Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Oncogenic Activation of c-Myb Correlates with a Loss of Negative Regulation by TIF1β and Ski

2004; Elsevier BV; Volume: 279; Issue: 16 Linguagem: Inglês

10.1074/jbc.m313069200

ISSN

1083-351X

Autores

Teruaki Nomura, Jun Tanikawa, Hiroshi Akimaru, Chie Kanei‐Ishii, Emi Ichikawa-Iwata, Md Matiullah Khan, Hiroki Ito, Shunsuke Ishii,

Tópico(s)

Cancer-related Molecular Pathways

Resumo

The c-myb proto-oncogene product (c-Myb) regulates proliferation of hematopoietic cells by inducing the transcription of a group of target genes. Removal or mutations of the negative regulatory domain (NRD) in the C-terminal half of c-Myb leads to increased transactivating capacity and oncogenic activation. Here we report that TIF1β directly binds to the NRD and negatively regulates the c-Myb-dependent trans-activation. In addition, three corepressors (Ski, N-CoR, and mSin3A) bind to the DNA-binding domain of c-Myb together with TIF1β and recruit the histone deacetylase complex to c-Myb. Furthermore, the Drosophila TIF1β homolog, Bonus, negatively regulates Drosophila Myb activity. The Ski corepressor competes with the coactivator CBP for binding to c-Myb, indicating that the selection of coactivators and corepressors is a key event for c-Myb-dependent transcription. Mutations or deletion of the NRD of c-Myb and the mutations found in the DNA-binding domain of v-Myb decrease the interaction with these corepressors and weaken the corepressor-induced negative regulation of Myb activity. These observations have conceptual implications for understanding how the nuclear oncogene is activated. The c-myb proto-oncogene product (c-Myb) regulates proliferation of hematopoietic cells by inducing the transcription of a group of target genes. Removal or mutations of the negative regulatory domain (NRD) in the C-terminal half of c-Myb leads to increased transactivating capacity and oncogenic activation. Here we report that TIF1β directly binds to the NRD and negatively regulates the c-Myb-dependent trans-activation. In addition, three corepressors (Ski, N-CoR, and mSin3A) bind to the DNA-binding domain of c-Myb together with TIF1β and recruit the histone deacetylase complex to c-Myb. Furthermore, the Drosophila TIF1β homolog, Bonus, negatively regulates Drosophila Myb activity. The Ski corepressor competes with the coactivator CBP for binding to c-Myb, indicating that the selection of coactivators and corepressors is a key event for c-Myb-dependent transcription. Mutations or deletion of the NRD of c-Myb and the mutations found in the DNA-binding domain of v-Myb decrease the interaction with these corepressors and weaken the corepressor-induced negative regulation of Myb activity. These observations have conceptual implications for understanding how the nuclear oncogene is activated. The c-myb proto-oncogene is the cellular progenitor of the v-myb oncogenes carried by the chicken retroviruses avian myeloblastosis virus (AMV) 1The abbreviations used are: AMV, avian myeloblastosis virus; ChIP, chromatin immunoprecipitation; c-Myb, c-myb proto-oncogene product; DBD, DNA-binding domain; dmyb, Drosophila myb; HDAC, histone deacetylase; HIPK2, homeodomain-interacting protein kinase 2; HP-1, heterochromatin protein-1; v-Myb, NRD, negative regulatory domain; v-myb oncogene product; R2, R3, repeats 2 and 3; CBP, cAMP-response element-binding protein; GST, glutathione S-transferase; MBS-I, Myb-binding site I; TRβ, thyroid hormone receptor β. and E26, which cause acute myeloblastic leukemia or erythroblastosis (1Klempnauer K.-H. Gonda T.J. Bishop J.M. Cell. 1982; 31: 453-463Abstract Full Text PDF PubMed Scopus (323) Google Scholar, 2Leprince D. Gegonne A. Coll J. de Taisne C. Schneeberger A. Lagrou C. Stehelin D. Nature. 