The Active Sites of the Eukaryotic 20 S Proteasome and Their Involvement in Subunit Precursor Processing
1997; Elsevier BV; Volume: 272; Issue: 40 Linguagem: Inglês
10.1074/jbc.272.40.25200
ISSN1083-351X
AutoresW. Heinemeyer, Michael B. Fischer, Thomas Krimmer, Ulrike Stachon, Dieter H. Wolf,
Tópico(s)Endoplasmic Reticulum Stress and Disease
ResumoThe 26 S proteasome is the central protease involved in ubiquitin-mediated protein degradation and fulfills vital regulatory functions in eukaryotes. The proteolytic core of the complex is the 20 S proteasome, a cylindrical particle with two outer rings each made of 7 different α-type subunits and two inner rings made of 7 different β-type subunits. In the archaebacterial 20 S proteasome ancestor proteolytically active sites reside in the 14 uniform β-subunits. Their N-terminal threonine residues, released by precursor processing, perform the nucleophilic attack for peptide bond hydrolysis. By directed mutational analysis of 20 S proteasomal β-type proteins of Saccharomyces cerevisiae, we identified three active site-carrying subunits responsible for different peptidolytic activities as follows: Pre3 for post-glutamyl hydrolyzing, Pup1 for trypsin-like, and Pre2 for chymotrypsin-like activity. Double mutants harboring only trypsin-like or chymotrypsin-like activity were viable. Mutation of two potentially active site threonine residues in the Pre4 subunit excluded its catalytic involvement in any of the three peptidase activities. The generation of different, incompletely processed forms of the Pre4 precursor in active site mutants suggested that maturation of non-active proteasomal β-type subunits is exerted by active subunits and occurs in the fully assembled particle. Thistrans-acting proteolytic activity might also account for processing intermediates of the active site mutated Pre2 subunit, which was unable to undergo autocatalytic maturation. The 26 S proteasome is the central protease involved in ubiquitin-mediated protein degradation and fulfills vital regulatory functions in eukaryotes. The proteolytic core of the complex is the 20 S proteasome, a cylindrical particle with two outer rings each made of 7 different α-type subunits and two inner rings made of 7 different β-type subunits. In the archaebacterial 20 S proteasome ancestor proteolytically active sites reside in the 14 uniform β-subunits. Their N-terminal threonine residues, released by precursor processing, perform the nucleophilic attack for peptide bond hydrolysis. By directed mutational analysis of 20 S proteasomal β-type proteins of Saccharomyces cerevisiae, we identified three active site-carrying subunits responsible for different peptidolytic activities as follows: Pre3 for post-glutamyl hydrolyzing, Pup1 for trypsin-like, and Pre2 for chymotrypsin-like activity. Double mutants harboring only trypsin-like or chymotrypsin-like activity were viable. Mutation of two potentially active site threonine residues in the Pre4 subunit excluded its catalytic involvement in any of the three peptidase activities. The generation of different, incompletely processed forms of the Pre4 precursor in active site mutants suggested that maturation of non-active proteasomal β-type subunits is exerted by active subunits and occurs in the fully assembled particle. Thistrans-acting proteolytic activity might also account for processing intermediates of the active site mutated Pre2 subunit, which was unable to undergo autocatalytic maturation. The proteasome is a large multi-subunit proteinase complex found in the cytoplasm and nucleus of all eukaryotic cells examined so far. This "proteolytic organelle" fulfills vital cellular functions. As part of the ubiquitin-mediated protein degradation machinery, it is responsible not only for the elimination of misfolded proteins, including those derived from the lumen of the endoplasmic reticulum (1Hiller M.M. Finger A. Schweiger M. Wolf D.H. Science. 