Portal de Periódicos da CAPES

Sequential DNA Methylation of the Nanog and Oct-4 Upstream Regions in Human NT2 Cells during Neuronal Differentiation

2004; Elsevier BV; Volume: 280; Issue: 8 Linguagem: Inglês

10.1074/jbc.c400479200

1083-351X

Paromita Deb‐Rinker, Dao Ly, Anna Jezierski, Marianna Sikorska, P. Roy Walker,

CRISPR and Genetic Engineering

Human NT2 cells, which differentiate into neurons and astrocytes, initially express and then permanently down-regulate Nanog and Oct-4 (POU5F1). We investigated the relationship between the expression of these genes and the methylation state of their 5′-flanking regions. Gene expression and DNA methylation were assayed with quantitative polymerase chain reaction and bisulfite genomic sequencing, respectively. Retinoic acid-induced differentiation of NT2 cells to neurons is accompanied by a sequential decrease in the expression of both genes, paralleled by sequential epigenetic modification of their upstream regions. This is the first report demonstrating changes in DNA methylation in the promoter regions of Nanog and Oct-4 in a human cell line. Human NT2 cells, which differentiate into neurons and astrocytes, initially express and then permanently down-regulate Nanog and Oct-4 (POU5F1). We investigated the relationship between the expression of these genes and the methylation state of their 5′-flanking regions. Gene expression and DNA methylation were assayed with quantitative polymerase chain reaction and bisulfite genomic sequencing, respectively. Retinoic acid-induced differentiation of NT2 cells to neurons is accompanied by a sequential decrease in the expression of both genes, paralleled by sequential epigenetic modification of their upstream regions. This is the first report demonstrating changes in DNA methylation in the promoter regions of Nanog and Oct-4 in a human cell line. The Nanog and Oct-4 (POU5F1) transcription factors are key intrinsic determinants of self-renewal of embryonic stem cells (1Chambers I. Smith A. Oncogene. 2004; 23: 7150-7160Crossref PubMed Scopus (442) Google Scholar). Oct-4 is a member of the POU family of transcription factors and is expressed in both embryonic stem (ES) 1The abbreviations used are: ES, embryonic stem; RA, retinoic acid; EC, embryonal carcinoma; TSS, transcription start site; CR; conserved region. 1The abbreviations used are: ES, embryonic stem; RA, retinoic acid; EC, embryonal carcinoma; TSS, transcription start site; CR; conserved region. cells and embryonal carcinoma (EC) cells. Nanog, the most recently described homeodomain gene (2Chambers I. Colby D. Robertson M. Nichols J. Lee S. Tweedie S. Smith A. Cell. 2003; 113: 643-655Abstract Full Text Full Text PDF PubMed Scopus (2595) Google Scholar, 3Mitsui K. Tokuzawa Y. Itoh H. Segawa K. Murakami M. Takahashi K. Maruyama M. Maeda M. Yamanaka S. Cell. 2003; 113: 631-642Abstract Full Text Full Text PDF PubMed Scopus (2522) Google Scholar), is expressed in a restricted number of cell types and only in a subset of cells that express Oct-4, including embryonic stem cells (1Chambers I. Smith A. Oncogene. 2004; 23: 7150-7160Crossref PubMed Scopus (442) Google Scholar). It has been shown that Nanog function requires the continued presence of Oct-4 and together they support stem cell potency and self-renewal (4Cavaleri F. Scholer H.R. Cell. 2003; 113: 551-552Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). Oct-4 prevents the differentiation of the inner cell mass and embryonic stem cells into trophectoderm, while Nanog blocks the differentiation into primitive endoderm and actively maintains pluripotency (5Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (47) Google Scholar). Nanog and Oct-4 are both expressed in pluripotent mouse and human cell lines including the undifferentiated human embryonal carcinoma cell line, NT2/D1 (6Hart A.H. Hartley L. Ibrahim M. Robb L. Dev. Dyn. 2004; 230: 187-198Crossref PubMed Scopus (272) Google Scholar). The undifferentiated cells become committed to differentiate with retinoic acid (RA), unleashing a genetic program that involves the differential expression of more than 3000 genes (7Walker P.R. Ly D. Liu Q.