Two Frameshift Products Involved in the Transposition of Bacterial Insertion Sequence IS629
2006; Elsevier BV; Volume: 281; Issue: 31 Linguagem: Inglês
10.1074/jbc.m602437200
ISSN1083-351X
AutoresChang-Chieh Chen, Shiau-Ting Hu,
Tópico(s)RNA and protein synthesis mechanisms
ResumoIS629 is 1,310 bp in length with a pair of 25-bp imperfect inverted repeats at its termini. Two partially overlapping open reading frames, orfA and orfB, are present in IS629, and two putative translational frameshift signals, TTTTG (T4G) and AAAAT (A4T), are located near the 3′-end of orfA. With the lacZ gene as the reporter, both T4G and A4T motifs are determined to be a −1 frameshift signal. Two peptides representing the two transframe products designated OrfAB′ and OrfAB, are identified by a liquid chromatography-tandem mass spectrometric approach. Results of transposition assays show that OrfAB′ is the transposase and that OrfAB aids in the transposition of IS629. Pulse-chase experiments and Escherichia coli two-hybrid assays demonstrate that OrfAB binds to and stabilizes OrfAB′, thus increasing the transposition activity of IS629. This is the first transposable element in the IS3 family shown to have two functional frameshifted products involved in transposition and to use a transframe product to regulate transposition. IS629 is 1,310 bp in length with a pair of 25-bp imperfect inverted repeats at its termini. Two partially overlapping open reading frames, orfA and orfB, are present in IS629, and two putative translational frameshift signals, TTTTG (T4G) and AAAAT (A4T), are located near the 3′-end of orfA. With the lacZ gene as the reporter, both T4G and A4T motifs are determined to be a −1 frameshift signal. Two peptides representing the two transframe products designated OrfAB′ and OrfAB, are identified by a liquid chromatography-tandem mass spectrometric approach. Results of transposition assays show that OrfAB′ is the transposase and that OrfAB aids in the transposition of IS629. Pulse-chase experiments and Escherichia coli two-hybrid assays demonstrate that OrfAB binds to and stabilizes OrfAB′, thus increasing the transposition activity of IS629. This is the first transposable element in the IS3 family shown to have two functional frameshifted products involved in transposition and to use a transframe product to regulate transposition. The insertion sequence IS629 is a member of the IS3 family of transposable elements. It was initially isolated from the chromosome of Shigella sonnei (1Matsutani S. Ohtsubo H. Maeda Y. Ohtsubo E. J. Mol. Biol. 1987; 196: 445-455Crossref PubMed Scopus (78) Google Scholar) and has been detected in many other enteric bacteria, including S. dysenteriae, S. flexneri, S. boydii, Escherichia coli C, E. coli O157:H7, Enterobacter cloacae MD36, and Serratia marcescens (2Matsutani S. Ohtsubo E. Gene (Amst.). 1993; 127: 111-115Crossref PubMed Scopus (18) Google Scholar). IS629 is 1,310 bp in length and has a pair of 25-bp imperfect inverted repeats at its termini (3Matsutani S. Ohtsubo E. Nucleic Acids Res. 1990; 18: 1899Crossref PubMed Scopus (24) Google Scholar). Similar to the genetic organization of other members of the IS3 family, two consecutive and partially overlapping open reading frames, designated orfA and orfB, are present in IS629 (see Fig. 1). The coding potential of orfA (nucleotides 55–381) is 108 amino acids, and that of orfB (nucleotides 378–1,268) is 296 amino acids (3Matsutani S. Ohtsubo E. Nucleic Acids Res. 1990; 18: 1899Crossref PubMed Scopus (24) Google Scholar). The stop codon (379TGA) of orfA overlaps the initiation codon (378ATG) of orfB (see Fig. 1). A putative promoter and the Shine-Dalgarno sequence are found upstream from the initiation codon of orfA, but no such sequences are present in the upstream region of orfB (3Matsutani S. Ohtsubo E. Nucleic Acids Res. 1990; 18: 1899Crossref PubMed Scopus (24) Google Scholar).Two putative −1 translational frameshift signals, TTTTG (T4G) and AAAAT (A4T), are located near the 3′-end of the orfA at nucleotide positions 342–346 and 375–379, respectively (Fig. 1) (4Chandler M. Fayet O. Mol. Microbiol. 