histone H1 kinase assay, the beads were washed four times with buffer A, then once in kinase reaction buffer (50 mmol/L HEPES, pH 7.0, 10 mmol/L MgCl2, 1 mmol/L dithiothreitol). The kinase reaction was performed at 37°C for 30 minutes in a kinase reaction buffer containing 5 μmol/L ATP, 2 μCi [32P] ATP (NEN Life Science Products, Boston, MA) and 0.6 μg histone H1 (Boehringer Mannheim). After stopping the reaction with 2× sodium dodecyl sulfate sample buffer, samples were resolved on a 15% sodium dodecyl sulfate-polyacrylamide gel under reduced condition. Finally, the gel was exposed to autoradiographic film (Amersham Pharmacia Biotech) to visualize the phosphorylated histone H1. The expression of p35 was also confirmed by reverse transcriptase (RT)-PCR. Total RNA was isolated from 70% confluent differentiated heat-sensitive mouse podocytes using the Tri-Reagent (Sigma) according to the manufacturer's instruction. To prevent contamination by genomic DNA, extracted RNA was treated with DNAase (RQ1 RNase-Free DNase Promega) at 37°C for 30 minutes. cDNA was synthesized using the oligo(dT) protocol contained in the Superscript First-Strand Synthesis System for RT-PCR (Life Technologies, Inc.). cDNA was amplified in a semiquantitative manner using primer sets specific for the mouse p35 gene (forward primer: 5′ CATGCTCTGCAGGGATGTTA 3′, reverse primer: 5′ GAAATAGTGTGGGTCGGCAT 3′). The PCR reaction was performed as follows: 94°C for 3 minutes, followed by 35 cycles of 94°C for 1 minute, 56°C for 1 minute, and 72°C for 1 minute. PCR products were resolved on a 2% agarose gel. We began by using heat-sensitive mouse podocytes in culture. When grown under growth permissive conditions, these cells dedifferentiate and proliferate; when grown under restrictive conditions, they exit the cell cycle, differentiate, and acquire a quiescent phenotype similar to podocytes in vivo.17Mundel P Reiser J Zuniga Mejia Borja A Pavenstadt H Davidson GR Kriz W Zeller R Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte lines.Exp Cell Res. 1997; 236: 248-258Crossref PubMed Scopus (754) Google Scholar, 20Hiromura K Haseley LA Zhang P Monkawa T Durvasula R Petermann AT Alpers CE Mundel P Shankland SJ Podocyte expression of the CDK-inhibitor p57 during development and disease.Kidney Int. 2001; 60: 2235-2246Crossref PubMed Scopus (80) Google Scholar As shown in Figure 1, cyclins B1 and A are increased in proliferating podocytes, grown under growth permissive conditions. In contrast, the protein levels for CDK5 were low in proliferating podocytes. However, there was an increase in CDK5 protein levels in differentiating podocytes when cultured under growth restrictive conditions (Figure 1). Actin was used to confirm equivalence of protein loading. CDK5 expression was also demonstrated in cultured podocytes by immunostaining. Consistent with the Western blot results, immunostaining for CDK5 was weak in proliferating and dedifferentiated podocytes (Figure 2). However, there was an increase in CDK5 staining in differentiated and quiescent podocytes, with CDK5 being detected in both the nucleus and cytoplasm, and abundant in cellular processes (Figure 2).Figure 2CDK5 immunostaining in cultured mouse podocytes. A: Faint staining for CDK5 was seen in dedifferentiated podocytes. B and C: Both nuclear and cytoplasmic CDK5 immunostaining increased significantly in differentiated podocytes, with enhancement at the tips of cellular processes. D–F: Corresponding phase contrast images. Original magnifications: ×200 (A, B, D, E); ×400 (C and F).View Large Image Figure ViewerDownload Hi-res image Download (PPT) To test the hypothesis that CDK5 is also expressed in differentiating podocytes in vivo, we examined kidneys from normal embryonic mice. Our results showed faint staining of CDK5 in most kidney cells including the metanephric mesenchyme and tubular structures. Weak staining for CDK5 was also detected in early glomerular structures including the vesicle and comma and S-shaped bodies. In contrast, there was a marked increase in CDK5 staining at the capillary loop stage, in a distribution consistent with podocytes (Figure 3, A and B). Immunostaining for CDK5 was intense in podocytes of adult mice (Figure 3C). The specificity of the CDK5 antibody was confirmed by negative CDK5 staining in embryonal kidneys of CDK5−/− mice (data not shown). We next determined if CDK5 protein levels were altered after podocyte injury. Accordingly, we examined two models of experimental podocyte injury (anti-GBM nephritis and HIV nephropathy) and one model of glomerular disease (Habu nephritis) in which mesangial and endothelial cells, but not podocytes, are injured. We have previously reported that p21−/− mice exhibit marked podocyte proliferation after the induction of glomerulonephritis with an anti-GBM antibody, and therefore used these mice to examine the expression of CDK
Referência(s)