-Y. Smith B. Sodja C. Ribecco M. Sikorska M. Janigro D. The Cell Cycle in the CNS. Humana Press, Totowa, NJ2005Google Scholar). Oct-4 protein levels are down-regulated in NT2 cells induced with RA to differentiate into neurons and glia (8Rosfjord E. Rizzino A. Biochem. Biophys. Res. Commun. 1994; 203: 1795-1802Crossref PubMed Scopus (35) Google Scholar). In an ongoing effort to gain an overall understanding of the contribution of genetic and epigenetic factors to the control of neurogenesis, this study evaluates the changes in expression of Nanog and Oct-4 in the early stages of neuronal differentiation in relation to DNA methylation of their upstream regions. Methylation of genomic CpG residues is known to play a key role in embryogenesis by silencing specific genes during development and differentiation. DNA methylation in the region 1.3 kb upstream of the mouse Oct-4 gene has previously been reported by following RA treatment of mouse OTF9–63 EC cells (9Ben-Shushan E. Pikarsky E. Klar A. Bergman Y. Mol. Cell. Biol. 1993; 13: 891-901Crossref PubMed Scopus (68) Google Scholar). These experiments, performed using methylation-sensitive restriction endonucleases, lacked base pair resolution but did establish that methylation operates in mouse cells. Subsequently, the mouse Oct-4 promoter was shown to undergo methylation at 6.5 days postcoitum in the whole embryo (10Gidekel S. Bergman Y. J. Biol. Chem. 2002; 277: 34521-34530Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). Moreover, Hattori et al. (11Hattori N. Nishino K. Ko Y.G. Hattori N. Ohgane J. Tanaka S. Shiota K. J. Biol. Chem. 2004; 279: 17063-17069Abstract Full Text Full Text PDF PubMed Scopus (342) Google Scholar) demonstrated methylation of the mouse Oct-4 promoter region in trophoblast stem cells. In an attempt to study the possibility of reversing the differentiation process, Tsuji-Takayama et al. (12Tsuji-Takayama K. Inoue T. Ijiri Y. Otani T. Motoda R. Nakamura S. Orita K. Biochem. Biophys. Res. Commun. 2004; 323: 86-90Crossref PubMed Scopus (68) Google Scholar) treated differentiated ES cells with a demethylating agent and found an increase in the expression of ES-specific genes such as Oct-4, Nanog, and Sox2. However, in this case, expression of any of these three genes could be an indirect consequence of demethylation of another gene. To our knowledge, the work presented here is the first report of direct changes in DNA methylation of specific sites within the promoter regions of human Oct-4 and Nanog genes during neurogenesis. We show that Nanog and Oct-4 are sequentially down-regulated early in RA-treated NT2 cells and that the decreases in gene expression are paralleled by dynamic, sequential methylation of CpG residues in both promoter regions as well as the enhancer region of Oct-4. Cell Culture and DNA Isolation—NT2/D1 cells (Stratagene, La Jolla, CA) were seeded at a density of 2 × 106 cells per T75 flask and treated with 10 μm RA (Sigma, Oakville, Ontario, Canada) for 2–12 days. Fresh RA and Dulbecco's modified Eagle's medium (Invitrogen, Burlington, Ontario, Canada) supplemented with 10% fetal bovine serum (Wisent, Saint-Jean, Quebec, Canada) were supplied every 2 days. Cells were harvested at different time points by trypsinization, centrifuged at 194 g for 5 min, and washed with phosphate-buffered saline. Total genomic DNA was isolated from each sample (adapted from Ref. 13Miller S.A. Dykes D.D. Polesky H.F. Nucleic Acids Res. 1988; 16: 1215Crossref PubMed Scopus (17628) Google Scholar). Quantitative PCR—RNA was isolated with TriReagent (Bio-Can Scientific, Mississauga, Ontario, Canada), and a 20 μg/sample was used for cDNA synthesis using Superscript II reverse transcriptase (Invitrogen). Each duplicate quantitative PCR reaction contained 2 ng of cDNA and a 0.15 μm concentration of each primer in a 25-μl reaction volume. The 2 × PCR SYBR Green master mix was purchased from