1996; 273: 1725-1728Crossref PubMed Scopus (615) Google Scholar), it also controls a multitude of regulatory processes by removing unnecessary or even harmful metabolic enzymes and by balancing the levels of many regulatory proteins (for reviews see Refs. 2Hilt W. Wolf D.H. Trends Biochem. Sci. 1996; 21: 96-102Abstract Full Text PDF PubMed Scopus (363) Google Scholar, 3Hochstrasser M. Curr. Opin. Cell Biol. 1995; 7: 215-223Crossref PubMed Scopus (781) Google Scholar, 4Rubin D.M. Finley D. Curr. Biol. 1995; 5: 854-858Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). Proteasomes exist as particles of 20 S and of 26 S. The 26 S complex of ≈2000 kDa is composed of the 20 S particle of ≈700 kDa as a proteolytic core unit and two regulatory 19 S caps that dock onto each side of the 20 S cylinder and confer ATP and ubiquitin dependence onto proteasomal protein degradation (2Hilt W. Wolf D.H. Trends Biochem. Sci. 1996; 21: 96-102Abstract Full Text PDF PubMed Scopus (363) Google Scholar, 3Hochstrasser M. Curr. Opin. Cell Biol. 1995; 7: 215-223Crossref PubMed Scopus (781) Google Scholar, 5Coux O. Tanaka K. Goldberg A.L. Annu. Rev. Biochem. 1996; 65: 801-847Crossref PubMed Scopus (2232) Google Scholar, 6Peters J.M. Trends Biochem. Sci. 1994; 19: 377-382Abstract Full Text PDF PubMed Scopus (299) Google Scholar, 7Rechsteiner M. Hoffmann L. Dubiel W. J. Biol. Chem. 1993; 268: 6065-6068Abstract Full Text PDF PubMed Google Scholar). A 20 S proteasome ancestor was isolated from the archaebacteriumThermoplasma acidophilum which exhibits an electron microscopic structure like the eukaryotic proteasome core but a much simpler subunit complexity. Extensive structural studies on this complex (8Dahlmann B. Kopp F. Kühn L. Niedel B. Pfeifer G. Hegerl R. Baumeister W. FEBS Lett. 1989; 251: 125-131Crossref PubMed Scopus (253) Google Scholar, 9Zwickl P. Lottspeich F. Dahlmann B. Baumeister W. FEBS Lett. 1991; 278: 217-221Crossref PubMed Scopus (69) Google Scholar, 10Zwickl P. Grziwa A. Pühler G. Dahlmann B. Lottspeich F. Baumeister W. Biochemistry. 1992; 31: 964-972Crossref PubMed Scopus (200) Google Scholar, 11Grziwa A. Baumeister W. Dahlmann B. Kopp F. FEBS Lett. 1991; 290: 186-190Crossref PubMed Scopus (110) Google Scholar) were completed by its x-ray crystallographic resolution (12Löwe J. Stock D. Jap B. Zwickl P. Baumeister W. Huber R. Science. 1995; 268: 533-539Crossref PubMed Scopus (1377) Google Scholar). Two related subunits, α and β, form a stack of four heptameric rings, whereby the two outer rings are composed of α-subunits and the two inner rings of β-subunits. Four narrow gates arranged along the cylinder axis give rise to three cavities within the particle. Analysis of the yeast 20 S proteasome (13Achstetter T. Ehmann C. Osaki A. Wolf D.H. J. Biol. Chem. 1984; 259: 13344-13348Abstract Full Text PDF PubMed Google Scholar, 14Kleinschmidt J.A. Escher C. Wolf D.H. FEBS Lett. 1988; 239: 35-40Crossref PubMed Scopus (50) Google Scholar, 15Heinemeyer W. Kleinschmidt J.A. Saidowsky J. Escher C. Wolf D.H. EMBO J. 1991; 10: 555-562Crossref PubMed Scopus (357) Google Scholar, 16Heinemeyer W. Tröndle N. Albrecht G. Wolf D.H. Biochemistry. 