1993; 7: 497-503Crossref PubMed Scopus (180) Google Scholar), suggesting the existence of two frameshifted products. In this study, we demonstrated that both of these two putative frameshift signals are functional, causing a −1 translational frameshift and resulting in the production of two transframe products designated OrfAB′ and OrfAB. OrfAB′ was shown to be the transposase of IS629, and OrfAB was demonstrated to bind and stabilize OrfAB′.EXPERIMENTAL PROCEDURESCloning of IS629—A fragment containing both orfA and orfB sequences of IS629 was amplified by PCR from the chromosome of S. sonnei (ATCC 9290) or E. coli O157 with primers FNdeI-55 and REcl136II-Term (Table 1). The PCR product thus generated was cloned into pGEMT-Easy (Promega) to produce pGEMT629. Subsequently, the 1.2-kb NdeI-Ecl136II fragment containing orfA and orfB without terminal repeats was isolated from pGEMT629 and then inserted into the corresponding sites of pET-29a(+) (Novagen), generating pET629. DNA fragments containing different portions of IS629 for various experiments were generated from pGEMT629 or pET629 by PCR using oligonucleotide primers listed in Table 1. Recombinant plasmids used in this study are described below in Table 2.TABLE 1Oligonucleotide primers used in this studyPrimerSequence (5′ → 3′)FNdeI-55CATATGACTAAAAATACTCGTTTTTCCCCCGREcl136II-TermGAGCTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCFXbaI-55CTCTAGAATGACTAAAAATACTCGTTTTTCCCCCGRRsrII-425CGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCARA4TAATCCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGgattaTTTTTTCCAGARClaI-TAATCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGGATTatcgaTTCCAGAGGF316-Bst11071CGATATCCTTCGCCAGGCTTCCGCGTAtactgCGAAGGCGGAGTTRRsrII-ClaICGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCatcgaTTCCAGAGGCGGTCARAgeI-375GACCGGTGAATTTCCAGAGGCGGTCAAACTCCGCCTTCGcagtaTACGCGGFBamHI-334CGGATCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCRAscI-375AGGCGCGCCCTCGGTACCCACCGGTGAATTTCCAFBamHI-367CGGATCCCTCTGGAAAAAATGATGCCTCTGCTGGATRAscI-458AGGCGCGCCCTCGGTACCGTTGACGGGGCAATATGCAFIRL-BamHITGAACCGCCCCGGGAATCCTGGAGACTAAGGATCCTGAGARIRR-BamHITGAACCGCCCCGGGTTTCCTGGAGAGTGTGGATCCTGTGAACTCART4A5CGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCAtttttTTCCAGAGFT5AACGATATCCTTCGCCAGGCTTCCGCTTAtttttGCGAAGGCRA5CGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGGATTAtttttTTCCAGAGFNotI-55GCGGCCGCGATGACTAAAAATACTCGTTTTTCCCCCGFP-1ACCTACAACAAAGCTCTCATCAACCPRP-1ACGTTTCCCGTTGAATATGGCTCAT Open table in a new tab TABLE 2Plasmids used in this studyView Large Image Figure ViewerDownload Hi-res image Download (PPT) Open table in a new tab Detection of Translational Frameshifting—To detect −1 translational frameshifting in IS629, the lacZ gene was fused to a DNA fragment containing the two putative frameshift motifs, referred to as the frameshift window (fsw), 2The abbreviations used are: fsw, frameshift window; IPTG, isopropyl 1-thio-β-d-galactopyranoside; MBP, maltose-binding protein; LC-MS/MS, liquid chromatography-tandem mass spectrometry; IRL, left terminal inverted repeat; IRR, right terminal inverted repeat; RNAP-α, α subunit of RNA polymerase. so that the lacZ gene is expressed only when a −1 frameshift occurs and that the frameshifting can be detected by measuring β-galactosidase activity. The 3.2-kb SmaI-PstI fragment containing the lacZ gene from pMC1871 (5Shapira S.K. Chou J. Richaud F.V. Casadaban M.J. Gene (Amst.). 