Applied Biosystems (Foster City, CA). PCR reactions were carried out in an Applied Biosystems 7000 machine as follows: 50 °C for 2 min for 1 cycle, 95 °C for 10 min for 1 cycle, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. A dissociation curve was run at the end of the reaction for product specificity. Bisulfite Genomic Sequencing—The EZ DNA methylation kit (Zymo Research, Orange, CA) was used to detect cytosine methylation. The sodium bisulfite treatment used 750 ng of genomic DNA. Briefly, the DNA was denatured with a dilution buffer containing 2 m NaOH and incubated overnight at 50 °C with CT conversion reagent, followed by a clean-up, desulfonation, and elution. The bisulfite-modified DNA was used immediately for PCR or stored at –70 °C. For PCR amplification, 2.5 μl of bisulfite-modified DNA was added in a final volume of 50 μl, containing 1 × PCR buffer (16.6 mm ammonium sulfate, 67 mm Tris, pH 8.8, 6.7 mm MgCl2, 10 mm 2-mercaptoethanol), dNTPs (1.25 mm concentration each), primers (1 pmol each), and 2.5 units of Hi Fidelity Platinum Taq (Invitrogen). The primers were designed to recognize the bisulfite-converted DNA only (Table I). PCR reactions were carried out in a MJ Research cycler (Waltham, MA) using the following protocol: 95 °C for 10 min, 35 cycles of 95 °C for 1 min, 50–58 °C for 1 min, and 72 °C for 1 min, followed by an extension at 72 °C for 10 min and soak at 4 °C. After electrophoresis on a 2% agarose gel the remaining PCR products were cloned (Zero Blunt End, Invitrogen). Ten clones for each ligation were randomly picked and sequenced on an Applied Biosystems 377 instrument.Table IA list of primers, their sequences, and the annealing temperatures used for PCRPrimer (GenBank™ accession no.)SequenceAnnealing temperatureQPCRNanog-F (NM_024865)GCAGAAGGCCTCAGCACCTA60Nanog-RAGGTTCCCAGTCGGGTTCAOct4-F (Z11898)GCTCGAGAAGGATGTGGTCC60Oct4-RCGTTGTGCATAGTCGCTGCTN-Oct3-F (Z11933)GAGCGAGGAGAGGGAGCC60N-Oct3-RTCTCGGAGCCGGACTGAGPax6-F (NM_000280)CACACCGGTTTCCTCCTTCA60Pax6-RGGCAGAGCGCTGTAGGTGTTSox2-F (Z11898)CACTGCCCCTCTCACACATG60Sox2-RTCCCATTTCCCTCGTTTTTCTBisulfite PCRNanog-FTTAATTTATTGGGATTATAGGGGTG58Nanog-RAAACCTAAAAACAAACCCAACAACOct4-1FTTTTTAGTTTTTTTTAGGTTTAA50Oct4-1RTAAACAAAAAACCCATTCCCOct4-2FTTAGGAAAATGGGTAGTAGGGATTT58Oct4-2RTACCCAAAAAACAAATAAATTATAAAACCTOct4-3FATTTGTTTTTTGGGTAGTTAAAGGT58Oct4-3RCCAACTATCTTCATCTTAATAACATCCOct4-4FGGATGTTATTAAGATGAAGATAGTTGG58Oct4-4RCCTAAACTCCCCTTCAAAATCTATTOct4-5FAATAGATTTTGAAGGGGAGTTTAGG58Oct4-5RTTCCTCCTTCCTCTAAAAAACTCAOct4-6FGAAGGGGAAGTAGGGATTAATTTT58Oct4-6RCAACAACCATAAACACAATAACCAAOct4-7FTAGTTGGGATGTGTAGAGTTTGAGA58Oct4-7RTAAACCAAAACAATCCTTCTACTCCOct4-8FAAGTTTTTGTGGGGGATTTGTAT58Oct4-8RCCACCCACTAACCTTAACCTCTAOct4-9FGTTAGAGGTTAAGGTTAGTGGGTG58Oct4-9RAAACCTTAAAAACTTAACCAAATCC Open table in a new tab Down-regulation of the Human Nanog and Oct-4 Genes following RA Treatment—Quantitative PCR analysis of RNA extracted following RA treatment of NT2/D1 cells shows a decline in the expression levels of Oct-4 and Nanog (Fig. 1). Nanog expression starts to decline immediately, whereas there is a two-day delay before Oct-4 expression declines. The expression of Sox2, a binding partner for Oct-4, does not change. Pax6, a marker for radial glia and N-Oct3 (POU3F2), which is essential for neuronal migration and corticogenesis; each shows an increase in gene expression coinciding with the down-regulation of Nanog and Oct-4. Both Oct-4 and Nanog show a significant drop in gene expression by day 4 and are reduced to very low levels by days 6 and 8 of RA treatment. DNA Methylation Status of the 5′-Flanking Region of the Human Nanog Gene—Human Nanog is a newly identified gene on chromosome 12p13.31, whose promoter has not been characterized. The gene has 4 exons and 3 introns, comparable with the mouse chromosome 6 homolog (14Clark A.T. Rodriguez R.T. Bodnar M.S. Abeyta M.J. Cedars M.I. Turek P.J. Firpo M.T. Reijo Pera R.A. Stem Cells. 2004; 22: 169-179Crossref PubMed Scopus (202) Google Scholar, 15Booth H.A. Holland P.W. Genomics. 