1983; 306: 395-397Crossref PubMed Scopus (331) Google Scholar). The level of c-myb expression is high in immature hematopoietic cells, and its expression is turned off during terminal differentiation (3Gonda T.J. Metcalf D. Nature. 1984; 310: 249-251Crossref PubMed Scopus (389) Google Scholar). c-myb-deficient mice show a defect in definitive hematopoiesis in the fetal liver due to a severe reduction in the number of progenitor cells, indicating that c-myb is essential for the proliferation of immature hematopoietic cells (4Mucenski M.L. McLain K. Kier A.B. Swerdlow S.H. Schereiner C.M. Miller T.A. Pietryga D.W. Scott W.J. Potter S.S. Cell. 1991; 65: 677-689Abstract Full Text PDF PubMed Scopus (877) Google Scholar). Analysis of homozygous null c-myb/Rag1 chimeric mice indicates that c-myb is also essential for early T-cell development (5Allen III, R.D. Bender T.P. Siu G. Genes Dev. 1999; 13: 1073-1078Crossref PubMed Scopus (124) Google Scholar). The myb gene is well conserved not only in vertebrates but also in other species. Drosophila melanogaster has one myb gene (dmyb), which is required in diverse cellular lineages throughout the course of development (6Katzen A.L. Jackson J. Harmon B.P. Fung S.M. Ramsay G. Bishop J.M. Genes Dev. 1998; 12: 831-843Crossref PubMed Scopus (67) Google Scholar). The c-myb gene product (c-Myb) is a transcriptional activator that recognizes the specific DNA sequence 5′-AACNG-3′ (7Biedenkapp H. Borgmeyer U. Sippel A.E. Klempnauer K.-H. Nature. 1988; 335: 835-837Crossref PubMed Scopus (434) Google Scholar, 8Sakura H. Kanei-Ishii C. Nagase T. Nakagoshi H. Gonda T.J. Ishii S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5758-5762Crossref PubMed Scopus (276) Google Scholar, 9Weston K. Bishop J.M. Cell. 1989; 58: 85-93Abstract Full Text PDF PubMed Scopus (213) Google Scholar, 10Ness S.A. Marknell A. Graf T. Cell. 1989; 59: 1115-1125Abstract Full Text PDF PubMed Scopus (375) Google Scholar). Some of the c-Myb target genes, including c-myc, are required for the G1/S transition in the cell cycle (11Nakagoshi H. Kanei-Ishii C. Sawazaki T. Mizuguchi G. Ishii S. Oncogene. 1992; 7: 1233-1240PubMed Google Scholar, 12Schmidt M. Nazarov V. Stevens L. Watson R. Wolff L. Mol. Cell. Biol. 2000; 20: 1970-1981Crossref PubMed Scopus (56) Google Scholar). In contrast, dmyb is required for the G2/M transition (6Katzen A.L. Jackson J. Harmon B.P. Fung S.M. Ramsay G. Bishop J.M. Genes Dev. 1998; 12: 831-843Crossref PubMed Scopus (67) Google Scholar), and cyclin B expression is directly regulated by dMyb (13Okada M. Akimaru H. Hou D.-X. Takahashi T. Ishii S. EMBO J. 2002; 21: 675-684Crossref PubMed Scopus (61) Google Scholar). Several other target genes, including mim-1, GBX2, and bcl-2, are involved in lineage commitment in differentiation and blockage of apoptosis (10Ness S.A. Marknell A. Graf T. Cell. 1989; 59: 1115-1125Abstract Full Text PDF PubMed Scopus (375) Google Scholar, 14Kowenz-Leutz E. Herr P. Niss K. Leutz A. Cell. 1997; 91: 185-195Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 15Frampton J. Ramqvist T. Graf T. Genes Dev. 1996; 10: 2720-2731Crossref PubMed Scopus (154) Google Scholar, 16Taylor D. Badiani P. Weston K. Genes Dev. 1996; 10: 2732-2744Crossref PubMed Scopus (162) Google Scholar). c-Myb has three functional domains that are responsible for DNA binding, transcriptional activation, and negative regulation (8Sakura H. Kanei-Ishii C. Nagase T. Nakagoshi H. Gonda T.J. Ishii S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5758-5762Crossref PubMed Scopus (276) Google Scholar). The DNA-binding domain (DBD) in the N-terminal region of c-Myb consists of three imperfect tandem repeats of 51-52 amino acids, each