1994; 33: 12229-12237Crossref PubMed Scopus (103) Google Scholar) suggested that the eukaryotic particle contains 14 different but related subunits, encoded by 7 α-type and 7 β-type genes. These findings together with immunoelectron microscopic studies on mammalian 20 S proteasomes (17Kopp F. Dahlmann B. Hendil K.B. J. Mol. Biol. 1993; 229: 14-19Crossref PubMed Scopus (91) Google Scholar,18Kopp F. Kristensen P. Hendil K.B. Johnsen A. Sobek A. Dahlmann B. J. Mol. Biol. 1995; 248: 264-272PubMed Google Scholar) implied an architecture in which an ordered array of each 7 different α-type and 7 different β-type subunits is present in the two outer and in the two inner proteasomal rings, respectively. In vertebrates the subunit complexity is further extended by the fact that three of the constitutive β-type subunits can be replaced by closely related, γ-interferon inducible subunits that improve the function of proteasomes in the major histocompatibility complex class I-coupled antigen presentation pathway (reviewed in Refs. 5Coux O. Tanaka K. Goldberg A.L. Annu. Rev. Biochem. 1996; 65: 801-847Crossref PubMed Scopus (2232) Google Scholar and 19Groetrupp M. Soza A. Kuckelkorn U. Kloetzel P.-M. Immunol. Today. 1996; 17: 429-435Abstract Full Text PDF PubMed Scopus (200) Google Scholar). The eukaryotic 20 S proteasome has at least three different activities against synthetic peptide substrates as follows: a chymotrypsin-like, a trypsin-like, and a peptidyl-glutamyl peptide-hydrolyzing (PGPH) 1The abbreviations used are: PGPH, peptidyl-glutamyl peptide-hydrolyzing; Cbz, carbobenzoxyl; βGal, β-galactosidase.1The abbreviations used are: PGPH, peptidyl-glutamyl peptide-hydrolyzing; Cbz, carbobenzoxyl; βGal, β-galactosidase. activity (20Orlowski M. Biochemistry. 1990; 29: 10289-10297Crossref PubMed Scopus (412) Google Scholar, 21Rivett A.J. J. Biol. Chem. 1989; 264: 12215-12219Abstract Full Text PDF PubMed Google Scholar). Yeast mutants defective in different peptidase activities of the 20 S proteasome had been isolated and were shown to carry alterations in distinct β-type subunits each (15Heinemeyer W. Kleinschmidt J.A. Saidowsky J. Escher C. Wolf D.H. EMBO J. 1991; 10: 555-562Crossref PubMed Scopus (357) Google Scholar, 22Heinemeyer W. Gruhler A. Möhrle V. Mahé Y. Wolf D.H. J. Biol. Chem. 1993; 268: 5115-5120Abstract Full Text PDF PubMed Google Scholar, 23Hilt W. Enenkel C. Gruhler A. Singer T. Wolf D.H. J. Biol. Chem. 1993; 268: 3479-3486Abstract Full Text PDF PubMed Google Scholar, 24Enenkel C. Lehmann H. Kipper J. Gückel R. Hilt W. Wolf D.H. FEBS Lett. 1994; 341: 193-196Crossref PubMed Scopus (73) Google Scholar). The resulting assumption that β-type subunits contain the proteolytically active sites was substantiated by the x-ray structure determination of theThermoplasma proteasome (12Löwe J. Stock D. Jap B. Zwickl P. Baumeister W. Huber R. Science. 1995; 268: 533-539Crossref PubMed Scopus (1377) Google Scholar). This study as well as mutational analysis (25Seemüller E. Lupas A. Stock D. Löwe J. Huber R. Baumeister W. Science. 1995; 268: 579-582Crossref PubMed Scopus (584) Google Scholar) identified the N-terminal threonine residue of the β-subunit, which becomes liberated by precursor processing during proteasome assembly (26Zwickl P. Kleinz J. Baumeister W. Nat. Struct. Biol. 1994; 1: 765-770Crossref PubMed Scopus (171) Google Scholar), as the central amino acid necessary for proteolysis. This classifies the archaebacterial β-subunit as a threonine protease within the family of N-terminal nucleophile hydrolases (27Brannigan J.A. Dodson G. Duggleby H.J. Moody P.C. Smith J.L. Tomchick D.R. Murzin A.G. Nature. 1995; 378: 416-419Crossref PubMed Scopus (544) Google Scholar). The N-terminal threonine, Thr-β1, acts via its hydroxyl group as nucleophile in peptide bond hydrolysis and presumably is assisted by its own amino group as proton acceptor. In addition, Lys-β33 was found to be central for catalysis (12Löwe J. Stock D. Jap B. Zwickl P. Baumeister W. Huber R. Science. 