1983; 25: 71-82Crossref PubMed Scopus (283) Google Scholar) was cloned into the corresponding sites of pUCD1752X (6Li C.-C. Characterization of the Putative Frameshift Signal T6Gof IS1372. National Yang-Ming University, Taipei, Taiwan1999Google Scholar) to generate pUCDlacZ. To investigate the function of the two putative frameshift motifs, a DNA fragment (IS629 nucleotides 55–425) containing the two motifs was amplified from pGEMT629 using primers FXbaI-55 and RRsrII-425 and cloned between XbaI and SmaI sites of pUC18, generating pUC629-21. The 450-bp XbaI-Acc65I fragment from pUC629-21 was then inserted into the corresponding sites of pUCDlacZ to generate pF1wF2wIw, thus making the expression of the lacZ gene dependent on −1 frameshifting. For this and subsequent plasmid designations, F1, F2, and I represent frameshift signal 1 (T4G), frameshift signal 2 (A4T), and initiation codon for orf B, respectively, whereas “w” denotes wild-type sequence, and “m” means mutated sequence. Because this 450-bp XbaI-Acc65I fragment contained the initiation codon of orf B, which may render the lacZ gene constitutively expressed, this initiation codon was mutated, generating pF1wF2wIm. To investigate the function of the first frameshift motif T4G (F1), the sequence AAAAT (F2) was mutated to TCGAT to create pF1wF2mIm. Similarly, the sequence TTTTG (F1) was changed to TACTG to investigate the function of the second frameshift motif, generating pF1mF2wIm. The plasmid that contained mutations of both motifs and the orfB initiation codon was called pF1mF2mIm, whereas the one containing the two mutated motifs with the wild-type orfB initiation codon was referred to as pF1mF2mIw. Mutations were created by PCR on the 450-bp XbaI-Acc65I fragment using primers listed in Table 1, and the new 450-bp XbaI-Acc65I fragment with a certain mutation was used to replace the XbaI-Acc65I fragment on pF1wF2wIw to generate various plasmids (Table 2 and Fig. 2).FIGURE 2The function of the putative frameshift motifs. DNA fragments (IS629 nucleotides 55–425) containing the wild-type or mutated frameshift motifs were fused with the lacZ gene. The nucleotide sequence of the frameshift window (fsw) and the deduced amino acids encoded by 0 and −1 reading frames in the window are shown. The stop codon of orfA is indicated by asterisks. The wild-type (T4G and A4T) or mutated frameshift motifs are underlined. The two ATG initiation codons for orf B and the mutated sequences are boxed. The β-galactosidase levels in Miller units derived from each construct are shown. The value derived from pF1mF2mLacZ on which the lacZ gene is fused in-frame to the fsw sequence is set as 100%, and the relative values of those derived from other constructs are shown in parenthesis.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Purification and Detection of Transframe Products—To detect and identify the frameshifted products of IS629, the gene encoding a portion (amino acids 147–402) of the E. coli maltose-binding protein (MBP) with a His6 tag at the 3′-end was fused to a DNA fragment containing either one of the two frameshift motifs so that MBP-His6 is produced only when a −1 frameshift occurs. IS629 fragment (nucleotides 334–375) containing the T4G motif was amplified from pET629 with primers FBamHI-334 and RAscI-375 and then inserted between BamHI and Ecl136II sites of pET-29a(+) to yield pET629T4G. The 767-bp BssHII-HindIII fragment containing the malE gene encoding MBP from pMAL-C2 (New England Biolabs) was then inserted between AscI and HindIII sites