containing a helix-turn-helix variation motif. Repeats 2 and 3 (R2 and R3) are sufficient for binding to the target DNA sequence (17Ogata K. Morikawa S. Nakamura H. Sekikawa A. Inoue T. Kanai H. Sarai A. Ishii S. Nishimura Y. Cell. 1994; 79: 639-648Abstract Full Text PDF PubMed Scopus (434) Google Scholar). The transcriptional activation domain is adjacent to the DBD, to which the transcriptional coactivator CBP binds (18Dai P. Shinagawa T. Nomura T. Harada J. Kaul S.C. Wadhwa R. Khan M.M. Akimaru H. Sasaki H. Colmenares C. Ishii S. Genes Dev. 2002; 16: 2843-2848Crossref PubMed Scopus (70) Google Scholar). Analysis of various oncogenically activated myb genes suggests that truncation of either the N or C terminus of c-Myb can cause oncogenic activation. For example, the v-Myb protein encoded by AMV is N- and C-terminally truncated versions of c-Myb (1Klempnauer K.-H. Gonda T.J. Bishop J.M. Cell. 1982; 31: 453-463Abstract Full Text PDF PubMed Scopus (323) Google Scholar). Deletion of the negative regulatory domain (NRD) located in the C-terminal portion of the molecule increases both the trans-activation and transformation capacity of c-Myb, implying that the NRD normally represses c-Myb activity (8Sakura H. Kanei-Ishii C. Nagase T. Nakagoshi H. Gonda T.J. Ishii S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5758-5762Crossref PubMed Scopus (276) Google Scholar, 19Gonda T.J. Buckmaster C. Ramsay R.G. EMBO J. 1989; 8: 1777-1783Crossref PubMed Scopus (77) Google Scholar, 20Hu Y. Ramsay R.G. Kanei-Ishii C. Ishii S. Gonda T.J. Oncogene. 1991; 6: 1549-1553PubMed Google Scholar, 21Dubendorff J.W. Whittaker L.J. Eltman J.T. Lipsick J.S. Genes Dev. 1992; 6: 2524-2535Crossref PubMed Scopus (89) Google Scholar). The v-Myb encoded by AMV lacks the C-proximal region of the NRD. In addition, the mutations of only the leucine-rich region in the NRD result in oncogenic activation of c-myb (22Kanei-Ishii C. MacMillan E.M. Nomura T. Sarai A. Ramsay R.G. Aimoto S. Ishii S. Gonda T.J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 3088-3092Crossref PubMed Scopus (95) Google Scholar). Thus, the NRD appears to contain multiple subdomains, and the deletion of any of these may result in the oncogenic activation of c-myb. However, the mechanism by which c-Myb is regulated by NRD still unclear. The ski gene is also a nuclear oncogene. The products of the c-ski proto-oncogene and its related gene sno (ski-related novel) (c-Ski and Sno) directly bind to two other corepressors, N-CoR/SMRT and mSin3A, and act as transcriptional corepressors (23Nomura T. Khan M.M. Kaul S.C. Dong H.-D. Wadhwa R. Colmanares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar). mSin3A and N-CoR/SMRT also interact with each other (24Heinzel T. Lavinsky R.M. Mullen T.-M. Söderström M. Laherty C.D. Torchia J. Yang W.-M. Brard G. Ngo S.D. Davie J.R. Seto E. Eisenman R.N. Rose D.W. Glass C.K. Rosenfeld M.G. Nature. 1997; 387: 43-48Crossref PubMed Scopus (1084) Google Scholar, 25Alland L. Muhle R. Hou Jr., H. Potes J. Chin L. Schreiber-Agus N. DePinho R.A. Nature. 1997; 387: 49-55Crossref PubMed Scopus (738) Google Scholar, 26Nagy L. Kao H.-Y. Chakravarti D. Lin R.J. Hassig C.A. Ayer D.E. Schreiber S.L. Evans R.M. Cell. 1997; 89: 373-380Abstract Full Text Full Text PDF PubMed Scopus (1107) Google Scholar) and form macromolecular complexes with class I and II histone deacetylase (HDAC), respectively (27Zhang Y. Iratni R. Erdjument-Bromage H. Tempst P. Reinberg D. Cell. 1997; 89: 357-364Abstract Full Text Full Text PDF PubMed Scopus (501) Google Scholar, 28Huang E.Y. Zhang J. Miska E.A. Guenther M.G. Kouzarides T. Lazar M.A. Genes Dev. 2000; 14: 45-54PubMed Google Scholar, 29Kao H.Y. Downes M. Ordentlich P. Evans R.M. Genes Dev. 2000; 14: 55-66PubMed Google Scholar). All three corepressors (Ski/Sno, mSin3A, and N-CoR/SMRT) are required for transcriptional repression by Mad and non-liganded thyroid hormone receptor β (30Hörlein A.J. Näär A.M. Heinzel T. Torchia J. Gloss B. Kurokawa R. Ryan A. Kamei Y. Söderström M. Glass C.K. Rosenfeld M.G. Nature. 