1995; 268: 533-539Crossref PubMed Scopus (1377) Google Scholar, 25Seemüller E. Lupas A. Stock D. Löwe J. Huber R. Baumeister W. Science. 1995; 268: 579-582Crossref PubMed Scopus (584) Google Scholar), participating either indirectly by stabilizing and orienting active site residues or directly via its ε-amino group acting as proton acceptor for the Thr-β1 hydroxyl group. Both residues are necessary not only for external peptide cleavage (25Seemüller E. Lupas A. Stock D. Löwe J. Huber R. Baumeister W. Science. 1995; 268: 579-582Crossref PubMed Scopus (584) Google Scholar) but also for the autocatalytic processing of the β-subunit (28Seemüller E. Lupas A. Baumeister W. Nature. 1996; 382: 468-471Crossref PubMed Scopus (182) Google Scholar). In the latter process, the amino group of Lys-β33 must be directly involved in catalysis since the amino function of Thr-β1 is still blocked in the precursor β-subunit. N-terminal threonine residues are also found in the recently discovered eubacterial proteasomes (5Coux O. Tanaka K. Goldberg A.L. Annu. Rev. Biochem. 1996; 65: 801-847Crossref PubMed Scopus (2232) Google Scholar) and in some of the eukaryotic proteasomal β-type subunits. A conserved catalytic mechanism in archaebacterial and eukaryotic proteasomes was first implicated through the covalent binding of the natural, highly specific proteasome inhibitor lactacystin to the N-terminal threonine of the mammalian β-type subunit X/MB1 (29Fenteany G. Standaert R.F. Lane W.S. Choi S. Corey E.J. Schreiber S.L. Science. 1995; 268: 726-731Crossref PubMed Scopus (1496) Google Scholar). Although N-terminal threonine modification by lactacystin was not detected in other mammalian β-type subunits, all three main peptidolytic activities were inhibitable by this compound. A recent mutational analysis of the yeast subunit Pre2/Doa3, a homologue of X/MB1, showed that this subunit type indeed represents a threonine protease and is correlated with chymotrypsin-like peptidase activity (30Chen P. Hochstrasser M. Cell. 1996; 86: 961-972Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar). Pre2 also undergoes autocatalytic activation by removal of its propeptide, but in contrast to the archaebacterial β-subunit, deletion of the Pre2 propeptide was lethal. Interestingly, viability was restored by providing the Pre2 propeptide in trans. Mutations of putative active site residues in the mammalian LMP2 subunit were found to prevent formation of the mature protein, but they did not interfere with another N-terminal cleavage in the LMP2 precursor at a position 8–10 residues upstream of the wild-type LMP2 processing site (31Schmidtke G. Kraft R. Kostka S. Henklein P. Frommel C. Löwe J. Huber R. Kloetzel P.M. Schmidt M. EMBO J. 1996; 15: 6887-6898Crossref PubMed Scopus (159) Google Scholar). This led to a model of an ordered two-step processing mechanism. Using a more extensive genetic approach in yeast we prove here that three eukaryotic 20 S proteasomal β-type subunits represent N-terminal threonine proteases, and we show that the three proteasomal peptidase activities can clearly be ascribed to active centers in the yeast β-type subunits Pre3, Pup1, and Pre2. Moreover, analysis of the N-terminal processing of the non-active β-type subunit Pre4 in proteasomal active site mutants reveals an in vivoproteolytic action of the three threonine protease subunits and implies that in wild-type proteasomes maturation of Pre4 is exerted by the next accessible active site subunit, Pup1, the ring-to-ring neighbor of Pre4. For all yeast manipulations and preparation of yeast growth media, protocols described in Refs. 32Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. Greene Publishing Association Wiley, New York1987Google Scholar and 33Methods Enzymol.Methods Enzymol1943933Guthrie, C., and Fink, G. R. (eds) (1991) Methods Enzymol., 194, 3–933Google Scholar were followed. Recombinant DNA work was carried out according to standard procedures (32Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. Greene Publishing Association Wiley, New York1987Google Scholar). Site-directed mutagenesis was performed using the PCR-based megaprimer method (Ref. 34Sarkar G. Sommer S.S. BioTechniques. 