on pET629T4G to obtain pET629T4GMBP, thus fusing MBP to the T4G motif. The hybrid gene was driven by the T7 promoter and regulated by the lac operator. To fuse the A4T motif with MBP-His6, IS629 fragment (nucleotides 367–458) containing the A4T motif was amplified from pGEMT629 with primers FBamHI-367 and RAscI-458. The resulting PCR product was digested with BamHI and AscI, and plasmid pET629A4TMBP was generated by substituting the BamHI-AscI fragment on pET629T4GMBP with the digested PCR product.The plasmid pET629T4GMBP or pET629A4TMBP was then introduced into E. coli BL21(DE3). Overnight cultures of cells containing the plasmid were diluted 1:100 in Luria-Bertani (LB) broth containing 50 μg/ml kanamycin and grown to an A600 of 0.8. Isopropyl 1-thio-β-d-galactopyranoside (IPTG) was added to the culture to a final concentration of 1 mm to induce protein expression. After 2.5 h of induction, the cells were harvested and lysed with the B-PER bacterial protein extraction reagent (Pierce) and lysis buffer (50 mm NaH2PO4, 10 mm Tris-HCl, 8 m urea, and 500 mm NaCl, pH 8.0). The whole cell lysate was clarified by centrifugation, and the His-tagged recombinant protein was purified by affinity column chromatography with the ProBond resin (Invitrogen). The proteins bound to the resin were washed with 50 ml of lysis buffer and then with 50 ml of wash buffer (500 mm NaCl and 20 mm NaPO4 buffer, pH 6.0). Finally, the bound proteins were eluted with elution buffer (150 mm imidazole, 500 mm NaCl, and 20 mm NaPO4 buffer, pH 6.0). The eluted proteins were concentrated and washed extensively with wash buffer using an Amicon Ultra PL-30 filter (Millipore). The purified proteins were resolved on 10% SDS-polyacrylamide gels for visualization by Coomassie Blue staining or Western blotting. For Western blotting, the proteins on the gel were electrotransferred onto Immobilon-P transfer membranes (Millipore). The membranes were then probed with a 1:1,000 dilution of the anti-MBP antibody (7Tsay Y.G. Chen C.C. Hu S.T. Anal. Biochem. 2005; 339: 83-93Crossref PubMed Scopus (5) Google Scholar) and a 1:1,000 dilution of horseradish peroxidase-conjugated anti-mouse immunoglobulin G (IgG) antibodies (Sigma). The signals on the blots were visualized using the enhanced chemiluminescence system (PerkinElmer Life Sciences).Mass Spectrometry—The gel piece containing the transframe protein was subjected to reduction, pyridylethylation, and ingel digestion with trypsin or Asp-N as described by Tsay et al. (7Tsay Y.G. Chen C.C. Hu S.T. Anal. Biochem. 2005; 339: 83-93Crossref PubMed Scopus (5) Google Scholar). The digested products were separated by an Agilent 1100D high-performance liquid chromatography system, which was interfaced with the ThermoFinnigan LCQ Deca XP ion trap tandem mass spectrometer. A 150-× 0.3-mm Agilent 300SB C18 column (3-μm particle diameter, 300-Å pore size) with mobile phases of 0.1% formic acid in water and 0.1% formic acid in acetonitrile was used to separate peptides.The occurrence of frameshifting was confirmed by detecting peptides that were produced by a −1 frameshift by matching the mass spectra of the peptides against two data-bases created based on the frameshift model of Jacks et al. (8Jacks T. Madhani H.D. Masiarz F.R. Varmus H.E. Cell. 1988; 55: 447-458Abstract Full Text PDF PubMed Scopus (430) Google Scholar). These two databases contained computer-generated nucleotide sequences of different peptides that may be produced by trypsin or Asp-N digestion of fsw(T4G)-MBP-His6 and fsw(A4T)-MBP-His6, respectively, translated in both the 0 and −1 frames. Because the region located between the most downstream peptide sequence derived from the 0 translation frame