1995; 377: 397-404Crossref PubMed Scopus (1712) Google Scholar, 23Nomura T. Khan M.M. Kaul S.C. Dong H.-D. Wadhwa R. Colmanares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar, 24Heinzel T. Lavinsky R.M. Mullen T.-M. Söderström M. Laherty C.D. Torchia J. Yang W.-M. Brard G. Ngo S.D. Davie J.R. Seto E. Eisenman R.N. Rose D.W. Glass C.K. Rosenfeld M.G. Nature. 1997; 387: 43-48Crossref PubMed Scopus (1084) Google Scholar, 25Alland L. Muhle R. Hou Jr., H. Potes J. Chin L. Schreiber-Agus N. DePinho R.A. Nature. 1997; 387: 49-55Crossref PubMed Scopus (738) Google Scholar, 26Nagy L. Kao H.-Y. Chakravarti D. Lin R.J. Hassig C.A. Ayer D.E. Schreiber S.L. Evans R.M. Cell. 1997; 89: 373-380Abstract Full Text Full Text PDF PubMed Scopus (1107) Google Scholar), suggesting that different corepressor-HDAC complexes interact with each other and mediate transcriptional repression together. c-Ski also directly binds to other multiple transcription factors, including Smads and Gli3, and mediates transcriptional repression or inhibits transcriptional activation (31Sun Y Liu X. Eaton E.N. Lane W.S. Lodish H.F. Weinberg R.A. Mol. Cell. 1999; 4: 499-509Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar, 32Luo K. Stroschein S.L. Wang W. Chen D. Martens E. Zhou S. Zhou Q. Genes Dev. 1999; 13: 2196-2206Crossref PubMed Scopus (390) Google Scholar, 33Dai P. Akimaru H. Tanaka Y. Hou D.X. Yasukawa T. Kanei-Ishii C. Takahashi T. Ishii S. Genes Dev. 1996; 10: 528-540Crossref PubMed Scopus (303) Google Scholar). Here, we demonstrate that four corepressors, including c-Ski, directly bind to c-Myb via multiple domains in the c-Myb molecule to negatively regulate c-Myb activity. Deletions or mutations of the NRD or the point mutations found in v-Myb reduces the affinity with these corepressors, leading to increased c-Myb activity. Thus, our results suggest that selection of coactivators or corepressors is a key event for oncogenic activation of c-Myb. Yeast Two-hybrid Screening and in Vitro Binding Assays—The yeast two-hybrid screening was performed using the mouse embryonic cDNA library as described previously (23Nomura T. Khan M.M. Kaul S.C. Dong H.-D. Wadhwa R. Colmanares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar). The protein containing the C-terminal 312 amino acids of mouse c-Myb was used as bait. GST pull-down assays were performed as described previously (23Nomura T. Khan M.M. Kaul S.C. Dong H.-D. Wadhwa R. Colmanares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar). To increase the solubility of GST fusion proteins expressed in bacteria, the thioredoxin coexpression system (34Yasukawa T. Kanei-Ishii C. Maekawa T. Fujimoto J. Yamamoto T. Ishii S. J. Biol. Chem. 1995; 270: 25328-25331Abstract Full Text Full Text PDF PubMed Scopus (281) Google Scholar) was used. The binding buffer used for most of the experiments consists of 20 mm Hepes, pH 7.5, 1 mm dithiothreitol, 0.1% Nonidet P-40, and 100 mm KCl (for interactions between Myb and mSin3A or N-CoR) or 150 mm KCl (for interactions between Myb and c-Ski). The binding buffer used for the experiments with the R23 fragment consists of 50 mm phosphate buffer, pH 6.8, 20 mm dithiothreitol, and 100 mm KCl. Coimmunoprecipitation and HDAC Assay—For coimmunoprecipitation of endogenous proteins, lysates were prepared from Molt-4 cells by mild sonication in NET buffer (20 mm Tris-HCl, pH 8.0, 1 mm EDTA, 0.5% Nonidet P-40, protease inhibitor mixture) containing 150 mm NaCl. Anti-c-Myb monoclonal antibody 1-1, the rabbit anti-N-CoR antibody (23Nomura T. Khan M.M. Kaul S.C. Dong H.