1990; 8: 404-407PubMed Google Scholar) (TableI). Briefly, derivatives of the shuttle vector pRS315 (35Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar) containing the respective proteasomal genes served as templates for a first PCR with a mutagenic primer and the appropriate one of two "outside" primers complementary to vector regions flanking the genomic inserts. The resulting product served as megaprimer for a second PCR together with the other outside primer yielding the full-length mutant gene. Suitable restriction fragments containing the mutated site were then exchanged against the corresponding wild-type fragments in the original pRS315 derivatives. The entire regions of the PCR-derived fragments were sequenced to verify the introduced mutation and to exclude unwanted additional mutations. Plasmid p15-P1 containing the PUP1 gene was created by inserting a 1.12-kbp EcoRI/XhoI fragment from pPHY97 (36Haffter P. Fox T.D. Nucleic Acids Res. 1991; 19: 5075Crossref PubMed Scopus (26) Google Scholar) containing the major part of PUP1into pRS316 (35Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). The missing native PUP1 promoter and the start of the coding region were then appended by insertion of anXhoI-cut 0.65-kbp PCR fragment derived from genomic DNA with primers PUP1–5Xho (5′-CCGCTCGAGCTCCTCTTGGGAATCACT-3′) and PUP1-cenXho (5′-CTGAGACCACTCTTGGTTC-3′), yielding p16-P1. The 1.77-kbp insert was released by partial XhoI and BamHI digest and cloned into pRS315.Table IGeneration of potential active site knock-out mutant allelesMutant alleleTemplate plasmid (gene; insert fragment in pRS315)Mutagenic primer (5′-3′)Introduced changes of restriction sitesResulting plasmidpre4-T34Ap15-E4 (PRE4; 1.40-kbpEcl136I/HindII)GGTTGCTGC GCATTAACCATNewFspI sitep15-E4T34Apre4-T42AGACGGAAGCACCTGTTACTALoss of RsaI sitep15-E4T42Apre3-T20Ap15-E3 (PRE3; 1.42-kbpNruI/SnaBI)G CCTCAATGTATGTATATAAGALoss of KpnI sitep15-E3T20Apup1-T30Ap15-P11-aSee text for details. (PUP1; 1.77 kbp)CCACGGGTG CCACCATTGTALoss ofKpnI sitep15-P1T30Apre2-T76Ap15-E2 (PRE2; 1.33 kbp, upstream end:GTAGCACCATGTGCGATCTTGLoss of RsaI sitep15-E2T76Apre2-T76S derived from exonuclease digestion,GTAGAACCATGTGCGATCTTGLoss ofRsaI sitep15-E2T76Spre2-K108A downstream end:BamHI)AACGGCCTTCACAGTTTGAGAAGNewHaeIII sitep15-E2K108Apre2-K108RAACGCGCTTCACAGTTTGAGAAGNewCfoI sitep15-E2K108RThe tools for site-directed mutagenesis of the proteasomal genes by the megaprimer method are summarized. Mutated codons in the mutagenic primers are in italics and nucleotide exchanges are underlined.1-a See text for details. Open table in a new tab The tools for site-directed mutagenesis of the proteasomal genes by the megaprimer method are summarized. Mutated codons in the mutagenic primers are in italics and nucleotide exchanges are underlined. The pRS315 derivatives harboring the different mutant alleles were introduced into the corresponding null mutant strains that were complemented by the respective wild-type genes on aURA3-marked plasmid (see TableII). 