and the most upstream peptide sequence derived from the −1 translation frame is where frameshifting may occur, this region is referred to as the “frameshift region.” Two additional new databases were then created. The first one contained the nucleotide sequences of different peptides derived from a −1 frameshift that occurs at each codon within the first frameshift region (fsw(T4G)-MBP-His6), and the second one contained those derived from the second frameshift region (fsw(A4T)-MBP-His6). Each nucleotide sequence corresponded to a resultant peptide from one −1 frameshifting event within a frameshift region.The collision-induced dissociation spectra of a peptide were acquired as three successive scans as described by Tsay et al. (9Tsay Y.G. Wang Y.H. Chiu C.M. Shen B.J. Lee S.C. Anal. Biochem. 2000; 287: 55-64Crossref PubMed Scopus (69) Google Scholar). The acquired collision-induced dissociation spectra were interpreted using a ThermoFinnigan software package, the Turbo-SEQUEST browser, which matches the tandem mass spectrum with those in the databases described above. The MS/MS data that matched the peptide sequences with appropriate cleavage sites at the right positions were subjected to manual analysis using another computer program (EverNew Biotech) to confirm the results.Transposition Assays—To investigate effects of IS629-encoded proteins on IS629 transposition in vivo, a mini-IS629 with the kanamycin resistance gene was first constructed, and proteins that may affect IS629 transposition were supplied in trans. The left terminal repeat (IRL) sequence of IS629 was amplified from the chromosome of S. sonnei ATCC 9290 with primers FIRL-BamHI and RAscI-375, and the PCR product was ligated into pGEMT-Easy (Promega) to generate pGEMT-IRL. The right terminal repeat (IRR) was amplified with primers F316-Bst1107I and RIRR-BamHI and similarly cloned into pGEMT-Easy to generate pGEMT-IRR. The 1.9-kb ScaI-BamHI fragment containing the IRL from pGEMT-IRL and the 1.2-kb ScaI-BamHI fragment containing the IRR from pGEMT-IRR were joined together to obtain pGEMT-mini629. The 1.3-kb BamHI fragment containing the kanamycin resistance gene from pUC4K (Amersham Biosciences) was then inserted into the BamHI site of pGEMT-mini629 to generate pGEMT-mini629Km. Finally, pMini629 was constructed by inserting the 1.3-kb NotI fragment containing the mini-IS629 with the kanamycin resistance gene from pGEMT-mini629Km into pET-22b(+) (Novagen).The 1.2-kb NdeI-Ecl136II fragment containing the orfA and orfB sequences of IS629 from pGEMT629 was then inserted into the corresponding sites of pMini629 to generate pMini629AB′-AB-A-B, which would express OrfAB′, OrfAB, OrfA, and OrfB. The 370-bp NdeI-RsrII DNA on pMini629AB′-AB-A-B was then replaced with the 370-bp PCR-generated NdeI-RsrII DNA fragment encoding OrfAB′, OrfAB, and OrfA to produce pMini629AB′-AB-A. Similarly, pMini629AB′-A that would express OrfAB′ and OrfA was constructed by replacing the same NdeI-RsrII DNA on pMini629AB′-AB-A-B with the 370-bp PCR-generated NdeI-RsrII DNA fragments encoding OrfAB′ and OrfA (Table 2).The transposition activity of IS629 was determined by the standard mating-out assay as described previously (10Hu S.T. Lee C.H. Mol. Gen. Genet. 