-D. Wadhwa R. Colmanares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar), the anti-mSin3A antibody (Santa Cruz Biotechnology, AK-11), or normal rabbit IgG were used for immunoprecipitation. The immunocomplexes were used in Western blotting with rabbit anti-TIF1β polyclonal antibodies raised against GST-TIF1βC, anti-c-Ski monoclonal antibody, rabbit anti-mSin3A antibody (Santa Cruz Biotechnology, AK-11), or anti-c-Myb monoclonal antibody 1-1. To study the interaction between c-Ski and various forms of c-Myb, 293 cells were cotransfected via the CaPO4 method with the c-Ski expression plasmid pact-Ski (10 μg) and the c-Myb expression plasmid pact-FLAG-c-Myb (10 μg). Forty hours after transfection, cells were lysed as described (23Nomura T. Khan M.M. Kaul S.C. Dong H.-D. Wadhwa R. Colmanares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar), and immunoprecipitation was performed with the anti-FLAG monoclonal antibody (M2, Sigma). Western blotting was performed using the anti-c-Ski monoclonal antibody. Assays for HDAC activity were performed essentially as described (23Nomura T. Khan M.M. Kaul S.C. Dong H.-D. Wadhwa R. Colmanares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar) using lysates prepared from 293 cells that were transfected with 10 μg of the c-Myb expression plasmid. Analysis of Repressor Domains in c-Myb—The cytomegalovirus promoter was used to express the Gal4-c-Myb fusion proteins consisting of the Gal4 DNA-binding domain fused to various portions of c-Myb. CV-1 cells were transfected with a mixture of 3 μg of the luciferase reporter containing the TK promoter and six Gal4-binding sites, 0.33 μg of the Gal4-c-Myb or Gal4 expression plasmids, and 1 μg of the internal control plasmid pRL-TK (Promega). The luciferase assays were performed using the dual-luciferase assay system (Promega). Subcellular Localization of c-Myb and Corepressors—CV-1 cells were transfected with a mixture of 1.5 μg of the FLAG-c-Myb expression plasmid and 1.5 μg of the plasmids that express c-Ski, mSin3A, or N-CoR. Forty hours after transfection, cells were fixed and stained as described (23Nomura T. Khan M.M. Kaul S.C. Dong H.-D. Wadhwa R. Colmanares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar) with anti-c-Myb, anti-c-Ski, and anti-FLAG antibodies. The signals for the different proteins were visualized by rhodamineand fluorescein isothiocyanate-conjugated secondary antibodies and analyzed by confocal microscopy. Chromatin Immunoprecipitation Assays—The retroviral expression plasmids for wild-type c-Myb or CT3 were constructed using the MSCV (murine stem cell virus)-based retroviral vector, and viruses were prepared as described (35Shinagawa T. Nomura T. Colmenares C. Ohira M. Nakagawara A. Ishii S. Oncogene. 2001; 20: 8100-8108Crossref PubMed Scopus (80) Google Scholar). To generate M1 cell clones that express c-Myb together with the neomycin resistance gene, M1 cells were infected with viruses and then grown in the presence of G418 (400 μg/ml). ChIP assay was carried out essentially by using the method of Weinmann and Farnham (36Weinmann A.S. Farnham P.J. Methods. 