2004; 84: 229-238Crossref PubMed Scopus (112) Google Scholar). We examined a section of DNA 500 bases upstream of the transcription start site (TSS). This probable promoter region shares homology with the mouse upstream region (1Chambers I. Smith A. Oncogene. 2004; 23: 7150-7160Crossref PubMed Scopus (442) Google Scholar), including conserved Oct-4 and Sox2 DNA-binding domains located at –104 to –118 bp. CpGs are sparsely spaced in this stretch of DNA. However, we observed a change in the methylation status for three closely spaced sites starting at day 4 of RA treatment (Fig. 2). This cluster is ∼200 bp upstream of the Oct-4/Sox2-binding domain. These sites are unmethylated (presence of an A residue, indicating a T residue on the opposite strand) in the undifferentiated state (Fig. 3) and remain methylated at day 10 RA (presence of a G residue indicating a methylated cytosine on the opposite strand, which does not convert to a T following bisulfite treatment). The percentage of clones with methylation at the three sites shows a steady increase from day 4 RA onwards, and the cluster remains methylated (>50%) beyond day 8 of RA treatment (Fig. 2) corresponding to the silencing of the gene.Fig. 3Bisulfite sequencing of the 5′-upstream region of the Nanog gene. The three CpG sites (along with their locations) that get methylated at day 10 RA are shown with the arrows. Unmethylated CpGs are represented by an A, indicating a T residue on the opposite strand. The presence of a G residue indicates a methylated cytosine on the opposite strand.View Large Image Figure ViewerDownload Hi-res image Download (PPT) DNA Methylation Profile of the 5′-Flanking Region of the Human Oct-4 Gene—The human Oct-4 gene, located on chromosome 6p21.31 is alternatively spliced, encoding two isoforms, 1 and 2. For this study, we looked at the region upstream of isoform 1 (GenBank™ accession number AJ297527), which has 5 exons and 4 introns. The gene encodes an mRNA sequence of 1413 bp and a protein of 360 amino acids (GenBank™ accession number NM_002701). There is no CpG island at the 5′ end of the Oct-4 gene (16Li L.C. Dahiya R. Bioinformatics. 2002; 18: 1427-1431Crossref PubMed Scopus (1913) Google Scholar), although CpG dinucleotide sequences are fairly abundant. We investigated the methylation status of 45 CpGs (Fig. 4) between –2973 and +153 bp from the TSS (+1). This region spans the proximal promoter and the proximal and distal enhancers (17Nordhoff V. Hubner K. Bauer A. Orlova I. Malapetsa A. Scholer H.R. Mamm. Genome. 2001; 12: 309-317Crossref PubMed Scopus (144) Google Scholar). Most of these sites are unmethylated in the undifferentiated cells, and there is a gradual increase in methylation by day 8 RA, which becomes much more extensive by day 12 of RA treatment (Fig. 4). In addition, the promoter/enhancer region has seven constitutively methylated CpGs between –464 and –825 (between the proximal promoter and the proximal enhancer) and two sites at –2724 and –2733 (upstream of the distal enhancer). The block of seven sites, already methylated in the undifferentiated cells remains methylated throughout, although there is an increase in the percentage of methylated clones even for these sites, increasing from 61% at day 0 to 90% by day 12 RA. Interestingly, the CpGs at different sites become methylated with different kinetics during the differentiation process (Fig. 4). Once methylated, the sites do not undergo demethylation at a later stage and the gene remains repressed. The specification of cell lineages in the developing brain is thought to be regulated by extrinsic and intrinsic factors. The intrinsic program of neuronal differentiation in NT2 cells, for example, involves the sequential expression of specific transcription factors, receptors, and signaling molecules (7Walker P.R. Ly D. Liu Q.