1988; 214: 490-495Crossref PubMed Scopus (27) Google Scholar). Derivatives of pMini629 (Kmr) carrying various IS629 genes were transformed into E. coli DH1(DE3) cells (Strs) harboring an F-derived conjugative plasmid pCJ105 (Cmr), which served as the target for IS629 transposition. Because pCJ105 carries a chloramphenicol resistance gene, transposition of mini629Km onto pCJ105 will render the host resistant to both kanamycin and chloramphenicol. To determine the transposition frequency of IS629, pCJ105::mini629Km was mated out from E. coli DH1(DE3) to E. coli HB101(Strr) at 37 °C for 90 min. Appropriate dilutions of the conjugation mix were plated on LB agar plates containing both chloramphenicol (50 μg/ml) and streptomycin (150 μg/ml) as well as on plates containing kanamycin (50 μg/ml), chloramphenicol (50 μg/ml), and streptomycin (150 μg/ml). Colonies that appeared on these plates were counted, and the transposition frequency was determined as the ratio of the number of Cmr Kmr Strr colonies to that of the Cmr Strr colonies. To confirm transposition, some of the transposition products (pCJ105:: mini629Km) were isolated and examined for direct repeat sequences flanking the mini-IS629. The direct repeat sequence adjacent to IRR was identified by nucleotide sequencing using primer FP-1 (Table 1), which anneals to the 3′-end of the kanamycin resistance gene 140 bp upstream from IRR. To detect the direct repeat sequence adjacent to IRL, primer PRP-1 (Table 1), which anneals to the 5′-end of the kanamycin resistance gene 164 bp downstream from IRL, was used for sequencing.Pulse-Chase Experiments—Pulse-chase experiments were performed to investigate the half-life of OrfAB′ and OrfAB. To express OrfAB′, the 1.2-kb NdeI-Ecl136II fragment from pMini629AB′-A was cloned into the corresponding sites on pET-29a (+) (Novagen) to generate pET629A-AB′. Similarly, the NdeI-Ecl136II fragments from pMini629AB-A and pMini629AB′-AB-A were inserted between NdeI and Ecl136II sites on pET-29a (+) to generate pET629A-AB and pET629A-AB′-AB that express OrfAB and OrfAB′+OrfAB, respectively.Overnight cultures of E. coli DH1(DE3) cells containing pET629A-AB′, pET629A-AB, or pET629A-AB′-AB were diluted 1:50 with fresh M9 minimal medium containing kanamycin (50 μg/ml) and grown to an A600 of 0.3. The cells in the culture were pelleted, washed with M9 buffer (11Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar), and suspended in M9 minimal medium containing 2% methionine assay medium (Difco Laboratories). After 100-min incubation at 37 °C, IPTG was added to the culture to a final concentration of 1 mm to induce the synthesis of the T7 RNA polymerase. Forty minutes later, rifampin (200 μg/ml) was added, and the culture was incubated for another 40 min. The cells were then labeled with [35S]methionine (20 μCi/ml, Amersham Biosciences) for 10 min and subsequently chased with an excess amount of non-radioactive methionine (final concentration, 2.5 mg/ml). Samples were taken at different time points, pelleted, and suspended in electrophoresis sample buffer (50 mm Tris-HCl, pH 6.8, 2% SDS, 7 mm β-mercaptoethanol, 10% glycerol, 0.1% bromphenol blue). The samples were boiled for 5 min and electrophoresed on a 12% SDS-polyacrylamide gel. The gels were scanned with a PhosphorImager (Amersham Biosciences), and quantification of the protein was performed with the program ImageQuant (Amersham Biosciences).Bacterial Two-hybrid Assay—To assess the interaction between OrfAB′ and OrfAB, an E. coli two-hybrid experiment was performed. In this system (BacterioMatch Two-Hybrid System, Stratagene), the bait plasmid pBT (Cmr) encodes the bacterial phage λcI protein under the control of the lac-UV5 promoter. This λcI protein contains the N-terminal DNA-binding domain and the C-terminal dimerization domain. The protein of interest, the bait, is fused to the λcI protein. The target plasmid pTRG (Tcr) contains an RNAPα gene, which is driven by the E. coli lipoprotein promoter (lpp) and regulated by the lac operator. The target protein is fused to the N-terminal domain of the RNA polymerase α subunit.DNA fragments encoding OrfAB′ or OrfAB were cloned into these plasmids