2002; 26: 37-47Crossref PubMed Scopus (301) Google Scholar). In brief, 1.5 × 107 M1 cells were fixed with 1% formal-dehyde for 10 min at room temperature. Nuclei were isolated and suspended in nuclei lysis buffer (50 mm Tris-HCl, pH 8.1, 10 mm EDTA, 1% SDS, protease inhibitors) and sonicated. After the centrifugation, the supernatant was diluted with IP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris-HCl, pH 8.1, 167 mm NaCl) and treated with antibody against each corepressor. The immunocomplex was collected and was incubated at 65 °C with IP elution buffer (50 mm NaHCO3, 1% SDS) to release the proteins and DNA complex. DNA was extracted and used for PCR. PCR reaction (94 °C for 45 s, 55 °C for 30 s, and 72 °C for 3 min) was carried out with [32P]dCTP for 30 cycles. PCR products were analyzed by electrophoresis on an 8% polyacrylamide gel. The primers used for the amplification of myc promoter were as follows: 782GTGCCCAGTCAACATAACTGTACG805 and 1101GGCGTATTGTGTGGAGCGAGGCAG1124. Luciferase Reporter Assays—In the experiments using the reporter containing multiple Myb-binding sites, CV-1 cells (2 × 105 cells per 60-mm dish) were cotransfected using LipofectAMINE Plus (Invitrogen) with the 6MBS-I-SV40-luc reporter (0.2 μg), the c-Myb expression plasmid (0.03 μg), the corepressor expression plasmid (0.5 or 1 μg), and the internal control plasmid pRL-TK (0.05 μg), followed by luciferase assays. The chicken β-actin promoter was used to express c-Myb and various corepressors. In the case of assays using the 6MBS-I-TK-luc reporter (1 μg), the plasmid to express c-Myb (0.1 μg), or the v-Myb (0.03 μg) was used together with the same amounts of other plasmids as described above. The dominant negative form of the TIF1β expression plasmid was constructed by inserting the DNA fragment encoding the RBCC motifs and the artificial nuclear localization signal into the β-actin promoter-based vector. In the experiments using the reporter containing the c-myc promoter, CV-1 cells (4 × 105 cells per 100-mm dish) were cotransfected by the CaPO4 method with the myc-CAT reporter (4 μg) (11Nakagoshi H. Kanei-Ishii C. Sawazaki T. Mizuguchi G. Ishii S. Oncogene. 1992; 7: 1233-1240PubMed Google Scholar), the c-Myb expression plasmid (4 μg), the corepressor expression plasmid (0.5 or 2.5 μg), and the internal control plasmid pact-β-gal (0.3 μg), followed by luciferase assays. The total amount of plasmid DNA was adjusted to 12 μg by adding the control plasmid DNA lacking the cDNA. Genetic Interaction between Bon and dMyb—Two alleles of dmyb mutants were described previously (13Okada M. Akimaru H. Hou D.-X. Takahashi T. Ishii S. EMBO J. 2002; 21: 675-684Crossref PubMed Scopus (61) Google Scholar). The bon241 and bon487 mutants (37Beckstead R. Ortiz J.A. Sanchez C. Prokopenko S.N. Chambon P. Losson R. Bellen H.J. Mol. Cell. 2001; 7: 753-765Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar) were provided by H. J. Bellen. Eye imaginal discs were dissected from late third-stage larvae, fixed, and stained with the anti-CycB antibody (gift from C. Lehner) as described (13Okada M. Akimaru H. Hou D.-X. Takahashi T. Ishii S. EMBO J. 2002; 21: 675-684Crossref PubMed Scopus (61) Google Scholar). For analysis of the lethal stages, dmyb2507 (hypomorph) and dmyb 1The abbreviations used are: AMV, avian myeloblastosis virus; ChIP, chromatin immunoprecipitation; c-Myb, c-myb proto-oncogene product; DBD, DNA-binding domain; dmyb, Drosophila myb; HDAC, histone deacetylase; HIPK2, homeodomain-interacting protein kinase 2; HP-1, heterochromatin protein-1; v-Myb, NRD, negative regulatory domain; v-myb oncogene product; R2, R3, repeats 2 and 3; CBP, cAMP-response element-binding protein; GST, glutathione S-transferase; MBS-I, Myb-binding site I; TRβ, thyroid hormone receptor β. (hypomorph) were balanced by FM7c,y and bon21B (amorph (37Beckstead R. Ortiz J.A. Sanchez C. Prokopenko S.N. Chambon P. Losson R. Bellen H.J. Mol. Cell. 2001; 7: 753-765Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar)) was balanced by TM6, Tb. dmyb2507/FM7c,y and dmyb 1The abbreviations used are: AMV, avian myeloblastosis virus; ChIP, chromatin immunoprecipitation; c-Myb, c-myb proto-oncogene product; DBD, DNA-binding