5′-Fluoroorotic acid selection was then used to identify descendants that had lost the URA3marker. The disruption alleles of PRE2, PRE3, andPRE4 have been described (see Table II). Apup1Δ::HIS3 null allele was constructed by cloning a p15-P1-derived 0.22-kbp XhoI/BclI fragment carrying 5′-flanking regions of PUP1 together with a 1.77-kbp BamHI fragment carrying the HIS3 gene into SalI/BamHI-cut pUC18 and subsequently inserting 3′-flanking regions of PUP1 on a 0.62-kbpAflII(filled-in)/EcoRI fragment from p16-P1 between the SmaI and EcoRI sites yielding plasmid p18-P1Δ::HIS3. A pup1 knock-out mutant was generated by one-step gene disruption (33Methods Enzymol.Methods Enzymol1943933Guthrie, C., and Fink, G. R. (eds) (1991) Methods Enzymol., 194, 3–933Google Scholar) in strain WCG4a/α by transformation with the pup1Δ::HIS3 fragment from p18-P1Δ::HIS3 and subsequent tetrad dissection.Table IIYeast strains used in this studyStrainRelevant genotypeWCG4aMATaleu2–3,112 ura3 his3–11,15 CanS GAL2WCG4αMATα leu2–3,112 ura3 his3-11,15 CanS GAL2WCG4a/αWCG4a X WCG4α; diploidYWH10pup1Δ::HIS3 [p16-P1]YWH11pup1Δ::HIS3 [p15-P1T30A]YUS4pup1-T30AYWH302-aR. Gückel and W. Hilt, unpublished, disruption allele as in Ref. 24.pre3Δ::HIS3 [p16-E3]YWH31pre3Δ::HIS3 [p15-E3T20A]YUS1pre3-T20AYUS5pup1-T30A pre3-T20AYHI39–1/22-bM. Bernert and W. Hilt, unpublished, disruption allele as in Ref. 23.pre4Δ2::HIS3[p16-E4]YWH41pre4Δ2::HIS3[p15-E4T34A]YWH42pre4Δ2::HIS3[p15-E4T42A]YUS2pre4-T34AYUS3pre4-T42AYWH202-cUnpublished, disruption allele as in Ref. 22.pre2Δ::HIS3 [p16-E2]YWH215pre2Δ::HIS3 [p15-E2T76S]YWH213pre2Δ::HIS3 [p15-E2K108A]YWH214pre2Δ::HIS3 [p15-E2K108R]YWH23pre2-K108AYWH24pre2-K108RYWH25pre2-T76SYWH26pre2-K108R pre3-T20AYWH22PRE2/pre2-T76AYWH220pre2Δ::HIS3 [p15-GAL-E2]YWH221pre2-T76A [p15-GAL-E2]YWH222PRE2 [p15-GAL-E2]YWH5202-dUnpublished, disruption allele as in Ref. 16.pre5Δ::HIS3[p15-GAL-E5]YWH200PRE2 [pRS425]YWH201PRE2 [p25-E2]YWH202PRE2[p25-E2T76A]All strains are isogenic with WCG4a, WCG4α (22Heinemeyer W. Gruhler A. Möhrle V. Mahé Y. Wolf D.H. J. Biol. Chem. 1993; 268: 5115-5120Abstract Full Text PDF PubMed Google Scholar), or WCG4a/α, respectively.2-a R. Gückel and W. Hilt, unpublished, disruption allele as in Ref. 24Enenkel C. Lehmann H. Kipper J. Gückel R. Hilt W. Wolf D.H. FEBS Lett. 1994; 341: 193-196Crossref PubMed Scopus (73) Google Scholar.2-b M. Bernert and W. Hilt, unpublished, disruption allele as in Ref. 23Hilt W. Enenkel C. Gruhler A. Singer T. Wolf D.H. J. Biol. Chem. 1993; 268: 3479-3486Abstract Full Text PDF PubMed Google Scholar.2-c Unpublished, disruption allele as in Ref. 22Heinemeyer W. Gruhler A. Möhrle V. Mahé Y. Wolf D.H. J. Biol. Chem. 1993; 268: 5115-5120Abstract Full Text PDF PubMed Google Scholar.2-d Unpublished, disruption allele as in Ref. 16Heinemeyer W. Tröndle N. Albrecht G. Wolf D.H. Biochemistry. 1994; 33: 12229-12237Crossref PubMed Scopus (103) Google Scholar. Open table in a new tab All strains are isogenic with WCG4a, WCG4α (22Heinemeyer W. Gruhler A. Möhrle V. Mahé Y. Wolf D.H. J. Biol. Chem. 1993; 268: 5115-5120Abstract Full Text PDF PubMed Google Scholar), or WCG4a/α, respectively. Exchange of proteasomal wild-type genes by respective mutant alleles in strain WCG4 was achieved by two-step gene replacement (33Methods Enzymol.Methods Enzymol1943933Guthrie, C., and Fink, G. R. (eds) (1991) Methods Enzymol., 194, 3–933Google Scholar). Proteasomal mutant alleles were inserted into the integrative,URA3-marked plasmid pRS306 (35Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar), and the resulting plasmids were linearized by cutting within the insert regions and introduced into WCG4. Correct chromosomal integration of the plasmids and maintenance of the mutations was verified among the transformants by genomic PCR and restriction analysis (see Table I). Descendants which by recombination had lost the plasmid sequences were then identified by 5′-fluoroorotic acid selection. Mutants and wild-type clones were distinguished by restriction analysis of genomic PCR products. Chromosomal introduction of the pre2-T76A allele was done analogously, using the diploid strain WCG4a/α, yielding the heterozygous PRE2/pre2-T76A diploid YWH22. For overexpression experiments the PRE2 andpre2-T76A genes were cloned into the LEU2-marked high copy vector pRS425 (37Christianson T.W. Sikorski R.S. Dante M. Shero J.H. Hieter P. Gene ( Amst .). 