to fuse OrfAB′ or OrfAB to λcI or RNAPα to generate λcI-OrfAB′, λcI-OrfAB, RNAPα-OrfAB′, and RNAPα-OrfAB. When interaction between λcI-OrfAB′ and RNAPα-OrfAB′, λcI-OrfAB and RNAPα-OrfAB, λcIOrfAB′ and RNAPα-OrfAB, or λcI-OrfAB and RNAPα-OrfAB′ had occurred, these complexes would bind to theλ operator (OR2) located upstream from the reporter cassette containing the lacZ genes in E. coli XL-1 Blue MRF′ (Kmr). This binding would recruit and stabilize the binding of RNA polymerase at the promoter and activate the transcription of the reporter gene. Thus, the protein-protein interaction between OrfAB and OrfAB′ or between themselves could be determined by the levels of β-galactosidase activity.The bait and target plasmids were constructed as follows. The IS629 fragment containing an insertion of a thymine residue within the T4G motif was amplified from pET629A-AB′ with primers FT5 and REcl136II-Term. The PCR product was digested with EcoRV and HindIII and then cloned into the corresponding sites of pGEMT629, resulting in pGEMT629T5. A 1.2-kb NotI-EcoRI fragment containing IS629(T5) without the terminal repeats was then amplified from pGEMT629T5 with primers FNotI-55 and RT7 and then cloned into the corresponding sites of pBT and pTRG to yield pBT-AB′ and pTRG-AB′. For construction of pBT-AB and pTRG-AB, the IS629 fragment (nucleotides 55–425) with an adenine insertion within the A4T motif was amplified from pET629A-AB with primers FNotI-55 and RA5. This PCR product was ligated into pGEMT-Easy vector (Promega) to generate pGEMT629A5NR. The RsrII-SphI fragment containing the IS629 nucleotides 420–1,269 from pGEMT629 was then inserted into the corresponding sites of pGEMT629A5NR to obtain pGEMT629A5. The NotI-EcoRI fragment of pGEMT629A5 was inserted between NotI and EcoRI sites on pBT and pTRG to generate pBT-AB and pTRG-AB, respectively.E. coli XL-1 Blue MRF′ was co-transformed with various combinations of recombinant bait and target plasmids to examine interaction between OrfAB′ and OrfAB or with non-recombinant pBT and pTRG vectors to serve as negative controls for the interaction analysis. Transformants were selected on LB agar plates containing 12.5 μg/ml tetracycline, 34 μg/ml chloramphenicol, and 50 μg/ml kanamycin. In the presence of 20 μm IPTG, cells were cultured at 30 °C to mid-log phase, and then assayed for β-galactosidase activity by the method of Miller (12Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1972Google Scholar) using o-nitrophenyl-β-d-galactopyranoside as the substrate.RESULTSTwo Functional −1 Frameshift Signals—To determine whether the T4G or the A4T motif was able to provoke a −1 frameshift, a lacZ reporter gene was fused to the 3′-end of a DNA fragment (nucleotides 55–425) containing the entire orfA, the first 48 bp of orfB, and the wild-type or mutated putative frameshift motifs. The lac promoter and E. coli RNA polymerase were used to express the hybrid gene on these constructs (Table 2). Translation of mRNA derived from each of these plasmids would start at frame 0 of orfA, and the β-galactosidase would be expressed only when a −1 frameshift had occurred, because lacZ was fused to the −1 reading frame of orfA. The β-galactosidase activity in cells harboring a certain construct after IPTG induction was measured (Fig. 2). As the positive control for β-galactosidase production, the lacZ gene on pF1mF2mLacZ was fused in-frame to orfA. The β-galactosidase activity conferred by this plasmid was determined to be 3,896 ± 243 units (Fig. 2) and designated as 100%. pF1wF2wIw, which contained the wild type of both T4G and A4T sequences fused to the lacZ gene, conferred 665 ± 50 units (17.1% of control) of β-galactosidase