domain; dmyb, Drosophila myb; HDAC, histone deacetylase; HIPK2, homeodomain-interacting protein kinase 2; HP-1, heterochromatin protein-1; v-Myb, NRD, negative regulatory domain; v-myb oncogene product; R2, R3, repeats 2 and 3; CBP, cAMP-response element-binding protein; GST, glutathione S-transferase; MBS-I, Myb-binding site I; TRβ, thyroid hormone receptor β./FM7c,y females were mated with males of +/Y or +/Y; bon21B/TM6, Tb. The offspring were grown at 25 °C, and the males of third instar larvae hemizygous for dmyb and the FM7c balancer were selected by the size of the gonads embedded in the opaque fat body. Furthermore, the male larvae were separated by the presence or the absence of the y+ cuticular phenotypes. The bon21B chromosome was isolated by the absence of the Tb phenotype. The viability was calculated as a standard value from the number of male larvae hemizygous for FM7c/Y or FM7c/Y; bon21B/+. TIF1β Binds to the NRD of c-Myb—To identify putative inhibitors that bind to the NRD of c-Myb, we performed yeast two-hybrid screening using the NRD of mouse c-Myb as bait. This resulted in the identification of clones encoding TIF1β (also called as KAP-1). TIF1β, which contains a RING finger, B boxes, a coiled-coil region, and a plant homeodomain (PHD) finger, was originally identified by two groups as a protein that binds to the heterochromatin protein-1 (HP-1) (38Le Douarin B. Nielsen A.L. Garnier J.M. Ichinose H. Jeanmougin F. Losson R. Chambon P. EMBO J. 1996; 15: 6701-6715Crossref PubMed Scopus (468) Google Scholar) or to the KRAB repression domain (39Friedman J.R. Fredericks W.J. Jensen D.E. Speicher D.W. Huang X.P. Neilson E.G. Rauscher III, F.J. Genes Dev. 1996; 10: 2067-2078Crossref PubMed Scopus (539) Google Scholar). TIF1β was subsequently found to act as a corepressor that associates with the HDAC complex and HP-1 (40Nielsen A.L. Ortiz J.A. You J. Oulad-Abdelghani M. Khechumian R. Gansmuller A. Chambon P. Losson R. EMBO J. 1999; 18: 6385-6395Crossref PubMed Scopus (294) Google Scholar, 41Ryan R.F. Schultz D.C. Ayyanathan K. Singh P.B. Friedman J.R. Fredericks W.J. Rauscher III, F.J. Mol. Cell. Biol. 1999; 19: 4366-4378Crossref PubMed Scopus (315) Google Scholar). The TIF1β clones isolated in our screening encoded the 92-amino acid region that includes the B1 box (Fig. 1A). In vitro translated c-Myb efficiently bound to the GSTTIF1βN protein containing the N-terminal half of TIF1β, but not to the GST-TIF1βC protein that contains the C-terminal half of TIF1β (Fig. 1A, lower middle panel). The bacterially expressed recombinant NRD also bound to the GST-TIF1βN protein (Fig. 1A, lower right panel). We then performed GST pull-down assays using in vitro translated TIF1β and GST-NRD fusion proteins that contain the NRD of c-Myb. TIF1β efficiently bound to the GST-NRD, but mutation of the leucine-rich region (L34P) dramatically decreased but did not completely abrogate the affinity with TIF1β (Fig. 1B, lower left panel, see also Supplementary Fig. 1B for GST-NRD proteins). We also performed GST pull-down assays using GST-TIF1βN and a series of in vitro translated C-terminally truncated forms of c-Myb bearing the mutation L34P in the leucine-rich region. The c-Myb protein truncated up to amino acid 500 still retained the capacity to interact with TIF1β, but truncation up to amino acid 444 completely abrogated binding, indicating that TIF1β binds to the region between amino acids 444 and 500 (Fig. 1B, lower right panel). Thus, TIF1β interacts with c-Myb at both the leucine-rich region and a C-terminal region in the NRD. Supporting this is that TIF1β binds to AMV-v-Myb, which lacks the C-terminal region of the NRD, with lower affinity than to c-Myb (Fig. 1B). Binding of c-Myb with Multiple