1992; 110: 119-122Crossref PubMed Scopus (1433) Google Scholar) yielding p25-E2 and p25-E2T76A. Wild-typePRE2 was brought under control of the inducibleGAL1 promoter by inserting a 0.92-kbpNspI/BamHI PRE2 fragment from p15-E2 into SphI/BamHI-cut p15-GAL/Sph, a modified version of plasmid pRS315-GAL 2P. Hieter, unpublished results. with an additional SphI site between the HindIII andSalI sites. By this the PRE2 translation-start ATG was positioned closely behind the GAL1 promoter sequences in the resulting plasmid p15-GAL-E2. Plasmid p15-GAL-E5 was constructed analogously by inserting a 0.83-kbpNspI/SacI PRE5 fragment intoSphI/SacI-cut p15-GAL/Sph. Strain YWH220 (pre2Δ::HIS3 [p15-GAL-E2]) is a haploid descendant of a diploid pre2Δ::HIS3/PRE2 strain transformed with p15-GAL-E2. Accordingly, strain YWH520 (pre5Δ::HIS3 [p15-GAL-E5]) was derived by sporulation of a pre5Δ::HIS3/PRE5 diploid harboring p15-GAL-E5. YWH22 (PRE2/pre2-T76A) transformed with p15-GAL-E2 led to YWH221 and YWH222 after sporulation and tetrad dissection on YPGal plates. For shut-off experiments strains transformed with p15-GAL-derived plasmids were pre-grown in 2% galactose containing synthetic complete medium without leucine, washed with water, and divided into fresh complete medium containing either glucose or galactose. Conditions for colony overlay assays applied to indicate in situ proteasomal peptidase activity against the substratesN-Cbz-Gly-Gly-Leu-p-nitroanilide andN-Suc-Leu-Leu-Glu-β-naphthylamide have been described (15Heinemeyer W. Kleinschmidt J.A. Saidowsky J. Escher C. Wolf D.H. EMBO J. 1991; 10: 555-562Crossref PubMed Scopus (357) Google Scholar,23Hilt W. Enenkel C. Gruhler A. Singer T. Wolf D.H. J. Biol. Chem. 1993; 268: 3479-3486Abstract Full Text PDF PubMed Google Scholar). Trypsin-like proteasomal activity in yeast cells grown on solid medium was assayed as follows: cells grown as patches on YPD plates covered with sterile filter disks were permeabilized by soaking the filter in 3 ml of 50 mm Tris-HCl, pH 9.3, 1% toluene, 5% ethanol for 15 min. The dried filter was then covered with 10 ml of substrate solution made of 1% agarose, 50 mm Tris-HCl, pH 9.3, 0.5 mm each of EDTA and EGTA, and 100 μl of 50 mm N-Cbz-Ala-Arg-Arg-4-methoxy-β-naphthylamide in dimethyl sulfoxide. After incubation at 50 °C for 4–6 h released 4-methoxy-β-naphthylamide was converted to an azo dye as described (23Hilt W. Enenkel C. Gruhler A. Singer T. Wolf D.H. J. Biol. Chem. 1993; 268: 3479-3486Abstract Full Text PDF PubMed Google Scholar). For measurements of peptidase activities in defined amounts of intact cells, about 1 A 600 of cells per assay were washed with water and either permeabilized by adding chloroform to the moist cell pellet or, for determination of trypsin-like activity, by resuspending the cells in 100 μl of 50 mm Tris-HCl, pH 9.3, 1% toluene, 5% ethanol. After 15 min cells were collected and resuspended in 200 μl of enzyme assay solutions as described in Ref.38Fischer M. Hilt W. Richter-Ruoff B. Gonen H. Ciechanover A. Wolf D.H. FEBS Lett. 1994; 355: 69-75Crossref PubMed Scopus (33) Google Scholar for fluorogenic peptide substrates and in Ref. 