activity, suggesting that a −1 frameshift had occurred. To determine whether both T4G and A4T motifs were essential for frameshifting, they were mutated to TACTG and TCGAT, respectively. Surprisingly, pF1mF2mIw, which harbors these mutations, still conferred 504 units (12.9% of control) of β-galactosidase activity (Fig. 2). A careful analysis of the nucleotide sequence revealed the presence of two tandem translation initiation codons (78ATGATG83) located at the beginning of orf B. To determine whether the lacZ activity conferred by pF1mF2mIw was due to translation initiated from one of these two codons, the sequence ATGATG on pF1mF2mIw was changed to ATAATC to generate pF1mF2mIm. As expected, pF1mF2mIm with both the two putative frameshift signals and both the two ATG codons mutated conferred very little β-galactosidase activity (1.69 ± 0.15 units, 0.04% of control). This result indicates that the majority of β-galactosidase activity conferred by pF1wF2wIw was derived from translation initiated from the initiation codons of orf B.To assess the frameshifting function of T4G, the TACTG sequence on pF1mF2mIm was changed back to TTTTG, generating pF1wF2mIm. pF1wF2mIm was found to confer 148 ± 14 units of β-galactosidase (3.8% of control), indicating that the T4G sequence is a functional −1 frameshift signal. Similarly, the TCGAT sequence on pF1mF2mIm was changed back to AAAAT, generating pF1mF2wIm to examine the frameshifting ability of A4T, and pF1mF2wIm was found to confer 173 ± 11 units of β-galactosidase (4.4% of control). This result indicates that A4T is also a functional frameshift signal. When both of the mutated frameshift motifs were changed back to wild type, the plasmid pF1wF2wIm, which carries these changes, conferred 174 ± 14 units of β-galactosidase (4.5% of control). Because pF1wF2wIm had a mutated initiation codon for orfB, this result indicates that the β-galactosidase activity derived from frameshifting was ∼4.5%.Identification of Frameshift Sites—To confirm that frameshifting indeed occurred, the transframe products were identified. A DNA fragment containing nucleotides 334–375 of IS629 with a portion of orfA and the T4G motif was fused out-of-frame to the sequence encoding His6-tagged maltose binding protein (MBP-His6), generating pET629T4GMBP (Fig. 3A). On this plasmid, the MBP-His6 would be translated only when a −1 frameshift had occurred. The fused gene was driven by the T7 promoter under the control of the lac operator. After IPTG induction, proteins were purified with nickel affinity column chromatography, electrophoresed on an SDS-polyacrylamide gel (Fig. 3B, left panel), and immunoblotted with anti-MBP antibodies (Fig. 3B, right panel). The 32-kDa band of the expected frameshifted product and two additional bands were seen. These two additional bands could be degradation products of fusion protein. The 32-kDa band was isolated from the gel and then subjected to LC-MS/MS analysis. A peptide with the sequence GSoMADIGSAYFCEGGVRPPLEIHR was identified (Fig. 3C). This sequence was the resultant product from a −1 frameshift that took place at the T4G motif.FIGURE 3Verification of the T4G motif as a −1 frameshift site. A, structure of the fsw(T4G)-MBP-His6 hybrid gene. Amino acid sequences of the putative products in the 0 and −1 frames are shown below the diagram. The boldface letters indicate the amino acid sequence of the transframe peptide determined by LC-MS/MS analysis. The T4G motif is boxed. Abbreviation of restriction sites: Ba, BamHI; As, AscI; Hd, HindIII. T7, T7 promoter; fsw, frameshift window; His6, histidine hexamer tag; MBP, E. coli maltose-binding protein. B, the −1 frameshifted fsw(T4G)-MBP-His6 protein. Left panel
Referência(s)