-Y. Smith B. Sodja C. Ribecco M. Sikorska M. Janigro D. The Cell Cycle in the CNS. Humana Press, Totowa, NJ2005Google Scholar). The cells pass through a series of transient states; epigenetic modifications such as chromatin remodeling and DNA methylation play a key role in defining these states. CpG dinucleotides are the major target for DNA methylation, with cytosines on both strands being prone to modification to 5-methylcytosine. This has been shown to be a major mechanism of transcriptional silencing (18Siegfried Z. Eden S. Mendelsohn M. Feng X. Tsuberi B.Z. Cedar H. Nat. Genet. 1999; 22: 203-206Crossref PubMed Scopus (279) Google Scholar). Most vertebrate DNA is de novo methylated at cytosine residues of CpG dinucleotides and must be demethylated to permit transcription. Stretches of GC-rich and relatively CpG-rich DNA sequences co-localize with some, but not all, promoter regions of genes. Methylation of only a few of these CpG sites can significantly down-regulate promoter activity (19Gonzalgo M.L. Hayashida T. Bender C.M. Pao M.M. Tsai Y.C. Gonzales F.A. Nguyen H.D. Nguyen T.T. Jones P.A. Cancer Res. 1998; 58: 1245-1252PubMed Google Scholar). Methyl-CpG is now recognized as a gene-silencing signal (20Zhang Z. Chen C.Q. Manev H. J. Neurochem. 2004; 88: 1424-1430Crossref PubMed Scopus (27) Google Scholar) because methylated CpG either interferes with the DNA binding of transcription factors or recruits methylated cytosine-binding domain proteins, which then engage other corepressors such as histone deacetylases. Since Nanog and Oct-4 are specifically expressed in undifferentiated NT2 cells, we sought to define a relationship between DNA methylation and gene expression in an in vitro model of human neurogenesis. This model consists of proliferating NT2 precursors that can be differentiated into postmitotic neurons and astrocytes with RA. To examine the methylation status of the two genes, we used the bisulfite sequencing method (21Clark S.J. Harrison J. Paul C.L. Frommer M. Nucleic Acids Res. 1994; 22: 2990-2997Crossref PubMed Scopus (1599) Google Scholar), which permits a comprehensive examination of every methylated CpG site in a target sequence. We show that CpG dinucleotides in the promoter region of both genes, as well as the enhancer region of Oct-4, are predominantly unmethylated in the undifferentiated state when the genes are active. As differentiation proceeds, the CpG dinucleotides become substantially methylated. DNA methylation of the two genes is sequential, paralleling their sequential decrease in expression, an exception being the unusual block of constitutively methylated CpG sites immediately upstream of the Oct-4 proximal promoter. This is a unique observation; however, the function of this block is unknown. We think that it could be a mark to initiate chromatin modification and/or DNA methylation to silence the proximal promoter and enhancer as the cells leave the stem or embryonal cell state following RA treatment. Since the human Oct-4 promoter has not been clearly defined, we have based our interpretation of the results on the comparative analyses of the human, mouse, and bovine Oct-4 upstream regions by Nordhoff et al. (17Nordhoff V. Hubner K. Bauer A. Orlova I. Malapetsa A. Scholer H.R. Mamm. Genome. 2001; 12: 309-317Crossref PubMed Scopus (144) Google Scholar). They identified four highly conserved sequences in the human Oct-4 upstream region, CR1 (–74 to +56), CR2 (–1454 to –1259), CR3 (–1900 to –1796), and CR4 (–2501 to –2370), all relative to the TSS. CR1 spans the proximal promoter and almost completely overlaps in the three species. The CR2 region partially overlaps in the human and bovine sequences. In the mouse sequence, CR2 and CR4 span the proximal and distal enhancers, respectively. To date, no DNA binding activity has been associated with CR3. From our results, it is clear that three of the four CpG sites in the human proximal promoter are not methylated in the undifferentiated stage and are de novo methylated at later stages of differentiation. Expression of the Oct-4 gene in EC cells requires occupancy by transcription factors or other DNA-binding proteins of sites in the proximal promoter as well as the proximal and distal enhancers. Rapid down-regulation by retinoic acid is paralleled by the release of factors from all three sites (22Minucci S. Botquin V. Yeom Y.I. Dey A. Sylvester I. Zand D.J. Ohbo K. Ozato K. Scholer H.R. EMBO J. 1996; 15: 888-899Crossref PubMed Scopus (85) Google Scholar, 23Dey A. Ozato K. Methods. 