15Heinemeyer W. Kleinschmidt J.A. Saidowsky J. Escher C. Wolf D.H. EMBO J. 1991; 10: 555-562Crossref PubMed Scopus (357) Google Scholar forN-Cbz-Gly-Gly-Leu-p-nitroanilide. Incubation of the reaction mixtures was done at 37 °C with vigorous shaking. After stopping the reactions the amount of released fluorophores or chromophores in the supernatants was determined photometrically as described (15Heinemeyer W. Kleinschmidt J.A. Saidowsky J. Escher C. Wolf D.H. EMBO J. 1991; 10: 555-562Crossref PubMed Scopus (357) Google Scholar, 38Fischer M. Hilt W. Richter-Ruoff B. Gonen H. Ciechanover A. Wolf D.H. FEBS Lett. 1994; 355: 69-75Crossref PubMed Scopus (33) Google Scholar) and related to the optical density of the cells employed in the test. Peptidase activity measurements with crude extracts, prepared in small scale according to Ref. 15Heinemeyer W. Kleinschmidt J.A. Saidowsky J. Escher C. Wolf D.H. EMBO J. 1991; 10: 555-562Crossref PubMed Scopus (357) Google Scholar, were done analogously. Large scale preparation of crude extracts and fractionation by gel filtration chromatography were carried out essentially as in Ref. 38Fischer M. Hilt W. Richter-Ruoff B. Gonen H. Ciechanover A. Wolf D.H. FEBS Lett. 1994; 355: 69-75Crossref PubMed Scopus (33) Google Scholar. Measurement of β-galactosidase activity using o-nitrophenyl-β-d-galactoside in strains harboring plasmids expressing ubiquitin-X-β-galactosidase fusion proteins was done according to Ref. 39Richter-Ruoff B. Heinemeyer W. Wolf D.H. FEBS Lett. 1992; 302: 192-196Crossref PubMed Scopus (66) Google Scholar. Preparation of heat-denatured crude cell extracts (Fig. 6) or non-denatured cell extracts (Fig. 3), separation by SDS-polyacrylamide gel electrophoresis on 18% gels, and electroblotting have been described (15Heinemeyer W. Kleinschmidt J.A. Saidowsky J. Escher C. Wolf D.H. EMBO J. 1991; 10: 555-562Crossref PubMed Scopus (357) Google Scholar, 38Fischer M. Hilt W. Richter-Ruoff B. Gonen H. Ciechanover A. Wolf D.H. FEBS Lett. 1994; 355: 69-75Crossref PubMed Scopus (33) Google Scholar). Fusion proteins between glutathione S-transferase and Pre2 or Pre4 were expressed inEscherichia coli from pGEX vectors (Pharmacia Biotech Inc.) and purified either from inclusion bodies according to standard protocols (32Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. Greene Publishing Association Wiley, New York1987Google Scholar) or according to the protocol provided by the manufacturer. Polyclonal antibodies against the fusion proteins were raised in rabbits by the Eurogentech Co. For immunodetection by enhanced chemiluminescence (Amersham Corp.) following the manufacturer's protocol, the anti-Pre2 and anti-Pre4 antisera were used in 1:2000 and 1:5000 dilution, respectively.Figure 3Anti-Pre4 immunoblot analysis of potential active site mutants in Pre4, Pre3, or/and Pup1. Crude extracts of cells with the genotypes as indicated were prepared from stationary cultures and separated on an 18% polyacrylamide SDS-gel prior to electroblotting and detection of immunoreactive Pre4 protein. Molecular mass standards (in kDa) are presented on the right. The positions of non-processed (pro-Pre4) and completely processed (m-Pre4) Pre4 species are marked on theleft. Bands derived from unspecific reaction of the anti-Pre4 immunoserum with unknown proteins are labeled withasterisks. Note that the intense band of cross-reacting material covers up minor amounts of pro-Pre4 only seen in lanes 4 and 5 after shorter exposure. 20 S, purified yeast 20 S proteasome reference sample.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Assuming a conserved catalytic mechanism of proteasomes throughout the kingdoms of life a sequen
Referência(s)