Corepressors—A recent study on corepressors demonstrates that multiple corepressors bind to the same transcriptional factor. This raises the possibility that several other corepressors may bind to c-Myb together with TIF1β. To investigate this, we analyzed the interaction between c-Myb and three other known corepressors, c-Ski, N-CoR, and mSin3A. All three in vitro translated proteins bound to GST-c-Myb (Fig. 2A). In vitro translated mSin3A and c-Ski also bound to GST-TIF1βN (Fig. 2A). We previously demonstrated that c-Ski binds to both N-CoR and mSin3A (23Nomura T. Khan M.M. Kaul S.C. Dong H.-D. Wadhwa R. Colmanares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar). Thus, N-CoR, mSin3A, and TIF1β can all bind to c-Ski. Given that the four corepressors can interact with each other, these results suggest that these corepressors bind to c-Myb simultaneously or sequentially (see "Discussion"). To investigate the in vivo interaction between c-Myb and the corepressors, we performed the coimmunoprecipitation experiments using Molt-4 cell lysates (Fig. 2B). The anti-Myb antibody precipitated TIF1β, c-Ski, and mSin3A. Furthermore, c-Myb and TIF1β were coprecipitated using the anti-N-CoR antibodies. The control IgG precipitated none of the corepressors or c-Myb. We then asked whether the c-Myb complex contains HDAC activity. We used anti-Myb to generate the immunocomplexes from 293 cells that had been transfected with the c-Myb expression plasmid and assessed their HDAC activity. A significant level of HDAC activity was observed compared with the immunocomplexes prepared with control IgG (Fig. 2C). The immunocomplexes of the c-Myb mutant containing the mutated leucine-rich region in the NRD (L34P) had slightly lower HDAC activity than those containing wild-type c-Myb (Fig. 2C). These observations are consistent with the fact that TIF1β only partly interacts with c-Myb through the leucine-rich region. Using various forms of in vitro translated c-Myb, we determined which of the one or more regions of c-Myb is bound by c-Ski (Fig. 3A). The results obtained using GST-Ski fusion proteins indicate that c-Ski binds to the DBD of c-Myb (CT5), but not to the mutant lacking the DBD (ΔDB) (Supplementary Fig. 1, data are summarized in Fig. 3A). The region containing only R2 and R3 (R23) was sufficient for c-Ski interaction. Interestingly, removal of the NRD (CT3) or mutations in the leucine-rich region (L34A and L34P) almost completely abrogated the interaction with c-Ski, although c-Ski does not bind to NRD. It may be that the mutations or removal of NRD alters the conformation of some of the regions such as the transactivating domain, which then blocks access to c-Ski. We then performed GST pull-down assays using various forms of in vitro translated c-Myb and GST-mSin3A-NCT. The latter protein contains the central region of mSin3A bearing the second and third putative paired amphipathic helical domains (PAH2 and PAH3). This is the region responsible for binding to c-Myb (Supplementary Fig. 2A). As with c-Ski, mSin3A binds to R2 and R3 of c-Myb (Supplementary Fig. 2B, and data are summarized in Fig. 3A). The mutations of leucine-rich region of the NRD (L34A and L34P) also partly decrease the affinity with mSin3A, but removal of the NRD (CT3) does not affect the affinity with mSin3A. To determine which region of c-Myb interacts with N-CoR, similar assays were performed. c-Myb binds to the N-terminal 427-amino acid region of N-CoR (Supplementary Fig. 3A), and when GST-N-CoR, which contains this region, was used in GST pull-down assays, N-CoR was found to interact with R2 and R3 of c-Myb (Supplementary Fig. 3B, and data are summarized in Fig. 3A). However, the loss of NRD (CT3) or mutations of the leu

Referência(s)