1997; 11: 197-204Crossref PubMed Scopus (9) Google Scholar) followed by the transient binding of repressor complexes (24Schoorlemmer J. Jonk L. Sanbing S. van Puijenbroek A. Feijen A. Kruijer W. Mol. Biol. Rep. 1995; 21: 129-140Crossref PubMed Scopus (34) Google Scholar, 25Fuhrmann G. Sylvester I. Scholer H.R. Cell. Mol. Biol. (Noisy-le-grand). 1999; 45: 717-724PubMed Google Scholar). Since DNA methylation commences soon after, it is unlikely to play a direct role in the cessation of transcriptional activity but ensures long term silencing of the gene. Similar studies remain to be carried out for Nanog. In both genes, there is a significant delay between decreasing levels of transcript and increased methylation, suggesting that methylation per se is not the primary event in switching off gene transcription but is involved in a later step of silencing. In one of the few other studies on the kinetics of DNA methylation, Mutskov and Felsenfeld (26Mutskov V. Felsenfeld G. EMBO J. 2004; 23: 138-149Crossref PubMed Scopus (236) Google Scholar) recently studied the transcriptional silencing of stably integrated transgenes and specifically excluded DNA methylation as the primary causative event. They propose the loss of histone acetylation and H3 K4 di- and trimethylation as early steps in a sequence of events leading up to the process of silencing. Initially, the gene is repressed reversibly, since transcription can be partially reactivated by inhibition of histone deacetylases. Methylation of histone H3 K9 and of DNA cytosines in the promoters are later events that could "lock" this stable silenced chromatin state. Whether these rules hold true for endogenous genes as well has not been determined. However, it has indeed been suggested in the case of mouse Oct-4 (10Gidekel S. Bergman Y. J. Biol. Chem. 2002; 277: 34521-34530Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar) and our results certainly support such a model. In both cases, the presence of promoter region CpG methylation almost certainly imposes an inability to return to an active state. To determine whether histone modification plays a key role for gene silencing in this case, we plan to do a comprehensive study where histone modifications at the Oct-4 and Nanog upstream regions will be analyzed by chromatin immunoprecipitation-PCR assays. Finally, it is clear that exit from an embryonal or stem cell state is effected, at least in part, by methylation of the promoter regions of two key determinants of self-renewal, Nanog and Oct-4. From this point on, the cells are committed to differentiate or die by apoptosis, and in the case of RA-stimulated NT2 cells, they immediately express the Pax6 gene, a determinant of the radial glia phenotype. Thus, the establishment of a normally regulated pattern of DNA methylation is essential for proper development and the importance of this epigenetic modification is emphasized by the fact that abnormalities in regulating DNA methylation are frequently associated with tumorigenesis and cell aging. In addition, DNA methylation has been implicated in a number of other distinct cellular processes including transcriptional regulation, embryogenesis, regulation of chromatin structure, genomic imprinting, X-inactivation, etc. However, the list of developmentally regulated genes that have been examined in the context of methylation is very short. This study emphasizes the importance of elucidating the role of methylation in the control of more genes like Nanog and Oct-4 that are critical in maintaining the phenotype of ES cells. We thank Julie LeBlanc for maintaining the cell cultures and RNA extractions and J. C. Achenbach for DNA sequencing. We are very grateful to Tom Devecseri for his help with the figures.